data_1A9L # _entry.id 1A9L # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1A9L pdb_00001a9l 10.2210/pdb1a9l/pdb WWPDB D_1000170563 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 2A9L _pdbx_database_related.details 'MINIMIZED AVERAGE STRUCTURE' _pdbx_database_related.content_type 'representative structure' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1A9L _pdbx_database_status.recvd_initial_deposition_date 1998-04-07 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Diener, J.L.' 1 'Moore, P.B.' 2 # _citation.id primary _citation.title 'Solution structure of a substrate for the archaeal pre-tRNA splicing endonucleases: the bulge-helix-bulge motif.' _citation.journal_abbrev Mol.Cell _citation.journal_volume 1 _citation.page_first 883 _citation.page_last 894 _citation.year 1998 _citation.journal_id_ASTM MOCEFL _citation.country US _citation.journal_id_ISSN 1097-2765 _citation.journal_id_CSD 2168 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9660971 _citation.pdbx_database_id_DOI '10.1016/S1097-2765(00)80087-8' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Diener, J.L.' 1 ? primary 'Moore, P.B.' 2 ? # _cell.entry_id 1A9L _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1A9L _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'PRE-TRNA BULGE-HELIX-BULGE MOTIF' _entity.formula_weight 12317.423 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGUGACUCCAGAGGUCGAGAGACCGGAGAUAUCACCC _entity_poly.pdbx_seq_one_letter_code_can GGGUGACUCCAGAGGUCGAGAGACCGGAGAUAUCACCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 U n 1 5 G n 1 6 A n 1 7 C n 1 8 U n 1 9 C n 1 10 C n 1 11 A n 1 12 G n 1 13 A n 1 14 G n 1 15 G n 1 16 U n 1 17 C n 1 18 G n 1 19 A n 1 20 G n 1 21 A n 1 22 G n 1 23 A n 1 24 C n 1 25 C n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 U n 1 32 A n 1 33 U n 1 34 C n 1 35 A n 1 36 C n 1 37 C n 1 38 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details ;THE MOLECULE WAS SYNTHESIZED IN VITRO BY T7 POLYMERASE RNA TRANSCRIPTION USING CHEMICALLY SYNTHESIZED DNA OLIGONUCLEOTIDES AS TEMPLATES ; # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1A9L _struct_ref.pdbx_db_accession 1A9L _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1A9L _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 38 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1A9L _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 38 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 38 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _pdbx_nmr_exptl.experiment_id 1 _pdbx_nmr_exptl.conditions_id 1 _pdbx_nmr_exptl.type 'SEE JRNL REFERENCE' _pdbx_nmr_exptl.solution_id 1 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 ? 7.0 ? . K 2 303 ? 7.0 ? . K # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 UNITY Varian 500 2 UNITYPLUS GE 600 3 OMEGA GE 600 # _pdbx_nmr_refine.entry_id 1A9L _pdbx_nmr_refine.method 'TORSION ANGLE MOLECULAR DYNAMICS' _pdbx_nmr_refine.details 'REFINEMENT DETAILS CAN BE FOUND IN THE JOURNAL CITATION ABOVE. X-PLOR 3.851 ALSO WAS USED.' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 1A9L _pdbx_nmr_ensemble.conformers_calculated_total_number 65 _pdbx_nmr_ensemble.conformers_submitted_total_number 12 _pdbx_nmr_ensemble.conformer_selection_criteria 'LEAST RESTRAINT VIOLATION' # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement CNS ? 'BRUNGER,ADAMS,CLORE,DELANO,GROS, GROSSE-KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,READ,RICE,SIMONSON,WARREN' 1 'structure solution' X-PLOR 3.851 ? 2 'structure solution' CNS ? ? 3 # _exptl.entry_id 1A9L _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 1A9L _struct.title 'SOLUTION STRUCTURE OF A SUBSTRATE FOR THE ARCHAEAL PRE-TRNA SPLICING ENDONUCLEASES: THE BULGE-HELIX-BULGE MOTIF, NMR, 12 STRUCTURES' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1A9L _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'ARCHAEAL BULGE-HELIX-BULGE MOTIF, PRE-TRNA SPLICING, ARCHAEA, RNA STRUCTURE, RIBONUCLEIC ACID, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 37 N3 ? ? A G 2 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 37 O2 ? ? A G 2 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 37 N4 ? ? A G 2 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 35 N1 ? ? A U 4 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 35 N6 ? ? A U 4 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 5 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 5 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 5 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 6 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 6 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 7 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 7 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 7 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 28 N1 ? ? A U 8 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 8 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 9 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 9 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 9 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 10 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 10 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 10 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 14 A C 24 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog29 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 14 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 14 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 14 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 15 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 15 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 15 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 23 N1 ? ? A U 16 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 23 N6 ? ? A U 16 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 17 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 17 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 17 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1A9L _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1A9L _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 G 5 5 5 G G A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 C 10 10 10 C C A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 U 16 16 16 U U A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 A 19 19 19 A A A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 G 26 26 26 G G A . n A 1 27 G 27 27 27 G G A . n A 1 28 A 28 28 28 A A A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 U 31 31 31 U U A . n A 1 32 A 32 32 32 A A A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 C 37 37 37 C C A . n A 1 38 C 38 38 38 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1998-06-17 2 'Structure model' 1 1 2008-03-05 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' 3.851 ? 1 X-PLOR refinement 3.851 ? 2 X-PLOR phasing 3.851 ? 3 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 4 "HO2'" A G 12 ? ? "O4'" A A 13 ? ? 1.59 2 10 "HO2'" A G 12 ? ? "O4'" A A 13 ? ? 1.58 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C4'" A A 6 ? ? "C3'" A A 6 ? ? "C2'" A A 6 ? ? 96.43 102.60 -6.17 1.00 N 2 1 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 117.52 109.80 7.72 0.90 N 3 1 "O4'" A G 12 ? ? "C1'" A G 12 ? ? N9 A G 12 ? ? 114.99 108.50 6.49 0.70 N 4 1 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 95.65 102.60 -6.95 1.00 N 5 1 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 124.26 114.00 10.26 1.30 N 6 1 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 101.68 108.20 -6.52 0.80 N 7 1 "O3'" A G 18 ? ? P A A 19 ? ? "O5'" A A 19 ? ? 117.04 104.00 13.04 1.90 Y 8 1 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.77 129.30 3.47 0.50 N 9 1 N9 A A 21 ? ? C4 A A 21 ? ? C5 A A 21 ? ? 108.48 105.80 2.68 0.40 N 10 1 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 114.82 109.90 4.92 0.80 N 11 1 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.14 120.30 -3.16 0.40 N 12 1 N9 A A 30 ? ? "C1'" A A 30 ? ? "C2'" A A 30 ? ? 122.16 114.00 8.16 1.30 N 13 2 "O4'" A A 6 ? ? "C1'" A A 6 ? ? N9 A A 6 ? ? 113.33 108.50 4.83 0.70 N 14 2 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 126.97 114.00 12.97 1.30 N 15 2 "O4'" A G 12 ? ? "C1'" A G 12 ? ? N9 A G 12 ? ? 102.40 108.20 -5.80 0.80 N 16 2 "C3'" A G 12 ? ? "O3'" A G 12 ? ? P A A 13 ? ? 127.49 119.70 7.79 1.20 Y 17 2 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 129.09 114.00 15.09 1.30 N 18 2 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 100.47 108.20 -7.73 0.80 N 19 2 "O3'" A G 18 ? ? P A A 19 ? ? "O5'" A A 19 ? ? 117.00 104.00 13.00 1.90 Y 20 2 "O4'" A A 19 ? ? "C1'" A A 19 ? ? N9 A A 19 ? ? 113.47 108.50 4.97 0.70 N 21 2 "C3'" A A 21 ? ? "C2'" A A 21 ? ? "C1'" A A 21 ? ? 106.71 101.50 5.21 0.80 N 22 2 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.72 129.30 3.42 0.50 N 23 2 N9 A A 21 ? ? C4 A A 21 ? ? C5 A A 21 ? ? 108.35 105.80 2.55 0.40 N 24 2 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.94 118.60 -3.66 0.60 N 25 2 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.56 109.90 5.66 0.80 N 26 2 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.53 120.30 -2.77 0.40 N 27 2 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 122.77 114.00 8.77 1.30 N 28 2 "O4'" A U 31 ? ? "C1'" A U 31 ? ? N1 A U 31 ? ? 113.38 108.50 4.88 0.70 N 29 3 C6 A C 7 ? ? N1 A C 7 ? ? C2 A C 7 ? ? 117.79 120.30 -2.51 0.40 N 30 3 "C3'" A A 11 ? ? "C2'" A A 11 ? ? "C1'" A A 11 ? ? 96.97 101.30 -4.33 0.70 N 31 3 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 127.55 116.00 11.55 1.60 N 32 3 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 116.78 109.80 6.98 0.90 N 33 3 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 125.88 114.00 11.88 1.30 N 34 3 "C3'" A A 13 ? ? "C2'" A A 13 ? ? "C1'" A A 13 ? ? 96.96 101.30 -4.34 0.70 N 35 3 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 126.42 114.00 12.42 1.30 N 36 3 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 103.06 108.20 -5.14 0.80 N 37 3 C8 A A 13 ? ? N9 A A 13 ? ? C4 A A 13 ? ? 103.00 105.80 -2.80 0.40 N 38 3 N3 A G 14 ? ? C4 A G 14 ? ? N9 A G 14 ? ? 130.08 126.00 4.08 0.60 N 39 3 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.55 109.90 5.65 0.80 N 40 3 "O4'" A C 25 ? ? "C1'" A C 25 ? ? N1 A C 25 ? ? 113.52 108.50 5.02 0.70 N 41 3 "C3'" A G 26 ? ? "C2'" A G 26 ? ? "C1'" A G 26 ? ? 108.70 101.50 7.20 0.80 N 42 3 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 124.61 114.00 10.61 1.30 N 43 3 "O4'" A U 31 ? ? "C1'" A U 31 ? ? N1 A U 31 ? ? 102.59 108.20 -5.61 0.80 N 44 4 "O4'" A C 10 ? ? "C1'" A C 10 ? ? N1 A C 10 ? ? 113.38 108.50 4.88 0.70 N 45 4 "C3'" A A 11 ? ? "C2'" A A 11 ? ? "C1'" A A 11 ? ? 96.87 101.30 -4.43 0.70 N 46 4 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 128.71 116.00 12.71 1.60 N 47 4 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 115.70 109.80 5.90 0.90 N 48 4 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 124.35 114.00 10.35 1.30 N 49 4 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 95.26 102.60 -7.34 1.00 N 50 4 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 123.71 114.00 9.71 1.30 N 51 4 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 103.27 108.20 -4.93 0.80 N 52 4 "C4'" A G 18 ? ? "C3'" A G 18 ? ? "C2'" A G 18 ? ? 95.47 102.60 -7.13 1.00 N 53 4 "O4'" A G 18 ? ? "C1'" A G 18 ? ? N9 A G 18 ? ? 112.82 108.50 4.32 0.70 N 54 4 "C3'" A G 18 ? ? "O3'" A G 18 ? ? P A A 19 ? ? 128.97 119.70 9.27 1.20 Y 55 4 "C5'" A A 19 ? ? "C4'" A A 19 ? ? "C3'" A A 19 ? ? 132.81 116.00 16.81 1.60 N 56 4 "C1'" A A 19 ? ? "O4'" A A 19 ? ? "C4'" A A 19 ? ? 100.96 109.70 -8.74 0.70 N 57 4 "C4'" A A 19 ? ? "C3'" A A 19 ? ? "C2'" A A 19 ? ? 95.19 102.60 -7.41 1.00 N 58 4 N9 A A 19 ? ? "C1'" A A 19 ? ? "C2'" A A 19 ? ? 124.41 114.00 10.41 1.30 N 59 4 "O4'" A G 20 ? ? "C4'" A G 20 ? ? "C3'" A G 20 ? ? 96.18 104.00 -7.82 1.00 N 60 4 N9 A G 20 ? ? "C1'" A G 20 ? ? "C2'" A G 20 ? ? 122.29 114.00 8.29 1.30 N 61 4 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 116.13 113.10 3.03 0.50 N 62 4 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 116.38 109.90 6.48 0.80 N 63 4 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.35 120.30 -2.95 0.40 N 64 4 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 122.96 114.00 8.96 1.30 N 65 4 "O4'" A A 32 ? ? "C4'" A A 32 ? ? "C3'" A A 32 ? ? 97.88 104.00 -6.12 1.00 N 66 5 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.82 108.50 5.32 0.70 N 67 5 "C4'" A A 6 ? ? "C3'" A A 6 ? ? "C2'" A A 6 ? ? 96.47 102.60 -6.13 1.00 N 68 5 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 123.73 114.00 9.73 1.30 N 69 5 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 93.98 102.60 -8.62 1.00 N 70 5 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 127.14 114.00 13.14 1.30 N 71 5 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 99.89 108.20 -8.31 0.80 N 72 5 N9 A G 14 ? ? "C1'" A G 14 ? ? "C2'" A G 14 ? ? 123.39 114.00 9.39 1.30 N 73 5 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 116.12 113.10 3.02 0.50 N 74 5 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.67 106.40 -2.73 0.40 N 75 5 "O4'" A C 17 ? ? "C1'" A C 17 ? ? N1 A C 17 ? ? 114.57 108.50 6.07 0.70 N 76 5 "O3'" A G 18 ? ? P A A 19 ? ? "O5'" A A 19 ? ? 116.55 104.00 12.55 1.90 Y 77 5 "O4'" A A 19 ? ? "C1'" A A 19 ? ? N9 A A 19 ? ? 113.18 108.50 4.68 0.70 N 78 5 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.41 109.90 5.51 0.80 N 79 5 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.33 120.30 -2.97 0.40 N 80 5 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 122.53 114.00 8.53 1.30 N 81 6 "O4'" A C 10 ? ? "C1'" A C 10 ? ? N1 A C 10 ? ? 114.13 108.50 5.63 0.70 N 82 6 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 94.96 102.60 -7.64 1.00 N 83 6 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.53 129.30 3.23 0.50 N 84 6 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.99 118.60 -3.61 0.60 N 85 6 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.87 120.30 -2.43 0.40 N 86 6 "C3'" A A 30 ? ? "C2'" A A 30 ? ? "C1'" A A 30 ? ? 96.41 101.30 -4.89 0.70 N 87 6 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 122.19 114.00 8.19 1.30 N 88 7 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 123.75 114.00 9.75 1.30 N 89 7 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 95.38 102.60 -7.22 1.00 N 90 7 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 126.69 114.00 12.69 1.30 N 91 7 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 102.14 108.20 -6.06 0.80 N 92 7 "C3'" A A 21 ? ? "C2'" A A 21 ? ? "C1'" A A 21 ? ? 106.51 101.50 5.01 0.80 N 93 7 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.66 129.30 3.36 0.50 N 94 7 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.86 118.60 -3.74 0.60 N 95 7 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.97 109.90 6.07 0.80 N 96 7 "C3'" A A 30 ? ? "C2'" A A 30 ? ? "C1'" A A 30 ? ? 96.39 101.30 -4.91 0.70 N 97 7 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 122.14 114.00 8.14 1.30 N 98 7 "O4'" A A 32 ? ? "C1'" A A 32 ? ? N9 A A 32 ? ? 113.16 108.50 4.66 0.70 N 99 8 "O4'" A C 10 ? ? "C1'" A C 10 ? ? N1 A C 10 ? ? 113.71 108.50 5.21 0.70 N 100 8 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 126.52 116.00 10.52 1.60 N 101 8 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 124.76 114.00 10.76 1.30 N 102 8 "O4'" A C 17 ? ? "C1'" A C 17 ? ? N1 A C 17 ? ? 113.79 108.50 5.29 0.70 N 103 8 "O3'" A G 18 ? ? P A A 19 ? ? "O5'" A A 19 ? ? 116.26 104.00 12.26 1.90 Y 104 8 "O4'" A A 19 ? ? "C1'" A A 19 ? ? N9 A A 19 ? ? 112.94 108.50 4.44 0.70 N 105 8 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.69 109.90 5.79 0.80 N 106 8 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.30 120.30 -3.00 0.40 N 107 9 "C4'" A A 6 ? ? "C3'" A A 6 ? ? "C2'" A A 6 ? ? 96.35 102.60 -6.25 1.00 N 108 9 "O4'" A C 10 ? ? "C1'" A C 10 ? ? N1 A C 10 ? ? 113.90 108.50 5.40 0.70 N 109 9 "C3'" A A 11 ? ? "C2'" A A 11 ? ? "C1'" A A 11 ? ? 96.65 101.30 -4.65 0.70 N 110 9 "O4'" A A 11 ? ? "C1'" A A 11 ? ? N9 A A 11 ? ? 103.16 108.20 -5.04 0.80 N 111 9 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 129.75 116.00 13.75 1.60 N 112 9 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 115.21 109.80 5.41 0.90 N 113 9 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 125.04 114.00 11.04 1.30 N 114 9 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 93.80 102.60 -8.80 1.00 N 115 9 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 126.24 114.00 12.24 1.30 N 116 9 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 101.74 108.20 -6.46 0.80 N 117 9 N9 A G 14 ? ? "C1'" A G 14 ? ? "C2'" A G 14 ? ? 122.20 114.00 8.20 1.30 N 118 9 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 116.15 113.10 3.05 0.50 N 119 9 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.83 106.40 -2.57 0.40 N 120 9 C6 A G 14 ? ? C5 A G 14 ? ? N7 A G 14 ? ? 126.73 130.40 -3.67 0.60 N 121 9 "O4'" A C 17 ? ? "C1'" A C 17 ? ? N1 A C 17 ? ? 113.01 108.50 4.51 0.70 N 122 9 N1 A G 18 ? ? C2 A G 18 ? ? N2 A G 18 ? ? 110.65 116.20 -5.55 0.90 N 123 9 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.90 129.30 3.60 0.50 N 124 9 N9 A A 21 ? ? C4 A A 21 ? ? C5 A A 21 ? ? 108.30 105.80 2.50 0.40 N 125 9 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.90 118.60 -3.70 0.60 N 126 9 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.64 109.90 5.74 0.80 N 127 9 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.88 120.30 -2.42 0.40 N 128 9 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 125.13 114.00 11.13 1.30 N 129 9 "O4'" A U 31 ? ? "C1'" A U 31 ? ? N1 A U 31 ? ? 102.29 108.20 -5.91 0.80 N 130 10 "C3'" A A 11 ? ? "C2'" A A 11 ? ? "C1'" A A 11 ? ? 97.00 101.30 -4.30 0.70 N 131 10 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 129.68 116.00 13.68 1.60 N 132 10 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 116.18 109.80 6.38 0.90 N 133 10 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 123.79 114.00 9.79 1.30 N 134 10 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 95.14 102.60 -7.46 1.00 N 135 10 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 124.09 114.00 10.09 1.30 N 136 10 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 102.16 108.20 -6.04 0.80 N 137 10 "C3'" A A 21 ? ? "C2'" A A 21 ? ? "C1'" A A 21 ? ? 106.34 101.50 4.84 0.80 N 138 10 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.56 129.30 3.26 0.50 N 139 10 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.88 118.60 -3.72 0.60 N 140 10 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.89 109.90 5.99 0.80 N 141 10 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.37 120.30 -2.93 0.40 N 142 10 "O4'" A U 31 ? ? "C4'" A U 31 ? ? "C3'" A U 31 ? ? 95.26 104.00 -8.74 1.00 N 143 10 "C1'" A U 31 ? ? "O4'" A U 31 ? ? "C4'" A U 31 ? ? 104.42 109.70 -5.28 0.70 N 144 10 "O4'" A U 31 ? ? "C1'" A U 31 ? ? N1 A U 31 ? ? 115.54 108.50 7.04 0.70 N 145 10 "O4'" A A 32 ? ? "C1'" A A 32 ? ? N9 A A 32 ? ? 113.11 108.50 4.61 0.70 N 146 11 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.03 108.50 4.53 0.70 N 147 11 C6 A C 7 ? ? N1 A C 7 ? ? C2 A C 7 ? ? 117.61 120.30 -2.69 0.40 N 148 11 "O4'" A C 10 ? ? "C1'" A C 10 ? ? N1 A C 10 ? ? 113.47 108.50 4.97 0.70 N 149 11 "C3'" A A 11 ? ? "C2'" A A 11 ? ? "C1'" A A 11 ? ? 96.89 101.30 -4.41 0.70 N 150 11 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 128.63 116.00 12.63 1.60 N 151 11 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 116.06 109.80 6.26 0.90 N 152 11 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 124.11 114.00 10.11 1.30 N 153 11 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 95.53 102.60 -7.07 1.00 N 154 11 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 122.77 114.00 8.77 1.30 N 155 11 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.73 129.30 3.43 0.50 N 156 11 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.93 118.60 -3.67 0.60 N 157 11 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.29 120.30 -3.01 0.40 N 158 11 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 124.88 114.00 10.88 1.30 N 159 11 "O4'" A U 31 ? ? "C1'" A U 31 ? ? N1 A U 31 ? ? 102.21 108.20 -5.99 0.80 N 160 12 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 127.05 114.00 13.05 1.30 N 161 12 "O4'" A G 12 ? ? "C1'" A G 12 ? ? N9 A G 12 ? ? 102.53 108.20 -5.67 0.80 N 162 12 "C3'" A G 12 ? ? "O3'" A G 12 ? ? P A A 13 ? ? 127.39 119.70 7.69 1.20 Y 163 12 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 128.38 114.00 14.38 1.30 N 164 12 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 100.90 108.20 -7.30 0.80 N 165 12 N9 A G 20 ? ? "C1'" A G 20 ? ? "C2'" A G 20 ? ? 122.23 114.00 8.23 1.30 N 166 12 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.91 129.30 3.61 0.50 N 167 12 N9 A A 21 ? ? C4 A A 21 ? ? C5 A A 21 ? ? 108.24 105.80 2.44 0.40 N 168 12 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.57 118.60 -4.03 0.60 N 169 12 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 115.78 109.90 5.88 0.80 N 170 12 "O4'" A U 31 ? ? "C4'" A U 31 ? ? "C3'" A U 31 ? ? 94.64 104.00 -9.36 1.00 N 171 12 "C1'" A U 31 ? ? "O4'" A U 31 ? ? "C4'" A U 31 ? ? 105.37 109.70 -4.33 0.70 N 172 12 "O4'" A U 31 ? ? "C1'" A U 31 ? ? N1 A U 31 ? ? 114.79 108.50 6.29 0.70 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 G A 3 ? ? 0.063 'SIDE CHAIN' 2 1 G A 12 ? ? 0.070 'SIDE CHAIN' 3 1 A A 13 ? ? 0.116 'SIDE CHAIN' 4 1 G A 14 ? ? 0.142 'SIDE CHAIN' 5 1 G A 18 ? ? 0.166 'SIDE CHAIN' 6 1 A A 19 ? ? 0.084 'SIDE CHAIN' 7 1 G A 22 ? ? 0.064 'SIDE CHAIN' 8 1 A A 23 ? ? 0.089 'SIDE CHAIN' 9 1 C A 24 ? ? 0.066 'SIDE CHAIN' 10 1 C A 25 ? ? 0.130 'SIDE CHAIN' 11 1 A A 28 ? ? 0.080 'SIDE CHAIN' 12 1 A A 30 ? ? 0.063 'SIDE CHAIN' 13 1 A A 32 ? ? 0.114 'SIDE CHAIN' 14 1 U A 33 ? ? 0.076 'SIDE CHAIN' 15 1 C A 34 ? ? 0.088 'SIDE CHAIN' 16 1 A A 35 ? ? 0.070 'SIDE CHAIN' 17 2 A A 13 ? ? 0.177 'SIDE CHAIN' 18 2 G A 14 ? ? 0.155 'SIDE CHAIN' 19 2 G A 15 ? ? 0.086 'SIDE CHAIN' 20 2 U A 16 ? ? 0.067 'SIDE CHAIN' 21 2 G A 18 ? ? 0.187 'SIDE CHAIN' 22 2 A A 19 ? ? 0.102 'SIDE CHAIN' 23 2 A A 23 ? ? 0.079 'SIDE CHAIN' 24 2 C A 25 ? ? 0.113 'SIDE CHAIN' 25 2 G A 27 ? ? 0.073 'SIDE CHAIN' 26 2 U A 31 ? ? 0.211 'SIDE CHAIN' 27 2 U A 33 ? ? 0.069 'SIDE CHAIN' 28 3 G A 1 ? ? 0.055 'SIDE CHAIN' 29 3 G A 12 ? ? 0.064 'SIDE CHAIN' 30 3 A A 13 ? ? 0.142 'SIDE CHAIN' 31 3 G A 14 ? ? 0.191 'SIDE CHAIN' 32 3 G A 18 ? ? 0.234 'SIDE CHAIN' 33 3 A A 19 ? ? 0.063 'SIDE CHAIN' 34 3 A A 21 ? ? 0.113 'SIDE CHAIN' 35 3 A A 23 ? ? 0.075 'SIDE CHAIN' 36 3 C A 24 ? ? 0.076 'SIDE CHAIN' 37 3 C A 25 ? ? 0.109 'SIDE CHAIN' 38 3 G A 26 ? ? 0.155 'SIDE CHAIN' 39 3 U A 31 ? ? 0.141 'SIDE CHAIN' 40 3 A A 32 ? ? 0.054 'SIDE CHAIN' 41 3 U A 33 ? ? 0.082 'SIDE CHAIN' 42 3 C A 37 ? ? 0.111 'SIDE CHAIN' 43 3 C A 38 ? ? 0.091 'SIDE CHAIN' 44 4 C A 7 ? ? 0.123 'SIDE CHAIN' 45 4 G A 12 ? ? 0.094 'SIDE CHAIN' 46 4 A A 13 ? ? 0.130 'SIDE CHAIN' 47 4 G A 14 ? ? 0.174 'SIDE CHAIN' 48 4 G A 15 ? ? 0.084 'SIDE CHAIN' 49 4 G A 18 ? ? 0.185 'SIDE CHAIN' 50 4 A A 19 ? ? 0.189 'SIDE CHAIN' 51 4 G A 20 ? ? 0.112 'SIDE CHAIN' 52 4 A A 21 ? ? 0.100 'SIDE CHAIN' 53 4 A A 23 ? ? 0.062 'SIDE CHAIN' 54 4 C A 25 ? ? 0.096 'SIDE CHAIN' 55 4 G A 27 ? ? 0.066 'SIDE CHAIN' 56 4 A A 32 ? ? 0.057 'SIDE CHAIN' 57 4 U A 33 ? ? 0.062 'SIDE CHAIN' 58 5 G A 5 ? ? 0.051 'SIDE CHAIN' 59 5 C A 7 ? ? 0.067 'SIDE CHAIN' 60 5 A A 13 ? ? 0.166 'SIDE CHAIN' 61 5 G A 14 ? ? 0.136 'SIDE CHAIN' 62 5 U A 16 ? ? 0.065 'SIDE CHAIN' 63 5 G A 18 ? ? 0.191 'SIDE CHAIN' 64 5 G A 20 ? ? 0.100 'SIDE CHAIN' 65 5 A A 21 ? ? 0.081 'SIDE CHAIN' 66 5 A A 23 ? ? 0.060 'SIDE CHAIN' 67 5 C A 24 ? ? 0.059 'SIDE CHAIN' 68 5 C A 25 ? ? 0.128 'SIDE CHAIN' 69 5 U A 33 ? ? 0.063 'SIDE CHAIN' 70 6 A A 6 ? ? 0.054 'SIDE CHAIN' 71 6 U A 8 ? ? 0.094 'SIDE CHAIN' 72 6 C A 9 ? ? 0.063 'SIDE CHAIN' 73 6 G A 12 ? ? 0.056 'SIDE CHAIN' 74 6 A A 13 ? ? 0.077 'SIDE CHAIN' 75 6 G A 14 ? ? 0.146 'SIDE CHAIN' 76 6 C A 17 ? ? 0.103 'SIDE CHAIN' 77 6 G A 18 ? ? 0.269 'SIDE CHAIN' 78 6 A A 19 ? ? 0.149 'SIDE CHAIN' 79 6 G A 22 ? ? 0.088 'SIDE CHAIN' 80 6 A A 23 ? ? 0.087 'SIDE CHAIN' 81 6 G A 26 ? ? 0.073 'SIDE CHAIN' 82 6 U A 31 ? ? 0.076 'SIDE CHAIN' 83 6 A A 32 ? ? 0.092 'SIDE CHAIN' 84 6 U A 33 ? ? 0.120 'SIDE CHAIN' 85 6 C A 34 ? ? 0.103 'SIDE CHAIN' 86 7 G A 3 ? ? 0.053 'SIDE CHAIN' 87 7 U A 8 ? ? 0.068 'SIDE CHAIN' 88 7 A A 13 ? ? 0.160 'SIDE CHAIN' 89 7 G A 14 ? ? 0.137 'SIDE CHAIN' 90 7 G A 15 ? ? 0.065 'SIDE CHAIN' 91 7 C A 17 ? ? 0.066 'SIDE CHAIN' 92 7 G A 18 ? ? 0.249 'SIDE CHAIN' 93 7 A A 19 ? ? 0.096 'SIDE CHAIN' 94 7 G A 22 ? ? 0.082 'SIDE CHAIN' 95 7 A A 23 ? ? 0.064 'SIDE CHAIN' 96 7 C A 25 ? ? 0.069 'SIDE CHAIN' 97 7 U A 31 ? ? 0.095 'SIDE CHAIN' 98 7 A A 32 ? ? 0.078 'SIDE CHAIN' 99 7 U A 33 ? ? 0.122 'SIDE CHAIN' 100 7 C A 34 ? ? 0.128 'SIDE CHAIN' 101 8 C A 9 ? ? 0.062 'SIDE CHAIN' 102 8 G A 12 ? ? 0.068 'SIDE CHAIN' 103 8 A A 13 ? ? 0.139 'SIDE CHAIN' 104 8 G A 14 ? ? 0.218 'SIDE CHAIN' 105 8 G A 18 ? ? 0.179 'SIDE CHAIN' 106 8 G A 20 ? ? 0.120 'SIDE CHAIN' 107 8 A A 21 ? ? 0.115 'SIDE CHAIN' 108 8 A A 23 ? ? 0.072 'SIDE CHAIN' 109 8 C A 25 ? ? 0.093 'SIDE CHAIN' 110 8 C A 34 ? ? 0.063 'SIDE CHAIN' 111 9 G A 2 ? ? 0.061 'SIDE CHAIN' 112 9 A A 6 ? ? 0.066 'SIDE CHAIN' 113 9 A A 11 ? ? 0.058 'SIDE CHAIN' 114 9 A A 13 ? ? 0.159 'SIDE CHAIN' 115 9 G A 14 ? ? 0.184 'SIDE CHAIN' 116 9 U A 16 ? ? 0.080 'SIDE CHAIN' 117 9 C A 17 ? ? 0.083 'SIDE CHAIN' 118 9 G A 18 ? ? 0.231 'SIDE CHAIN' 119 9 A A 19 ? ? 0.081 'SIDE CHAIN' 120 9 G A 22 ? ? 0.061 'SIDE CHAIN' 121 9 A A 23 ? ? 0.053 'SIDE CHAIN' 122 9 C A 24 ? ? 0.077 'SIDE CHAIN' 123 9 C A 25 ? ? 0.154 'SIDE CHAIN' 124 9 G A 26 ? ? 0.072 'SIDE CHAIN' 125 9 G A 27 ? ? 0.052 'SIDE CHAIN' 126 9 U A 31 ? ? 0.121 'SIDE CHAIN' 127 9 A A 35 ? ? 0.068 'SIDE CHAIN' 128 9 C A 36 ? ? 0.070 'SIDE CHAIN' 129 10 U A 8 ? ? 0.068 'SIDE CHAIN' 130 10 C A 9 ? ? 0.068 'SIDE CHAIN' 131 10 G A 12 ? ? 0.076 'SIDE CHAIN' 132 10 A A 13 ? ? 0.119 'SIDE CHAIN' 133 10 G A 14 ? ? 0.127 'SIDE CHAIN' 134 10 G A 15 ? ? 0.067 'SIDE CHAIN' 135 10 C A 17 ? ? 0.103 'SIDE CHAIN' 136 10 G A 18 ? ? 0.255 'SIDE CHAIN' 137 10 A A 19 ? ? 0.098 'SIDE CHAIN' 138 10 G A 22 ? ? 0.084 'SIDE CHAIN' 139 10 A A 23 ? ? 0.064 'SIDE CHAIN' 140 10 C A 24 ? ? 0.067 'SIDE CHAIN' 141 10 C A 25 ? ? 0.128 'SIDE CHAIN' 142 10 A A 35 ? ? 0.082 'SIDE CHAIN' 143 11 G A 2 ? ? 0.105 'SIDE CHAIN' 144 11 G A 5 ? ? 0.054 'SIDE CHAIN' 145 11 G A 12 ? ? 0.108 'SIDE CHAIN' 146 11 A A 13 ? ? 0.115 'SIDE CHAIN' 147 11 G A 14 ? ? 0.165 'SIDE CHAIN' 148 11 C A 17 ? ? 0.069 'SIDE CHAIN' 149 11 G A 18 ? ? 0.249 'SIDE CHAIN' 150 11 A A 19 ? ? 0.102 'SIDE CHAIN' 151 11 G A 22 ? ? 0.073 'SIDE CHAIN' 152 11 A A 23 ? ? 0.096 'SIDE CHAIN' 153 11 C A 25 ? ? 0.113 'SIDE CHAIN' 154 11 G A 27 ? ? 0.060 'SIDE CHAIN' 155 11 U A 31 ? ? 0.118 'SIDE CHAIN' 156 11 U A 33 ? ? 0.097 'SIDE CHAIN' 157 11 C A 37 ? ? 0.062 'SIDE CHAIN' 158 12 U A 8 ? ? 0.074 'SIDE CHAIN' 159 12 A A 13 ? ? 0.182 'SIDE CHAIN' 160 12 G A 14 ? ? 0.170 'SIDE CHAIN' 161 12 G A 15 ? ? 0.093 'SIDE CHAIN' 162 12 G A 18 ? ? 0.275 'SIDE CHAIN' 163 12 A A 19 ? ? 0.107 'SIDE CHAIN' 164 12 G A 20 ? ? 0.065 'SIDE CHAIN' 165 12 G A 22 ? ? 0.074 'SIDE CHAIN' 166 12 A A 23 ? ? 0.086 'SIDE CHAIN' 167 12 C A 24 ? ? 0.064 'SIDE CHAIN' 168 12 C A 25 ? ? 0.090 'SIDE CHAIN' 169 12 G A 27 ? ? 0.064 'SIDE CHAIN' 170 12 A A 32 ? ? 0.078 'SIDE CHAIN' 171 12 U A 33 ? ? 0.068 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1A9L 'a-form double helix' 1A9L 'hairpin loop' 1A9L 'bulge loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 38 1_555 -0.860 -0.185 0.056 3.304 -6.800 0.042 1 A_G1:C38_A A 1 ? A 38 ? 19 1 1 A G 2 1_555 A C 37 1_555 -0.999 -0.296 -0.145 -0.607 -15.026 0.895 2 A_G2:C37_A A 2 ? A 37 ? 19 1 1 A G 3 1_555 A C 36 1_555 -0.372 -0.058 -0.105 -6.125 -7.376 -1.677 3 A_G3:C36_A A 3 ? A 36 ? 19 1 1 A U 4 1_555 A A 35 1_555 0.412 -0.128 -0.188 -3.117 -11.632 -4.630 4 A_U4:A35_A A 4 ? A 35 ? 20 1 1 A G 5 1_555 A C 34 1_555 -0.059 0.003 -0.230 -12.111 -17.541 -1.197 5 A_G5:C34_A A 5 ? A 34 ? 19 1 1 A A 6 1_555 A U 33 1_555 0.196 -0.037 0.544 1.199 -11.945 0.867 6 A_A6:U33_A A 6 ? A 33 ? 20 1 1 A C 7 1_555 A G 29 1_555 -0.481 0.008 0.169 10.484 -4.856 -2.108 7 A_C7:G29_A A 7 ? A 29 ? 19 1 1 A U 8 1_555 A A 28 1_555 -0.319 -0.016 -0.493 9.439 -5.422 -0.296 8 A_U8:A28_A A 8 ? A 28 ? 20 1 1 A C 9 1_555 A G 27 1_555 0.958 -0.343 0.084 3.853 -5.387 -3.483 9 A_C9:G27_A A 9 ? A 27 ? 19 1 1 A C 10 1_555 A G 26 1_555 0.660 -0.201 0.017 -11.390 -11.852 -4.602 10 A_C10:G26_A A 10 ? A 26 ? 19 1 1 A G 14 1_555 A C 25 1_555 -0.196 -0.203 0.903 0.781 2.753 -5.423 11 A_G14:C25_A A 14 ? A 25 ? 19 1 1 A G 15 1_555 A C 24 1_555 0.252 -0.108 0.885 9.670 -7.072 -4.875 12 A_G15:C24_A A 15 ? A 24 ? 19 1 1 A U 16 1_555 A A 23 1_555 -0.185 -0.011 0.365 7.259 -11.971 -3.584 13 A_U16:A23_A A 16 ? A 23 ? 20 1 1 A C 17 1_555 A G 22 1_555 0.291 -0.198 0.659 11.012 -3.112 -5.376 14 A_C17:G22_A A 17 ? A 22 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 38 1_555 A G 2 1_555 A C 37 1_555 -0.531 -2.418 3.199 -3.601 10.191 28.764 -6.304 0.390 2.278 19.659 6.946 30.688 1 AA_G1G2:C37C38_AA A 1 ? A 38 ? A 2 ? A 37 ? 1 A G 2 1_555 A C 37 1_555 A G 3 1_555 A C 36 1_555 -0.458 -2.355 3.239 -4.311 12.960 32.430 -5.586 0.199 2.207 22.026 7.327 35.117 2 AA_G2G3:C36C37_AA A 2 ? A 37 ? A 3 ? A 36 ? 1 A G 3 1_555 A C 36 1_555 A U 4 1_555 A A 35 1_555 -1.009 -2.139 3.198 0.378 9.213 25.787 -6.501 2.215 2.295 19.854 -0.815 27.359 3 AA_G3U4:A35C36_AA A 3 ? A 36 ? A 4 ? A 35 ? 1 A U 4 1_555 A A 35 1_555 A G 5 1_555 A C 34 1_555 0.287 -1.171 3.384 3.879 23.565 30.386 -4.509 0.014 2.020 38.386 -6.319 38.473 4 AA_U4G5:C34A35_AA A 4 ? A 35 ? A 5 ? A 34 ? 1 A G 5 1_555 A C 34 1_555 A A 6 1_555 A U 33 1_555 1.806 -1.026 2.926 -0.616 8.723 20.903 -5.231 -4.786 2.265 22.798 1.611 22.640 5 AA_G5A6:U33C34_AA A 5 ? A 34 ? A 6 ? A 33 ? 1 A C 7 1_555 A G 29 1_555 A U 8 1_555 A A 28 1_555 -1.585 -2.168 3.154 -0.056 4.330 23.346 -6.564 3.836 2.716 10.583 0.136 23.739 6 AA_C7U8:A28G29_AA A 7 ? A 29 ? A 8 ? A 28 ? 1 A U 8 1_555 A A 28 1_555 A C 9 1_555 A G 27 1_555 -0.644 -2.443 3.412 -6.835 11.211 37.482 -4.859 0.183 2.674 16.827 10.259 39.638 7 AA_U8C9:G27A28_AA A 8 ? A 28 ? A 9 ? A 27 ? 1 A C 9 1_555 A G 27 1_555 A C 10 1_555 A G 26 1_555 1.290 -1.907 3.349 8.878 5.205 40.736 -3.222 -0.849 3.290 7.337 -12.513 41.962 8 AA_C9C10:G26G27_AA A 9 ? A 27 ? A 10 ? A 26 ? 1 A G 14 1_555 A C 25 1_555 A G 15 1_555 A C 24 1_555 -0.171 -0.253 3.186 -0.985 4.495 29.054 -1.432 0.132 3.116 8.889 1.948 29.408 9 AA_G14G15:C24C25_AA A 14 ? A 25 ? A 15 ? A 24 ? 1 A G 15 1_555 A C 24 1_555 A U 16 1_555 A A 23 1_555 0.269 -1.260 3.357 3.271 13.771 28.583 -4.685 0.076 2.516 25.976 -6.170 31.831 10 AA_G15U16:A23C24_AA A 15 ? A 24 ? A 16 ? A 23 ? 1 A U 16 1_555 A A 23 1_555 A C 17 1_555 A G 22 1_555 0.125 -1.253 3.344 -0.369 9.449 31.332 -3.810 -0.283 2.854 17.017 0.665 32.693 11 AA_U16C17:G22A23_AA A 16 ? A 23 ? A 17 ? A 22 ? #