data_1F7G # _entry.id 1F7G # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1F7G pdb_00001f7g 10.2210/pdb1f7g/pdb RCSB RCSB011336 ? ? WWPDB D_1000011336 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1F6Z _pdbx_database_related.details '1F6Z contains the average structure calculated from this ensemble' _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1F7G _pdbx_database_status.recvd_initial_deposition_date 2000-06-27 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Schmitz, M.' 1 'Tinoco Jr., I.' 2 # _citation.id primary _citation.title 'Solution structure and metal-ion binding of the P4 element from bacterial RNase P RNA.' _citation.journal_abbrev RNA _citation.journal_volume 6 _citation.page_first 1212 _citation.page_last 1225 _citation.year 2000 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 10999599 _citation.pdbx_database_id_DOI 10.1017/S1355838200000881 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Schmitz, M.' 1 ? primary 'Tinoco Jr., I.' 2 ? # _cell.entry_id 1F7G _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1F7G _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNASE P RNA RIBOZYME, P4 DOMAIN' _entity.formula_weight 8634.127 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation C70U _entity.pdbx_fragment 'P4 STEM' _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAAGUUCGGUCUUCGGACCGGCUUCC _entity_poly.pdbx_seq_one_letter_code_can GGAAGUUCGGUCUUCGGACCGGCUUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 A n 1 5 G n 1 6 U n 1 7 U n 1 8 C n 1 9 G n 1 10 G n 1 11 U n 1 12 C n 1 13 U n 1 14 U n 1 15 C n 1 16 G n 1 17 G n 1 18 A n 1 19 C n 1 20 C n 1 21 G n 1 22 G n 1 23 C n 1 24 U n 1 25 U n 1 26 C n 1 27 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'synthesized from DNA oligonucleotide template by T7 RNA polymerase' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1F7G _struct_ref.pdbx_db_accession 1F7G _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1F7G _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1F7G _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 2 2 '2D NOESY' 3 3 3 '2D NOESY' 4 4 4 '2D NOESY' 5 2 2 DQF-COSY 6 2 2 31P-1H-COSY 7 2 2 13C-1H-HMQC # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 6.5 '100 mM Na' ? K 2 288 ambient 6.5 '100 mM Na' ? K 3 288 ambient 6.5 '100 mM Na, 10 mM Mg' ? K 4 288 ambient 6.5 '100 mM Na, 3 mM Co(NH3)6' ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2 mM P4m RNA; 100 mM sodium chloride; 10 mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' 2 '2 mM P4m RNA; 100 mM sodium chloride; 10 mM phosphate buffer; 99.96% D2O' '99.96% D2O' 3 '2 mM P4m RNA; 100 mM sodium chloride; 10 mM magnesium chloride; 10 mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' 4 '2 mM P4m RNA; 100 mM sodium chloride; 3 mM hexammine cobalt chloride; 10 mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Bruker AMX 600 2 ? Bruker DRX 500 # _pdbx_nmr_refine.entry_id 1F7G _pdbx_nmr_refine.method 'restrained molecular dynamics; simulated annealing' _pdbx_nmr_refine.details ;The structures are based on a total of 268 NOE derived distance constraints, 171 dihedral restraints and 49 distance restraints from hydrogen bonds. The 17 structures with lowest NOE and dihedral angle violation energies are presented ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_details.entry_id 1F7G _pdbx_nmr_details.text ;This structure was determined using standard 2D homonuclear techniques and 13C and 31P heteronuclear techniques at natural abundance ; # _pdbx_nmr_ensemble.entry_id 1F7G _pdbx_nmr_ensemble.conformers_calculated_total_number 50 _pdbx_nmr_ensemble.conformers_submitted_total_number 17 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1F7G _pdbx_nmr_representative.conformer_id 5 _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal XwinNMR 3.1 collection Bruker 1 Felix 95 processing MSI 2 X-PLOR 3.841 'structure solution' Brunger 3 X-PLOR 3.841 refinement Brunger 4 # _exptl.entry_id 1F7G _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 1F7G _struct.title 'SOLUTION STRUCTURE OF THE RNASE P RNA (M1 RNA) P4 STEM C70U MUTANT OLIGORIBONUCLEOTIDE, ENSEMBLE OF 17 STRUCTURES' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1F7G _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RIBONUCLEASE P, RIBOZYME, TRANSFER RNA PROCESSING, P4 STEM, C70U MUTANT, METAL BINDING SITE, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 25 N3 ? ? A A 3 A U 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 25 O4 ? ? A A 3 A U 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 24 N3 ? ? A A 4 A U 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 24 O4 ? ? A A 4 A U 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 22 O6 ? ? A U 6 A G 22 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 22 N1 ? ? A U 6 A G 22 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A G 21 O6 ? ? A G 9 A G 21 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog23 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 18 N1 ? ? A U 11 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 18 N6 ? ? A U 11 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 13 O2 ? ? ? 1_555 A G 16 N1 ? ? A U 13 A G 16 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1F7G _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1F7G _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 U 7 7 7 U U A . n A 1 8 C 8 8 8 C C A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 U 24 24 24 U U A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2000-10-09 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A G 9 ? ? "O4'" A G 10 ? ? 1.49 2 2 "HO2'" A U 14 ? ? "O5'" A C 15 ? ? 1.44 3 8 "HO2'" A C 15 ? ? OP2 A G 16 ? ? 1.52 4 9 H41 A C 8 ? ? O6 A G 21 ? ? 1.59 5 12 H41 A C 8 ? ? O6 A G 21 ? ? 1.59 6 13 O6 A G 10 ? ? H41 A C 19 ? ? 1.59 7 15 "HO2'" A C 15 ? ? OP2 A G 16 ? ? 1.51 8 15 "O2'" A U 13 ? ? H5 A C 15 ? ? 1.56 9 16 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1F7G 'double helix' 1F7G 'a-form double helix' 1F7G tetraloop 1F7G 'bulge loop' 1F7G 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 27 1_555 -0.223 -0.289 0.305 24.119 -18.712 -3.446 1 A_G1:C27_A A 1 ? A 27 ? 19 1 1 A G 2 1_555 A C 26 1_555 -0.386 -0.358 0.299 -19.027 1.579 -2.056 2 A_G2:C26_A A 2 ? A 26 ? 19 1 1 A A 3 1_555 A U 25 1_555 0.102 -0.017 -0.269 -0.654 -13.444 -5.883 3 A_A3:U25_A A 3 ? A 25 ? 20 1 1 A A 4 1_555 A U 24 1_555 -0.044 -0.189 -0.445 3.326 -16.604 -2.125 4 A_A4:U24_A A 4 ? A 24 ? 20 1 1 A G 5 1_555 A C 23 1_555 -0.165 -0.249 0.018 -15.859 -32.995 -5.685 5 A_G5:C23_A A 5 ? A 23 ? 19 1 1 A U 6 1_555 A G 22 1_555 2.087 -0.598 0.973 -18.056 -6.577 -9.368 6 A_U6:G22_A A 6 ? A 22 ? 28 ? 1 A C 8 1_555 A G 21 1_555 0.254 -0.486 -0.674 -32.785 20.915 -7.155 7 A_C8:G21_A A 8 ? A 21 ? 19 1 1 A G 9 1_555 A C 20 1_555 -0.113 -0.121 0.971 16.572 9.968 -3.464 8 A_G9:C20_A A 9 ? A 20 ? 19 1 1 A G 10 1_555 A C 19 1_555 -0.410 -0.584 -0.974 2.523 -21.575 10.612 9 A_G10:C19_A A 10 ? A 19 ? 19 1 1 A U 11 1_555 A A 18 1_555 -0.123 -0.362 -1.091 4.556 -17.889 -1.000 10 A_U11:A18_A A 11 ? A 18 ? 20 1 1 A C 12 1_555 A G 17 1_555 0.380 -0.250 0.327 -8.481 -12.200 -3.826 11 A_C12:G17_A A 12 ? A 17 ? 19 1 1 A U 13 1_555 A G 16 1_555 -0.996 -5.054 -2.159 49.366 -5.338 -153.484 12 A_U13:G16_A A 13 ? A 16 ? ? 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 27 1_555 A G 2 1_555 A C 26 1_555 -0.761 -2.993 3.748 -10.960 32.403 30.358 -6.230 0.189 0.637 46.988 15.894 45.432 1 AA_G1G2:C26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A G 2 1_555 A C 26 1_555 A A 3 1_555 A U 25 1_555 -0.050 -1.326 2.966 4.439 3.398 30.968 -3.009 0.827 2.774 6.300 -8.229 31.456 2 AA_G2A3:U25C26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A A 3 1_555 A U 25 1_555 A A 4 1_555 A U 24 1_555 0.439 -1.253 3.254 1.452 10.578 36.533 -3.200 -0.498 2.811 16.448 -2.257 38.010 3 AA_A3A4:U24U25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A A 4 1_555 A U 24 1_555 A G 5 1_555 A C 23 1_555 0.197 -0.827 4.421 0.547 5.353 35.553 -2.359 -0.215 4.258 8.705 -0.890 35.944 4 AA_A4G5:C23U24_AA A 4 ? A 24 ? A 5 ? A 23 ? 1 A G 5 1_555 A C 23 1_555 A U 6 1_555 A G 22 1_555 0.403 -0.887 3.393 -3.193 23.117 39.663 -3.102 -0.790 2.503 31.036 4.286 45.779 5 AA_G5U6:G22C23_AA A 5 ? A 23 ? A 6 ? A 22 ? 1 A U 6 1_555 A G 22 1_555 A C 8 1_555 A G 21 1_555 1.055 -1.032 5.050 13.531 36.157 22.421 -6.371 0.478 2.085 57.099 -21.369 44.429 6 AA_U6C8:G21G22_AA A 6 ? A 22 ? A 8 ? A 21 ? 1 A C 8 1_555 A G 21 1_555 A G 9 1_555 A C 20 1_555 0.596 -0.850 2.077 -7.016 6.547 21.255 -3.384 -2.847 1.484 16.697 17.891 23.298 7 AA_C8G9:C20G21_AA A 8 ? A 21 ? A 9 ? A 20 ? 1 A G 9 1_555 A C 20 1_555 A G 10 1_555 A C 19 1_555 1.219 -0.306 4.858 13.511 3.892 26.202 -1.888 2.096 4.805 7.903 -27.432 29.678 8 AA_G9G10:C19C20_AA A 9 ? A 20 ? A 10 ? A 19 ? 1 A G 10 1_555 A C 19 1_555 A U 11 1_555 A A 18 1_555 -0.566 -0.727 3.485 -0.833 9.292 32.911 -2.764 0.827 3.181 16.004 1.434 34.172 9 AA_G10U11:A18C19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A U 11 1_555 A A 18 1_555 A C 12 1_555 A G 17 1_555 -0.589 -0.808 3.972 -6.169 16.467 32.506 -3.918 -0.057 3.262 27.088 10.147 36.845 10 AA_U11C12:G17A18_AA A 11 ? A 18 ? A 12 ? A 17 ? 1 A C 12 1_555 A G 17 1_555 A U 13 1_555 A G 16 1_555 -1.643 0.578 3.297 -5.520 -16.439 108.562 0.560 0.937 3.275 -10.084 3.386 109.500 11 AA_C12U13:G16G17_AA A 12 ? A 17 ? A 13 ? A 16 ? #