data_1K5I # _entry.id 1K5I # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1K5I pdb_00001k5i 10.2210/pdb1k5i/pdb RCSB RCSB014585 ? ? WWPDB D_1000014585 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1K5I _pdbx_database_status.recvd_initial_deposition_date 2001-10-10 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Nagaswamy, U.' 1 'Gao, X.' 2 'Martinis, S.A.' 3 'Fox, G.E.' 4 # _citation.id primary _citation.title 'NMR structure of a ribosomal RNA hairpin containing a conserved CUCAA pentaloop.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 29 _citation.page_first 5129 _citation.page_last 5139 _citation.year 2001 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11812846 _citation.pdbx_database_id_DOI 10.1093/nar/29.24.5129 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Nagaswamy, U.' 1 ? primary 'Gao, X.' 2 ? primary 'Martinis, S.A.' 3 ? primary 'Fox, G.E.' 4 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-R(P*GP*GP*AP*CP*CP*CP*GP*GP*GP*CP*UP*CP*AP*AP*CP*CP*UP*GP*GP*GP*UP*CP*C)-3'" _entity.formula_weight 7369.440 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment '16S ribosomal RNA fragment (612-628)' _entity.details 'CUCAA pentaloop' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGACCCGGGCUCAACCUGGGUCC _entity_poly.pdbx_seq_one_letter_code_can GGACCCGGGCUCAACCUGGGUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 C n 1 6 C n 1 7 G n 1 8 G n 1 9 G n 1 10 C n 1 11 U n 1 12 C n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 U n 1 18 G n 1 19 G n 1 20 G n 1 21 U n 1 22 C n 1 23 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'The oligonucleotide was synthesized by T7 run-off transcription.' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1K5I _struct_ref.pdbx_db_accession 1K5I _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1K5I _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 23 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1K5I _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 23 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 23 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 1 1 DQF-COSY 3 1 1 '1H-31P HETCOR' 4 1 1 COSY-35 5 1 1 TOCSY 6 1 1 ? # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength '10 mM Sodium Phosphate' _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '0.8 mM RNA; 10 mM Sodium Phosphate; 0.1 mM EDTA; pH 6.5' '90% H2O/10% D2O' 2 '10 mM Sodium Phosphate; 0.1 mM EDTA; pH 6.5' '99.99 % D2O' # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model AMX _pdbx_nmr_spectrometer.field_strength 600 # _pdbx_nmr_refine.entry_id 1K5I _pdbx_nmr_refine.method 'Distance Geometry, Simulated Annealing, Restrained Molecular Dynamics' _pdbx_nmr_refine.details ;A total of 300 structures were calculated using distance geometry utilizing 123 experimentally derived distance restraints for the loop and 918 (258-experimental distances, 660-A form distances) distance restraints for the stem region and 143 dihedral angle restraints. Additionally, 50 distance restraints were used to maintain the Watson-Crick geometry of the base pairs in the stem region. Final refinement resulted in 10 lowest energy structures. ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 1K5I _pdbx_nmr_ensemble.conformers_calculated_total_number 33 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_software.name X-PLOR _pdbx_nmr_software.version 3.1 _pdbx_nmr_software.classification refinement _pdbx_nmr_software.authors Brunger _pdbx_nmr_software.ordinal 1 # _exptl.entry_id 1K5I _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 1K5I _struct.title 'NMR Structure of a Ribosomal RNA Hairpin Containing a Conserved CUCAA Pentaloop' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1K5I _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'CUCAA pentaloop, RNA hairpin, non standard base-base interaction, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 2 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 2 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 2 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 21 N3 ? ? A A 3 A U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 21 O4 ? ? A A 3 A U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 4 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 4 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 4 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 5 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 5 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 5 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 6 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 6 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 6 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 7 N1 ? ? ? 1_555 A U 17 O2 ? ? A G 7 A U 17 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A G 7 O6 ? ? ? 1_555 A U 17 N3 ? ? A G 7 A U 17 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 16 N3 ? ? A G 8 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 16 O2 ? ? A G 8 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 8 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 15 N3 ? ? A G 9 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 15 O2 ? ? A G 9 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 9 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 O2 ? ? ? 1_555 A A 13 N6 ? ? A C 10 A A 13 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A A 14 N6 ? ? A C 10 A A 14 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1K5I _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1K5I _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 C 5 5 5 C C A . n A 1 6 C 6 6 6 C C A . n A 1 7 G 7 7 7 G G A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 U 17 17 17 U U A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 U 21 21 21 U U A . n A 1 22 C 22 22 22 C C A . n A 1 23 C 23 23 23 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2001-10-17 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_struct_assembly 3 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1K5I 'a-form double helix' 1K5I 'mismatched base pair' 1K5I 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 23 1_555 -0.299 -0.085 -0.129 -3.953 8.611 -1.621 1 A_G1:C23_A A 1 ? A 23 ? 19 1 1 A G 2 1_555 A C 22 1_555 -0.307 -0.084 -0.091 -3.776 7.528 -1.219 2 A_G2:C22_A A 2 ? A 22 ? 19 1 1 A A 3 1_555 A U 21 1_555 0.093 -0.013 0.127 -2.702 8.127 -2.124 3 A_A3:U21_A A 3 ? A 21 ? 20 1 1 A C 4 1_555 A G 20 1_555 0.344 -0.091 0.006 0.877 8.094 -1.192 4 A_C4:G20_A A 4 ? A 20 ? 19 1 1 A C 5 1_555 A G 19 1_555 0.308 -0.092 -0.032 1.915 10.684 -1.136 5 A_C5:G19_A A 5 ? A 19 ? 19 1 1 A C 6 1_555 A G 18 1_555 0.271 -0.084 -0.206 6.199 7.586 -1.546 6 A_C6:G18_A A 6 ? A 18 ? 19 1 1 A G 7 1_555 A U 17 1_555 -1.607 -0.367 0.102 -0.231 5.464 -1.200 7 A_G7:U17_A A 7 ? A 17 ? 28 1 1 A G 8 1_555 A C 16 1_555 -0.755 -0.224 0.065 3.320 8.383 -1.174 8 A_G8:C16_A A 8 ? A 16 ? 19 1 1 A G 9 1_555 A C 15 1_555 -0.726 -0.213 0.045 1.772 6.379 -1.212 9 A_G9:C15_A A 9 ? A 15 ? 19 1 1 A C 10 1_555 A A 14 1_555 3.137 -0.611 0.511 19.804 48.509 27.471 10 A_C10:A14_A A 10 ? A 14 ? ? 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 23 1_555 A G 2 1_555 A C 22 1_555 0.105 -1.686 3.355 -0.921 10.186 31.421 -4.606 -0.333 2.688 18.214 1.648 33.003 1 AA_G1G2:C22C23_AA A 1 ? A 23 ? A 2 ? A 22 ? 1 A G 2 1_555 A C 22 1_555 A A 3 1_555 A U 21 1_555 -0.044 -1.588 3.362 -1.436 7.697 34.615 -3.710 -0.133 2.952 12.735 2.376 35.463 2 AA_G2A3:U21C22_AA A 2 ? A 22 ? A 3 ? A 21 ? 1 A A 3 1_555 A U 21 1_555 A C 4 1_555 A G 20 1_555 -0.011 -1.670 3.232 0.948 8.106 31.430 -4.308 0.175 2.726 14.657 -1.715 32.446 3 AA_A3C4:G20U21_AA A 3 ? A 21 ? A 4 ? A 20 ? 1 A C 4 1_555 A G 20 1_555 A C 5 1_555 A G 19 1_555 -0.061 -1.732 3.359 0.811 10.000 30.600 -4.819 0.248 2.673 18.339 -1.487 32.165 4 AA_C4C5:G19G20_AA A 4 ? A 20 ? A 5 ? A 19 ? 1 A C 5 1_555 A G 19 1_555 A C 6 1_555 A G 18 1_555 -0.125 -1.682 3.247 2.006 8.458 29.234 -4.756 0.607 2.653 16.309 -3.869 30.472 5 AA_C5C6:G18G19_AA A 5 ? A 19 ? A 6 ? A 18 ? 1 A C 6 1_555 A G 18 1_555 A G 7 1_555 A U 17 1_555 -0.020 -1.968 3.516 -3.964 13.241 23.631 -7.213 -0.869 2.111 29.337 8.782 27.327 6 AA_C6G7:U17G18_AA A 6 ? A 18 ? A 7 ? A 17 ? 1 A G 7 1_555 A U 17 1_555 A G 8 1_555 A C 16 1_555 -0.212 -1.613 3.157 -2.906 9.157 35.104 -3.745 -0.028 2.675 14.841 4.710 36.355 7 AA_G7G8:C16U17_AA A 7 ? A 17 ? A 8 ? A 16 ? 1 A G 8 1_555 A C 16 1_555 A G 9 1_555 A C 15 1_555 -0.044 -1.695 3.462 -1.258 8.705 31.003 -4.595 -0.142 2.892 15.889 2.297 32.197 8 AA_G8G9:C15C16_AA A 8 ? A 16 ? A 9 ? A 15 ? 1 A G 9 1_555 A C 15 1_555 A C 10 1_555 A A 14 1_555 0.437 -1.116 3.361 -11.069 4.899 39.779 -2.093 -1.787 2.988 7.006 15.829 41.508 9 AA_G9C10:A14C15_AA A 9 ? A 15 ? A 10 ? A 14 ? #