data_1NZ1 # _entry.id 1NZ1 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1NZ1 pdb_00001nz1 10.2210/pdb1nz1/pdb RCSB RCSB018370 ? ? WWPDB D_1000018370 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2003-05-13 2 'Structure model' 1 1 2008-04-29 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_conn 6 5 'Structure model' chem_comp_atom 7 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' 4 4 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1NZ1 _pdbx_database_status.recvd_initial_deposition_date 2003-02-14 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1LC6 'Solution structure of the U6 intramolecular stem-loop RNA' unspecified PDB 1NYZ 'Refined solution structure of the U6 intramolecular stem-loop RNA using residual dipolar couplings (RDCs)' unspecified PDB 1NC0 'U80G U6 Intramolecular Stem-Loop RNA from Saccharomyces cerevisiae' unspecified BMRB 5703 . unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Reiter, N.J.' 1 'Nikstad, L.J.' 2 'Allman, A.M.' 3 'Johnson, R.J.' 4 'Butcher, S.E.' 5 # _citation.id primary _citation.title ;Structure of the U6 RNA intramolecular stem-loop harboring an S(P)-phosphorothioate modification. ; _citation.journal_abbrev RNA _citation.journal_volume 9 _citation.page_first 533 _citation.page_last 542 _citation.year 2003 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 12702812 _citation.pdbx_database_id_DOI 10.1261/rna.2199103 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Reiter, N.J.' 1 ? primary 'Nikstad, L.J.' 2 ? primary 'Allman, A.M.' 3 ? primary 'Johnson, R.J.' 4 ? primary 'Butcher, S.E.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'SP U6 Intramolecular Stem-Loop RNA' _entity.formula_weight 7684.681 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation A62G _entity.pdbx_fragment ? _entity.details 'A62G, SP phoshphorothioate modified U80' # _entity_name_com.entity_id 1 _entity_name_com.name 'SP ISL RNA' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'GGUUCCCCUGCAUAAGGA(SSU)GAACC' _entity_poly.pdbx_seq_one_letter_code_can GGUUCCCCUGCAUAAGGAUGAACC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 U n 1 5 C n 1 6 C n 1 7 C n 1 8 C n 1 9 U n 1 10 G n 1 11 C n 1 12 A n 1 13 U n 1 14 A n 1 15 A n 1 16 G n 1 17 G n 1 18 A n 1 19 SSU n 1 20 G n 1 21 A n 1 22 A n 1 23 C n 1 24 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details ;Synthetic RNA (Dharmacon, Inc.) was prepared containing an SP phosphorothioate modification at nucleotide U80. The Sp RNA was separated from the Rp RNA diastereomer using reverse-phase high pressure liquid chromatography. ; # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 SSU 'RNA linking' n "URIDINE-5'-PHOSPHOROTHIOATE" 'SP-SULFUR-SUBSTITUTED URIDINE' 'C9 H13 N2 O8 P S' 340.247 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 U 4 4 4 U U A . n A 1 5 C 5 5 5 C C A . n A 1 6 C 6 6 6 C C A . n A 1 7 C 7 7 7 C C A . n A 1 8 C 8 8 8 C C A . n A 1 9 U 9 9 9 U U A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 A 14 14 14 A A A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 SSU 19 19 19 SSU SSU A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n # _exptl.entry_id 1NZ1 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _database_PDB_matrix.entry_id 1NZ1 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1NZ1 _struct.title 'Solution structure of the S. cerevisiae U6 Intramolecular stem-loop containing an SP phosphorothioate at nucleotide U80' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1NZ1 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'U6 RNA, stem-loop, phosphorothioate, Sp phosphorothioate, residual dipolar coupling, RDC, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1NZ1 _struct_ref.pdbx_db_accession 1NZ1 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1NZ1 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 24 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1NZ1 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 24 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 24 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A A 18 "O3'" ? ? ? 1_555 A SSU 19 P ? ? A A 18 A SSU 19 1_555 ? ? ? ? ? ? ? 1.610 ? ? covale2 covale both ? A SSU 19 "O3'" ? ? ? 1_555 A G 20 P ? ? A SSU 19 A G 20 1_555 ? ? ? ? ? ? ? 1.611 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 22 N1 ? ? A U 3 A A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 22 N6 ? ? A U 3 A A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 21 N1 ? ? A U 4 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 21 N6 ? ? A U 4 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 5 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 5 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 5 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A A 18 N6 ? ? A C 6 A A 18 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 7 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 7 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 7 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 8 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 8 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 8 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 9 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 9 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N2 ? ? ? 1_555 A A 14 N7 ? ? A G 10 A A 14 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog24 hydrog ? ? A G 10 N3 ? ? ? 1_555 A A 14 N6 ? ? A G 10 A A 14 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A C 11 ? ? "O4'" A A 12 ? ? 1.53 2 3 "HO2'" A C 11 ? ? "O4'" A A 12 ? ? 1.47 3 5 "O2'" A A 12 ? ? "H2'" A U 13 ? ? 1.45 4 5 "H2'" A G 10 ? ? OP2 A A 12 ? ? 1.58 5 6 "HO2'" A C 11 ? ? "O4'" A A 12 ? ? 1.47 6 6 "HO2'" A G 17 ? ? "O5'" A A 18 ? ? 1.51 7 7 "H2'" A G 10 ? ? OP2 A A 12 ? ? 1.57 8 8 "H2'" A G 10 ? ? OP2 A A 12 ? ? 1.51 9 9 "HO2'" A C 8 ? ? "O5'" A U 9 ? ? 1.26 10 10 "HO2'" A G 20 ? ? "O5'" A A 21 ? ? 1.46 11 10 "H2'" A G 10 ? ? OP2 A A 12 ? ? 1.53 12 11 "HO2'" A C 8 ? ? "O5'" A U 9 ? ? 1.30 13 11 "H2'" A G 10 ? ? OP2 A A 12 ? ? 1.47 14 12 "HO2'" A C 11 ? ? "O4'" A A 12 ? ? 1.42 15 12 "O2'" A C 11 ? ? H8 A A 12 ? ? 1.43 16 12 "O2'" A G 10 ? ? "H2'" A C 11 ? ? 1.47 17 12 "O2'" A C 11 ? ? "H5''" A A 12 ? ? 1.49 18 12 "HO2'" A C 23 ? ? "O4'" A C 24 ? ? 1.59 19 14 "H2'" A G 10 ? ? OP2 A A 12 ? ? 1.49 20 14 "HO2'" A C 5 ? ? "O4'" A C 6 ? ? 1.54 21 15 "O2'" A U 4 ? ? "H5'" A C 5 ? ? 1.58 22 16 "HO2'" A C 11 ? ? "O4'" A A 12 ? ? 1.37 23 16 "O2'" A C 11 ? ? H8 A A 12 ? ? 1.42 24 16 "O2'" A G 10 ? ? "H2'" A C 11 ? ? 1.48 25 17 "HO2'" A C 11 ? ? "O4'" A A 12 ? ? 1.33 26 17 "O2'" A C 11 ? ? H8 A A 12 ? ? 1.38 27 17 "O2'" A G 10 ? ? "H2'" A C 11 ? ? 1.38 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.66 113.10 4.56 0.50 N 2 1 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.76 106.40 -2.64 0.40 N 3 1 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.79 113.10 4.69 0.50 N 4 1 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.63 106.40 -2.77 0.40 N 5 1 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.69 113.10 4.59 0.50 N 6 1 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.84 106.40 -2.56 0.40 N 7 1 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.40 113.80 3.60 0.50 N 8 1 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.56 113.80 3.76 0.50 N 9 1 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.50 113.80 3.70 0.50 N 10 1 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.60 113.10 4.50 0.50 N 11 1 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.70 106.40 -2.70 0.40 N 12 1 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.75 113.10 4.65 0.50 N 13 1 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.82 106.40 -2.58 0.40 N 14 1 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.58 113.80 3.78 0.50 N 15 1 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.68 113.10 4.58 0.50 N 16 1 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.73 106.40 -2.67 0.40 N 17 1 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.48 113.80 3.68 0.50 N 18 1 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.53 113.80 3.73 0.50 N 19 2 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.65 113.10 4.55 0.50 N 20 2 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.73 106.40 -2.67 0.40 N 21 2 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.72 113.10 4.62 0.50 N 22 2 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.73 106.40 -2.67 0.40 N 23 2 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.74 113.10 4.64 0.50 N 24 2 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.80 106.40 -2.60 0.40 N 25 2 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.49 113.80 3.69 0.50 N 26 2 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.62 113.80 3.82 0.50 N 27 2 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.52 113.80 3.72 0.50 N 28 2 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.62 113.10 4.52 0.50 N 29 2 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.69 106.40 -2.71 0.40 N 30 2 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.62 113.10 4.52 0.50 N 31 2 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.66 106.40 -2.74 0.40 N 32 2 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.55 113.80 3.75 0.50 N 33 2 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.76 113.10 4.66 0.50 N 34 2 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.63 106.40 -2.78 0.40 N 35 2 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.51 113.80 3.71 0.50 N 36 2 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.52 113.80 3.72 0.50 N 37 3 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.55 113.10 4.45 0.50 N 38 3 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.76 106.40 -2.64 0.40 N 39 3 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 40 3 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.66 106.40 -2.74 0.40 N 41 3 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.76 113.10 4.66 0.50 N 42 3 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.81 106.40 -2.59 0.40 N 43 3 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.48 113.80 3.68 0.50 N 44 3 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.56 113.80 3.76 0.50 N 45 3 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.45 113.80 3.65 0.50 N 46 3 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.75 113.10 4.65 0.50 N 47 3 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.73 106.40 -2.67 0.40 N 48 3 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.61 113.10 4.51 0.50 N 49 3 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.68 106.40 -2.72 0.40 N 50 3 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.55 113.80 3.75 0.50 N 51 3 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.71 113.10 4.61 0.50 N 52 3 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.69 106.40 -2.71 0.40 N 53 3 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.54 113.80 3.74 0.50 N 54 3 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.54 113.80 3.74 0.50 N 55 4 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.65 113.10 4.55 0.50 N 56 4 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.73 106.40 -2.67 0.40 N 57 4 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.69 113.10 4.59 0.50 N 58 4 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.72 106.40 -2.68 0.40 N 59 4 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.77 113.10 4.67 0.50 N 60 4 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.75 106.40 -2.65 0.40 N 61 4 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.40 113.80 3.60 0.50 N 62 4 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.49 113.80 3.69 0.50 N 63 4 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.53 113.80 3.73 0.50 N 64 4 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.56 113.10 4.46 0.50 N 65 4 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.83 106.40 -2.57 0.40 N 66 4 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.69 113.10 4.59 0.50 N 67 4 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.74 106.40 -2.66 0.40 N 68 4 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.64 113.80 3.84 0.50 N 69 4 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.63 113.10 4.53 0.50 N 70 4 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.75 106.40 -2.65 0.40 N 71 4 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.59 113.80 3.79 0.50 N 72 4 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.54 113.80 3.74 0.50 N 73 5 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.61 113.10 4.51 0.50 N 74 5 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.76 106.40 -2.64 0.40 N 75 5 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 76 5 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.77 106.40 -2.63 0.40 N 77 5 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.79 113.10 4.69 0.50 N 78 5 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.85 106.40 -2.55 0.40 N 79 5 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.31 113.80 3.51 0.50 N 80 5 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.63 113.80 3.83 0.50 N 81 5 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.50 113.80 3.70 0.50 N 82 5 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.68 113.10 4.58 0.50 N 83 5 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.74 106.40 -2.66 0.40 N 84 5 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.75 113.10 4.65 0.50 N 85 5 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.83 106.40 -2.57 0.40 N 86 5 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.53 113.80 3.73 0.50 N 87 5 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.59 113.10 4.49 0.50 N 88 5 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.80 106.40 -2.60 0.40 N 89 5 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.63 113.80 3.83 0.50 N 90 5 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.51 113.80 3.71 0.50 N 91 6 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.56 113.10 4.46 0.50 N 92 6 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.81 106.40 -2.59 0.40 N 93 6 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.59 113.10 4.49 0.50 N 94 6 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.75 106.40 -2.65 0.40 N 95 6 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.79 113.10 4.69 0.50 N 96 6 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.87 106.40 -2.53 0.40 N 97 6 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.46 113.80 3.66 0.50 N 98 6 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.47 113.80 3.67 0.50 N 99 6 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.47 113.80 3.67 0.50 N 100 6 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.66 113.10 4.56 0.50 N 101 6 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.76 106.40 -2.64 0.40 N 102 6 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.67 113.10 4.57 0.50 N 103 6 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.77 106.40 -2.63 0.40 N 104 6 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.68 113.80 3.88 0.50 N 105 6 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.59 113.10 4.49 0.50 N 106 6 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.74 106.40 -2.66 0.40 N 107 6 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.48 113.80 3.68 0.50 N 108 6 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.46 113.80 3.66 0.50 N 109 7 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.60 113.10 4.50 0.50 N 110 7 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.75 106.40 -2.65 0.40 N 111 7 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 112 7 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.79 106.40 -2.61 0.40 N 113 7 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.64 113.10 4.54 0.50 N 114 7 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.83 106.40 -2.57 0.40 N 115 7 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.47 113.80 3.67 0.50 N 116 7 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.72 113.80 3.92 0.50 N 117 7 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.64 113.80 3.84 0.50 N 118 7 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.69 113.10 4.59 0.50 N 119 7 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.69 106.40 -2.71 0.40 N 120 7 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.57 113.10 4.47 0.50 N 121 7 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.76 106.40 -2.64 0.40 N 122 7 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.59 113.80 3.79 0.50 N 123 7 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.78 113.10 4.68 0.50 N 124 7 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.61 106.40 -2.79 0.40 N 125 7 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.57 113.80 3.77 0.50 N 126 7 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.49 113.80 3.69 0.50 N 127 8 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.62 113.10 4.52 0.50 N 128 8 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.72 106.40 -2.68 0.40 N 129 8 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.62 113.10 4.52 0.50 N 130 8 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.74 106.40 -2.66 0.40 N 131 8 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.79 113.10 4.69 0.50 N 132 8 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.82 106.40 -2.58 0.40 N 133 8 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.45 113.80 3.65 0.50 N 134 8 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.50 113.80 3.70 0.50 N 135 8 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.44 113.80 3.64 0.50 N 136 8 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.66 113.10 4.56 0.50 N 137 8 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.73 106.40 -2.67 0.40 N 138 8 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.60 113.10 4.50 0.50 N 139 8 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.75 106.40 -2.65 0.40 N 140 8 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.64 113.80 3.84 0.50 N 141 8 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.65 113.10 4.55 0.50 N 142 8 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.71 106.40 -2.69 0.40 N 143 8 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.50 113.80 3.70 0.50 N 144 8 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.59 113.80 3.79 0.50 N 145 9 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.67 113.10 4.57 0.50 N 146 9 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.67 106.40 -2.73 0.40 N 147 9 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.62 113.10 4.52 0.50 N 148 9 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.76 106.40 -2.64 0.40 N 149 9 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.76 113.10 4.66 0.50 N 150 9 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.74 106.40 -2.66 0.40 N 151 9 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.29 113.80 3.49 0.50 N 152 9 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.60 113.80 3.80 0.50 N 153 9 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.53 113.80 3.73 0.50 N 154 9 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.66 113.10 4.56 0.50 N 155 9 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.74 106.40 -2.66 0.40 N 156 9 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.63 113.10 4.53 0.50 N 157 9 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.75 106.40 -2.65 0.40 N 158 9 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.69 113.80 3.89 0.50 N 159 9 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.69 113.10 4.59 0.50 N 160 9 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.78 106.40 -2.62 0.40 N 161 9 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.55 113.80 3.75 0.50 N 162 9 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.51 113.80 3.71 0.50 N 163 10 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.70 113.10 4.60 0.50 N 164 10 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.77 106.40 -2.63 0.40 N 165 10 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.61 113.10 4.51 0.50 N 166 10 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.77 106.40 -2.63 0.40 N 167 10 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.73 113.10 4.63 0.50 N 168 10 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.90 106.40 -2.50 0.40 N 169 10 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.56 113.80 3.76 0.50 N 170 10 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.75 113.80 3.95 0.50 N 171 10 C8 A A 14 ? ? N9 A A 14 ? ? C4 A A 14 ? ? 103.37 105.80 -2.43 0.40 N 172 10 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.55 113.80 3.75 0.50 N 173 10 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.59 113.10 4.49 0.50 N 174 10 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.72 106.40 -2.68 0.40 N 175 10 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.63 113.10 4.53 0.50 N 176 10 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.75 106.40 -2.65 0.40 N 177 10 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.55 113.80 3.75 0.50 N 178 10 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.55 113.10 4.45 0.50 N 179 10 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.83 106.40 -2.57 0.40 N 180 10 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.59 113.80 3.79 0.50 N 181 10 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.56 113.80 3.76 0.50 N 182 11 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.61 113.10 4.51 0.50 N 183 11 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.76 106.40 -2.64 0.40 N 184 11 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.62 113.10 4.52 0.50 N 185 11 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.76 106.40 -2.64 0.40 N 186 11 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.71 113.10 4.61 0.50 N 187 11 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.87 106.40 -2.53 0.40 N 188 11 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.52 113.80 3.72 0.50 N 189 11 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.66 113.80 3.86 0.50 N 190 11 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.52 113.80 3.72 0.50 N 191 11 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.66 113.10 4.56 0.50 N 192 11 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.74 106.40 -2.66 0.40 N 193 11 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.60 113.10 4.50 0.50 N 194 11 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.83 106.40 -2.57 0.40 N 195 11 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.60 113.80 3.80 0.50 N 196 11 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.58 113.10 4.48 0.50 N 197 11 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.90 106.40 -2.50 0.40 N 198 11 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.56 113.80 3.76 0.50 N 199 11 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.56 113.80 3.76 0.50 N 200 12 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.58 113.10 4.48 0.50 N 201 12 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.77 106.40 -2.63 0.40 N 202 12 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.68 113.10 4.58 0.50 N 203 12 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.66 106.40 -2.74 0.40 N 204 12 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.70 113.10 4.60 0.50 N 205 12 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.93 106.40 -2.47 0.40 N 206 12 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.79 113.80 3.99 0.50 N 207 12 C8 A A 12 ? ? N9 A A 12 ? ? C4 A A 12 ? ? 103.13 105.80 -2.67 0.40 N 208 12 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.65 113.80 3.85 0.50 N 209 12 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.54 113.80 3.74 0.50 N 210 12 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.65 113.10 4.55 0.50 N 211 12 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.76 106.40 -2.64 0.40 N 212 12 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.74 113.10 4.64 0.50 N 213 12 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.75 106.40 -2.65 0.40 N 214 12 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.56 113.80 3.76 0.50 N 215 12 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.65 113.10 4.55 0.50 N 216 12 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.78 106.40 -2.62 0.40 N 217 12 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.62 113.80 3.82 0.50 N 218 12 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.53 113.80 3.73 0.50 N 219 13 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.63 113.10 4.53 0.50 N 220 13 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.73 106.40 -2.67 0.40 N 221 13 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.56 113.10 4.46 0.50 N 222 13 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.84 106.40 -2.56 0.40 N 223 13 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.77 113.10 4.67 0.50 N 224 13 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.80 106.40 -2.60 0.40 N 225 13 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.50 113.80 3.70 0.50 N 226 13 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.62 113.80 3.82 0.50 N 227 13 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.64 113.80 3.84 0.50 N 228 13 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.68 113.10 4.58 0.50 N 229 13 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.71 106.40 -2.69 0.40 N 230 13 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.62 113.10 4.52 0.50 N 231 13 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.74 106.40 -2.66 0.40 N 232 13 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.63 113.80 3.83 0.50 N 233 13 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.73 113.10 4.63 0.50 N 234 13 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.75 106.40 -2.65 0.40 N 235 13 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.56 113.80 3.76 0.50 N 236 13 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.58 113.80 3.78 0.50 N 237 14 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.67 113.10 4.57 0.50 N 238 14 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.76 106.40 -2.64 0.40 N 239 14 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.58 113.10 4.48 0.50 N 240 14 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.79 106.40 -2.61 0.40 N 241 14 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.78 113.10 4.68 0.50 N 242 14 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.89 106.40 -2.51 0.40 N 243 14 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.43 113.80 3.63 0.50 N 244 14 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.43 113.80 3.63 0.50 N 245 14 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.53 113.80 3.73 0.50 N 246 14 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.83 113.10 4.73 0.50 N 247 14 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.57 106.40 -2.83 0.40 N 248 14 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.62 113.10 4.52 0.50 N 249 14 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.66 106.40 -2.74 0.40 N 250 14 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.65 113.80 3.85 0.50 N 251 14 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.65 113.10 4.55 0.50 N 252 14 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.75 106.40 -2.65 0.40 N 253 14 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.62 113.80 3.82 0.50 N 254 14 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.63 113.80 3.83 0.50 N 255 15 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.62 113.10 4.52 0.50 N 256 15 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.72 106.40 -2.68 0.40 N 257 15 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.64 113.10 4.54 0.50 N 258 15 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.79 106.40 -2.61 0.40 N 259 15 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.58 113.10 4.48 0.50 N 260 15 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.72 106.40 -2.68 0.40 N 261 15 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.68 113.80 3.88 0.50 N 262 15 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.50 113.80 3.70 0.50 N 263 15 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.46 113.80 3.66 0.50 N 264 15 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.70 113.10 4.60 0.50 N 265 15 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.70 106.40 -2.70 0.40 N 266 15 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.66 113.10 4.56 0.50 N 267 15 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.72 106.40 -2.68 0.40 N 268 15 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.60 113.80 3.80 0.50 N 269 15 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.66 113.10 4.56 0.50 N 270 15 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.74 106.40 -2.66 0.40 N 271 15 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.50 113.80 3.70 0.50 N 272 15 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.61 113.80 3.81 0.50 N 273 16 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.66 113.10 4.56 0.50 N 274 16 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.71 106.40 -2.69 0.40 N 275 16 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.70 113.10 4.60 0.50 N 276 16 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.71 106.40 -2.69 0.40 N 277 16 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.74 113.10 4.64 0.50 N 278 16 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.95 106.40 -2.45 0.40 N 279 16 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.91 113.80 4.11 0.50 N 280 16 C8 A A 12 ? ? N9 A A 12 ? ? C4 A A 12 ? ? 103.02 105.80 -2.78 0.40 N 281 16 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.78 113.80 3.98 0.50 N 282 16 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.52 113.80 3.72 0.50 N 283 16 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.63 113.10 4.53 0.50 N 284 16 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.71 106.40 -2.69 0.40 N 285 16 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.57 113.10 4.47 0.50 N 286 16 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.85 106.40 -2.55 0.40 N 287 16 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.58 113.80 3.78 0.50 N 288 16 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.71 113.10 4.61 0.50 N 289 16 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.64 106.40 -2.76 0.40 N 290 16 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.51 113.80 3.71 0.50 N 291 16 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.40 113.80 3.60 0.50 N 292 17 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.59 113.10 4.49 0.50 N 293 17 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.81 106.40 -2.59 0.40 N 294 17 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.64 113.10 4.54 0.50 N 295 17 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.74 106.40 -2.66 0.40 N 296 17 N7 A G 10 ? ? C8 A G 10 ? ? N9 A G 10 ? ? 117.79 113.10 4.69 0.50 N 297 17 C8 A G 10 ? ? N9 A G 10 ? ? C4 A G 10 ? ? 103.99 106.40 -2.41 0.40 N 298 17 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 118.13 113.80 4.33 0.50 N 299 17 C8 A A 12 ? ? N9 A A 12 ? ? C4 A A 12 ? ? 102.84 105.80 -2.96 0.40 N 300 17 N7 A A 14 ? ? C8 A A 14 ? ? N9 A A 14 ? ? 117.65 113.80 3.85 0.50 N 301 17 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.48 113.80 3.68 0.50 N 302 17 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.71 113.10 4.61 0.50 N 303 17 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.67 106.40 -2.73 0.40 N 304 17 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.68 113.10 4.58 0.50 N 305 17 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.73 106.40 -2.67 0.40 N 306 17 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.72 113.80 3.92 0.50 N 307 17 N7 A G 20 ? ? C8 A G 20 ? ? N9 A G 20 ? ? 117.71 113.10 4.61 0.50 N 308 17 C8 A G 20 ? ? N9 A G 20 ? ? C4 A G 20 ? ? 103.71 106.40 -2.69 0.40 N 309 17 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.39 113.80 3.59 0.50 N 310 17 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.54 113.80 3.74 0.50 N # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id SSU _pdbx_struct_mod_residue.label_seq_id 19 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id SSU _pdbx_struct_mod_residue.auth_seq_id 19 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id U _pdbx_struct_mod_residue.details "URIDINE-5'-PHOSPHOROTHIOATE" # _pdbx_nmr_ensemble.entry_id 1NZ1 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 17 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1NZ1 _pdbx_nmr_representative.conformer_id 15 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '0.8-1.2 mM RNA, 50 mM NaCL, pH 7.0' H2O 2 '0.8-1.2 mM RNA, 50 mM NaCL, pH 7.0, 17 mg/mL PF1 Phage' H2O 3 '0.8-1.2 mM RNA, 50 mM NaCL, pH 7.0' D2O # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 ambient 7.0 '50 mM NaCl' ? K 2 303 ambient 7.2 '50 mM NaCl' ? K 3 303 ambient 7.0 '50 mM NaCl' ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 2 2 HSQC 3 3 3 HSQC 4 3 3 '2D NOESY' 5 3 3 '2D TOCSY' # _pdbx_nmr_details.entry_id 1NZ1 _pdbx_nmr_details.text ;Solution structure based on 322 NOE derived distance restraints, 144 dihedral angle restraints, 25 hydrogen bond restraints, and 40 residual dipolar copupling restraints. ; # _pdbx_nmr_refine.entry_id 1NZ1 _pdbx_nmr_refine.method 'Torsion angle and molecular dynamics, simulated annealing, residual dipolar coupling' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal XwinNMR 2.6 collection Bruker 1 Felix 98 processing Accelrys 2 Sparky 3 'data analysis' 'Goddard, T.D. and D.G. Kneller' 3 CNS 1.1 'structure solution' Brunger 4 X-PLOR 3.1 refinement Brunger 5 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 SSU "O2'" O N N 111 SSU "C2'" C N R 112 SSU "C1'" C N R 113 SSU "O4'" O N N 114 SSU "C4'" C N R 115 SSU "C5'" C N N 116 SSU "O5'" O N N 117 SSU P P N N 118 SSU S1P S N N 119 SSU OP2 O N N 120 SSU OP3 O N N 121 SSU "C3'" C N S 122 SSU "O3'" O N N 123 SSU N1 N N N 124 SSU C6 C N N 125 SSU C5 C N N 126 SSU C4 C N N 127 SSU O4 O N N 128 SSU N3 N N N 129 SSU C2 C N N 130 SSU O2 O N N 131 SSU "HO2'" H N N 132 SSU "H2'" H N N 133 SSU "H1'" H N N 134 SSU "H4'" H N N 135 SSU "H5'" H N N 136 SSU "H5''" H N N 137 SSU H2P H N N 138 SSU H3P H N N 139 SSU "H3'" H N N 140 SSU "HO3'" H N N 141 SSU H6 H N N 142 SSU H5 H N N 143 SSU H3 H N N 144 U OP3 O N N 145 U P P N N 146 U OP1 O N N 147 U OP2 O N N 148 U "O5'" O N N 149 U "C5'" C N N 150 U "C4'" C N R 151 U "O4'" O N N 152 U "C3'" C N S 153 U "O3'" O N N 154 U "C2'" C N R 155 U "O2'" O N N 156 U "C1'" C N R 157 U N1 N N N 158 U C2 C N N 159 U O2 O N N 160 U N3 N N N 161 U C4 C N N 162 U O4 O N N 163 U C5 C N N 164 U C6 C N N 165 U HOP3 H N N 166 U HOP2 H N N 167 U "H5'" H N N 168 U "H5''" H N N 169 U "H4'" H N N 170 U "H3'" H N N 171 U "HO3'" H N N 172 U "H2'" H N N 173 U "HO2'" H N N 174 U "H1'" H N N 175 U H3 H N N 176 U H5 H N N 177 U H6 H N N 178 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 SSU "O2'" "C2'" sing N N 116 SSU "O2'" "HO2'" sing N N 117 SSU "C2'" "C1'" sing N N 118 SSU "C2'" "C3'" sing N N 119 SSU "C2'" "H2'" sing N N 120 SSU "C1'" "O4'" sing N N 121 SSU "C1'" N1 sing N N 122 SSU "C1'" "H1'" sing N N 123 SSU "O4'" "C4'" sing N N 124 SSU "C4'" "C5'" sing N N 125 SSU "C4'" "C3'" sing N N 126 SSU "C4'" "H4'" sing N N 127 SSU "C5'" "O5'" sing N N 128 SSU "C5'" "H5'" sing N N 129 SSU "C5'" "H5''" sing N N 130 SSU "O5'" P sing N N 131 SSU P S1P doub N N 132 SSU P OP2 sing N N 133 SSU P OP3 sing N N 134 SSU OP2 H2P sing N N 135 SSU OP3 H3P sing N N 136 SSU "C3'" "O3'" sing N N 137 SSU "C3'" "H3'" sing N N 138 SSU "O3'" "HO3'" sing N N 139 SSU N1 C6 sing N N 140 SSU N1 C2 sing N N 141 SSU C6 C5 doub N N 142 SSU C6 H6 sing N N 143 SSU C5 C4 sing N N 144 SSU C5 H5 sing N N 145 SSU C4 O4 doub N N 146 SSU C4 N3 sing N N 147 SSU N3 C2 sing N N 148 SSU N3 H3 sing N N 149 SSU C2 O2 doub N N 150 U OP3 P sing N N 151 U OP3 HOP3 sing N N 152 U P OP1 doub N N 153 U P OP2 sing N N 154 U P "O5'" sing N N 155 U OP2 HOP2 sing N N 156 U "O5'" "C5'" sing N N 157 U "C5'" "C4'" sing N N 158 U "C5'" "H5'" sing N N 159 U "C5'" "H5''" sing N N 160 U "C4'" "O4'" sing N N 161 U "C4'" "C3'" sing N N 162 U "C4'" "H4'" sing N N 163 U "O4'" "C1'" sing N N 164 U "C3'" "O3'" sing N N 165 U "C3'" "C2'" sing N N 166 U "C3'" "H3'" sing N N 167 U "O3'" "HO3'" sing N N 168 U "C2'" "O2'" sing N N 169 U "C2'" "C1'" sing N N 170 U "C2'" "H2'" sing N N 171 U "O2'" "HO2'" sing N N 172 U "C1'" N1 sing N N 173 U "C1'" "H1'" sing N N 174 U N1 C2 sing N N 175 U N1 C6 sing N N 176 U C2 O2 doub N N 177 U C2 N3 sing N N 178 U N3 C4 sing N N 179 U N3 H3 sing N N 180 U C4 O4 doub N N 181 U C4 C5 sing N N 182 U C5 C6 doub N N 183 U C5 H5 sing N N 184 U C6 H6 sing N N 185 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1NZ1 'a-form double helix' 1NZ1 'hairpin loop' 1NZ1 'bulge loop' 1NZ1 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 24 1_555 -0.656 -0.064 0.032 0.674 0.712 -4.845 1 A_G1:C24_A A 1 ? A 24 ? 19 1 1 A G 2 1_555 A C 23 1_555 -0.908 -0.206 0.052 -0.711 -0.186 2.087 2 A_G2:C23_A A 2 ? A 23 ? 19 1 1 A U 3 1_555 A A 22 1_555 0.582 -0.150 0.086 -0.255 -0.906 -11.622 3 A_U3:A22_A A 3 ? A 22 ? 20 1 1 A U 4 1_555 A A 21 1_555 -0.894 -0.086 -0.078 1.269 0.570 -4.926 4 A_U4:A21_A A 4 ? A 21 ? 20 1 1 A C 5 1_555 A G 20 1_555 -0.097 -0.183 0.053 -0.245 -0.961 -0.618 5 A_C5:G20_A A 5 ? A 20 ? 19 1 1 A C 6 1_555 A A 18 1_555 2.281 -0.596 -0.220 4.896 -4.838 7.897 6 A_C6:A18_A A 6 ? A 18 ? ? 1 1 A C 7 1_555 A G 17 1_555 0.516 -0.253 0.086 -3.237 -3.134 -3.392 7 A_C7:G17_A A 7 ? A 17 ? 19 1 1 A C 8 1_555 A G 16 1_555 0.694 -0.090 -0.072 1.602 0.864 2.261 8 A_C8:G16_A A 8 ? A 16 ? 19 1 1 A U 9 1_555 A A 15 1_555 -0.849 -0.030 0.051 0.828 -0.707 -8.116 9 A_U9:A15_A A 9 ? A 15 ? 20 1 1 A G 10 1_555 A A 14 1_555 6.595 -3.599 -0.043 6.029 6.307 11.888 10 A_G10:A14_A A 10 ? A 14 ? 11 9 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 24 1_555 A G 2 1_555 A C 23 1_555 -0.056 -1.116 4.480 -1.644 -7.370 32.872 -0.237 -0.280 4.612 -12.813 2.858 33.705 1 AA_G1G2:C23C24_AA A 1 ? A 24 ? A 2 ? A 23 ? 1 A G 2 1_555 A C 23 1_555 A U 3 1_555 A A 22 1_555 -1.003 -1.677 3.251 0.663 20.626 39.684 -3.885 1.378 2.152 28.194 -0.906 44.537 2 AA_G2U3:A22C23_AA A 2 ? A 23 ? A 3 ? A 22 ? 1 A U 3 1_555 A A 22 1_555 A U 4 1_555 A A 21 1_555 0.513 -1.364 4.068 0.689 -4.709 26.882 -1.387 -0.866 4.251 -10.028 -1.467 27.292 3 AA_U3U4:A21A22_AA A 3 ? A 22 ? A 4 ? A 21 ? 1 A U 4 1_555 A A 21 1_555 A C 5 1_555 A G 20 1_555 0.122 -1.079 3.570 -0.906 26.594 32.634 -4.271 -0.265 2.138 40.064 1.364 41.877 4 AA_U4C5:G20A21_AA A 4 ? A 21 ? A 5 ? A 20 ? 1 A C 5 1_555 A G 20 1_555 A C 6 1_555 A A 18 1_555 4.405 0.165 5.110 -16.050 4.148 58.591 -0.119 -5.451 3.898 4.148 16.052 60.690 5 AA_C5C6:A18G20_AA A 5 ? A 20 ? A 6 ? A 18 ? 1 A C 6 1_555 A A 18 1_555 A C 7 1_555 A G 17 1_555 -0.949 -2.014 3.694 2.416 9.141 20.588 -8.409 3.284 2.459 24.009 -6.346 22.634 6 AA_C6C7:G17A18_AA A 6 ? A 18 ? A 7 ? A 17 ? 1 A C 7 1_555 A G 17 1_555 A C 8 1_555 A G 16 1_555 1.186 -0.669 3.263 6.706 2.007 38.593 -1.242 -0.947 3.377 3.006 -10.045 39.199 7 AA_C7C8:G16G17_AA A 7 ? A 17 ? A 8 ? A 16 ? 1 A C 8 1_555 A G 16 1_555 A U 9 1_555 A A 15 1_555 -1.926 -1.525 3.120 0.148 15.010 23.423 -6.150 4.044 1.817 32.984 -0.325 27.763 8 AA_C8U9:A15G16_AA A 8 ? A 16 ? A 9 ? A 15 ? 1 A U 9 1_555 A A 15 1_555 A G 10 1_555 A A 14 1_555 2.295 0.115 4.549 -11.895 -28.207 62.424 1.515 -2.626 3.772 -25.652 10.818 68.840 9 AA_U9G10:A14A15_AA A 9 ? A 15 ? A 10 ? A 14 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Bruker DMX 750 2 ? Bruker DMX 600 3 ? Bruker DMX 500 4 ? Bruker DMX 400 # _atom_sites.entry_id 1NZ1 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P S # loop_