data_1SZY # _entry.id 1SZY # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1SZY pdb_00001szy 10.2210/pdb1szy/pdb RCSB RCSB022139 ? ? WWPDB D_1000022139 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1SZY _pdbx_database_status.recvd_initial_deposition_date 2004-04-06 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Schweisguth, D.C.' 1 'Moore, P.B.' 2 # _citation.id primary _citation.title 'On the conformation of the anticodon loops of initiator and elongator methionine tRNAs.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 267 _citation.page_first 505 _citation.page_last 519 _citation.year 1997 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9126834 _citation.pdbx_database_id_DOI 10.1006/jmbi.1996.0903 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Schweisguth, D.C.' 1 ? primary 'Moore, P.B.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-R(P*GP*GP*CP*AP*GP*GP*GP*CP*UP*CP*AP*UP*AP*AP*CP*CP*CP*UP*GP*CP*C)-3'" _entity.formula_weight 6703.052 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCAGGGCUCAUAACCCUGCC _entity_poly.pdbx_seq_one_letter_code_can GGCAGGGCUCAUAACCCUGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 G n 1 6 G n 1 7 G n 1 8 C n 1 9 U n 1 10 C n 1 11 A n 1 12 U n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 C n 1 18 U n 1 19 G n 1 20 C n 1 21 C n # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1SZY _struct_ref.pdbx_db_accession 1SZY _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1SZY _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 21 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1SZY _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 21 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 21 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 1 1 DQF-COSY 3 1 1 '13C-1H HSQC' 4 1 1 TOCSY 5 1 1 'GE JRSE NOESY' 6 1 1 '31P-1H COSY' 7 1 1 '31P-1H heteroTOCSY' 8 1 1 '31P-1H heteroTOCSY-NOESY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 303 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength ? _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents 'S1 NMR buffer; 100mM KCl, 50mM NaCl, 4mM Na cacodylate, 0.2mM EDTA' _pdbx_nmr_sample_details.solvent_system ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Yale homebuilt 490 2 ? Bruker AM 500 3 ? GE OMEGA 500 4 ? Varian UNITY 500 5 ? Varian UNITYPLUS 600 # _pdbx_nmr_refine.entry_id 1SZY _pdbx_nmr_refine.method 'Distance geometry, simulated annealing' _pdbx_nmr_refine.details ;RNA topology and parameters from Rife and Moore, NAR, 1996. Constraints in loop included 128 NOEs, 7 chi dihedrals inferred from NOEs, 20 v0-v4 ribose dihedrals, 8 a and z P dihedrals, 12 b and g P dihedrals and 7 e P dihedrals. Stem was constrained to A-form based on qualitative spectral analysis. ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_details.entry_id 1SZY _pdbx_nmr_details.text 'See DCS dissertation p. 61.' # _pdbx_nmr_ensemble.entry_id 1SZY _pdbx_nmr_ensemble.conformers_calculated_total_number ? _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria ? # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal Felix unknown processing ? 1 X-PLOR 3.1 'structure solution' ? 2 X-PLOR 3.1 refinement ? 3 # _exptl.entry_id 1SZY _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 1SZY _struct.title ;Solution structure of ITALY1 ("Initiator tRNA Anticodon Loop from Yeast"), an unmodified 21-nt RNA with the sequence of the anticodon stem-loop of yeast initiator tRNA ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1SZY _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'Initiator tRNA Anticodon Loop, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 3 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 3 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 3 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 18 N3 ? ? A A 4 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 18 O4 ? ? A A 4 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 17 N3 ? ? A G 5 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 17 O2 ? ? A G 5 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 17 N4 ? ? A G 5 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 16 N3 ? ? A G 6 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 16 O2 ? ? A G 6 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 6 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 15 N3 ? ? A G 7 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 15 O2 ? ? A G 7 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 7 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 7 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A A 13 N6 ? ? A C 8 A A 13 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1SZY _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1SZY _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G GUA A . n A 1 2 G 2 2 2 G GUA A . n A 1 3 C 3 3 3 C CYT A . n A 1 4 A 4 4 4 A ADE A . n A 1 5 G 5 5 5 G GUA A . n A 1 6 G 6 6 6 G GUA A . n A 1 7 G 7 7 7 G GUA A . n A 1 8 C 8 8 8 C CYT A . n A 1 9 U 9 9 9 U URI A . n A 1 10 C 10 10 10 C CYT A . n A 1 11 A 11 11 11 A ADE A . n A 1 12 U 12 12 12 U URI A . n A 1 13 A 13 13 13 A ADE A . n A 1 14 A 14 14 14 A ADE A . n A 1 15 C 15 15 15 C CYT A . n A 1 16 C 16 16 16 C CYT A . n A 1 17 C 17 17 17 C CYT A . n A 1 18 U 18 18 18 U URI A . n A 1 19 G 19 19 19 G GUA A . n A 1 20 C 20 20 20 C CYT A . n A 1 21 C 21 21 21 C CYT A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2004-04-20 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-02 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1SZY 'a-form double helix' 1SZY 'hairpin loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 21 1_555 -0.157 -0.170 0.029 -2.474 5.661 -1.786 1 A_G1:C21_A A 1 ? A 21 ? 19 1 1 A G 2 1_555 A C 20 1_555 -0.233 -0.191 -0.081 -1.977 9.116 -2.098 2 A_G2:C20_A A 2 ? A 20 ? 19 1 1 A C 3 1_555 A G 19 1_555 0.264 -0.202 -0.119 2.219 8.708 -2.735 3 A_C3:G19_A A 3 ? A 19 ? 19 1 1 A A 4 1_555 A U 18 1_555 -0.079 -0.145 -0.085 -1.973 8.848 -3.960 4 A_A4:U18_A A 4 ? A 18 ? 20 1 1 A G 5 1_555 A C 17 1_555 -0.248 -0.171 -0.029 -2.294 9.326 -2.498 5 A_G5:C17_A A 5 ? A 17 ? 19 1 1 A G 6 1_555 A C 16 1_555 -0.100 -0.171 -0.067 -1.786 8.761 -1.878 6 A_G6:C16_A A 6 ? A 16 ? 19 1 1 A G 7 1_555 A C 15 1_555 -0.253 -0.172 0.034 -4.487 5.066 -2.177 7 A_G7:C15_A A 7 ? A 15 ? 19 1 1 A C 8 1_555 A A 13 1_555 5.566 -1.219 -0.945 -11.770 33.778 -21.749 8 A_C8:A13_A A 8 ? A 13 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 21 1_555 A G 2 1_555 A C 20 1_555 0.039 -1.651 3.305 -0.608 11.422 31.028 -4.697 -0.164 2.553 20.498 1.092 33.020 1 AA_G1G2:C20C21_AA A 1 ? A 21 ? A 2 ? A 20 ? 1 A G 2 1_555 A C 20 1_555 A C 3 1_555 A G 19 1_555 -0.052 -1.611 3.208 0.479 9.872 33.708 -4.024 0.152 2.645 16.586 -0.805 35.086 2 AA_G2C3:G19C20_AA A 2 ? A 20 ? A 3 ? A 19 ? 1 A C 3 1_555 A G 19 1_555 A A 4 1_555 A U 18 1_555 -0.098 -1.748 3.555 0.147 12.748 28.857 -5.552 0.207 2.571 24.147 -0.278 31.493 3 AA_C3A4:U18G19_AA A 3 ? A 19 ? A 4 ? A 18 ? 1 A A 4 1_555 A U 18 1_555 A G 5 1_555 A C 17 1_555 0.168 -1.774 3.430 -0.815 9.748 29.609 -5.098 -0.464 2.717 18.451 1.543 31.149 4 AA_A4G5:C17U18_AA A 4 ? A 18 ? A 5 ? A 17 ? 1 A G 5 1_555 A C 17 1_555 A G 6 1_555 A C 16 1_555 0.048 -1.638 3.386 -0.237 10.655 30.702 -4.717 -0.125 2.682 19.404 0.431 32.457 5 AA_G5G6:C16C17_AA A 5 ? A 17 ? A 6 ? A 16 ? 1 A G 6 1_555 A C 16 1_555 A G 7 1_555 A C 15 1_555 0.166 -1.677 3.473 -0.447 10.275 31.300 -4.686 -0.368 2.795 18.431 0.801 32.906 6 AA_G6G7:C15C16_AA A 6 ? A 16 ? A 7 ? A 15 ? 1 A G 7 1_555 A C 15 1_555 A C 8 1_555 A A 13 1_555 0.190 -1.792 5.845 -6.553 7.327 69.020 -2.034 -0.582 5.620 6.433 5.754 69.631 7 AA_G7C8:A13C15_AA A 7 ? A 15 ? A 8 ? A 13 ? #