data_1UUI # _entry.id 1UUI # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1UUI pdb_00001uui 10.2210/pdb1uui/pdb PDBE EBI-14258 ? ? WWPDB D_1290014258 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2004-02-12 2 'Structure model' 1 1 2011-05-08 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_database_status # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.status_code_mr' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1UUI _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.SG_entry . _pdbx_database_status.recvd_initial_deposition_date 2003-12-19 _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.content_type _pdbx_database_related.details PDB 1UTS unspecified 'DESIGNED HIV-1 TAR BINDING LIGAND' PDB 1UUD unspecified 'DESIGNED HIV-1 TAR BINDING LIGAND' # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Davis, B.' 1 'Afshar, M.' 2 'Varani, G.' 3 'Karn, J.' 4 'Murchie, A.I.H.' 5 'Lentzen, G.' 6 'Drysdale, M.J.' 7 'Potter, A.J.' 8 'Bower, J.' 9 'Aboul-Ela, F.' 10 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary ;Rational Design of Inhibitors of HIV-1 Tar RNA Through the Stabilisation of Electrostatic "Hot Spots" ; J.Mol.Biol. 336 343 ? 2004 JMOBAK UK 0022-2836 0070 ? 14757049 10.1016/J.JMB.2003.12.046 1 'The Structure of the Human Immunodeficiency Virus Type-1 Tar RNA Reveals Principles of RNA Recognition by Tat Protein' J.Mol.Biol. 253 313 ? 1995 JMOBAK UK 0022-2836 0070 ? 7563092 10.1006/JMBI.1995.0555 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Davis, B.' 1 ? primary 'Afshar, M.' 2 ? primary 'Varani, G.' 3 ? primary 'Murchie, A.I.H.' 4 ? primary 'Karn, J.' 5 ? primary 'Lentzen, G.' 6 ? primary 'Drysdale, M.J.' 7 ? primary 'Bower, J.' 8 ? primary 'Potter, A.J.' 9 ? primary 'Aboul-Ela, F.' 10 ? 1 'Aboul-Ela, F.' 11 ? 1 'Jkarn, J.' 12 ? 1 'Varani, G.' 13 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*AP*GP*CP* CP*UP*GP*GP*GP*AP*GP*CP*UP*CP*UP*CP*UP*GP*CP*C)-3' ; 9307.555 1 ? ? 'HIV_1 TAR BULGED STEM LOOP' ;BULGED STEM LOOP REGION FROM 5'LTR OF HIV-1 MRNA-BINDING SITE FOR TRANSCRIPTIONAL ACTIVATOR PROTEIN TAT. ; 2 non-polymer syn '4-[AMINO(IMINO)METHYL]-1-[2-(3-AMMONIOPROPOXY)-5-METHOXYBENZYL]PIPERAZIN-1-IUM' 323.434 1 ? ? ? ? # _entity_name_com.entity_id 1 _entity_name_com.name 'HIV-1 TAR RNA' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCAGAUCUGAGCCUGGGAGCUCUCUGCC _entity_poly.pdbx_seq_one_letter_code_can GGCAGAUCUGAGCCUGGGAGCUCUCUGCC _entity_poly.pdbx_strand_id B _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name '4-[AMINO(IMINO)METHYL]-1-[2-(3-AMMONIOPROPOXY)-5-METHOXYBENZYL]PIPERAZIN-1-IUM' _pdbx_entity_nonpoly.comp_id P12 # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 G n 1 6 A n 1 7 U n 1 8 C n 1 9 U n 1 10 G n 1 11 A n 1 12 G n 1 13 C n 1 14 C n 1 15 U n 1 16 G n 1 17 G n 1 18 G n 1 19 A n 1 20 G n 1 21 C n 1 22 U n 1 23 C n 1 24 U n 1 25 C n 1 26 U n 1 27 G n 1 28 C n 1 29 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 (CLONE 12)' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11679 _pdbx_entity_src_syn.details '29 NUCLEOTIDE SEQUENCE COMPRSISING PRIMARY BINDING SITE OF HIV-1 TAT, SYNTHESIZED USING T7 RNA POLYMERASE OFF OF A DNA TEMPLATE' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 P12 non-polymer . '4-[AMINO(IMINO)METHYL]-1-[2-(3-AMMONIOPROPOXY)-5-METHOXYBENZYL]PIPERAZIN-1-IUM' 'RBT205 INHIBITOR' 'C16 H29 N5 O2 2' 323.434 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 17 17 G G B . n A 1 2 G 2 18 18 G G B . n A 1 3 C 3 19 19 C C B . n A 1 4 A 4 20 20 A A B . n A 1 5 G 5 21 21 G G B . n A 1 6 A 6 22 22 A A B . n A 1 7 U 7 23 23 U U B . n A 1 8 C 8 24 24 C C B . n A 1 9 U 9 25 25 U U B . n A 1 10 G 10 26 26 G G B . n A 1 11 A 11 27 27 A A B . n A 1 12 G 12 28 28 G G B . n A 1 13 C 13 29 29 C C B . n A 1 14 C 14 30 30 C C B . n A 1 15 U 15 31 31 U U B . n A 1 16 G 16 32 32 G G B . n A 1 17 G 17 33 33 G G B . n A 1 18 G 18 34 34 G G B . n A 1 19 A 19 35 35 A A B . n A 1 20 G 20 36 36 G G B . n A 1 21 C 21 37 37 C C B . n A 1 22 U 22 38 38 U U B . n A 1 23 C 23 39 39 C C B . n A 1 24 U 24 40 40 U U B . n A 1 25 C 25 41 41 C C B . n A 1 26 U 26 42 42 U U B . n A 1 27 G 27 43 43 G G B . n A 1 28 C 28 44 44 C C B . n A 1 29 C 29 45 45 C C B . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id P12 _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 1046 _pdbx_nonpoly_scheme.auth_seq_num 1046 _pdbx_nonpoly_scheme.pdb_mon_id P12 _pdbx_nonpoly_scheme.auth_mon_id P12 _pdbx_nonpoly_scheme.pdb_strand_id B _pdbx_nonpoly_scheme.pdb_ins_code . # _cell.entry_id 1UUI _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1UUI _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1UUI _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 1UUI _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1UUI _struct.title 'NMR structure of a synthetic small molecule, rbt158, bound to HIV-1 TAR RNA' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details 'MINIMIZED AVERAGE' # _struct_keywords.entry_id 1UUI _struct_keywords.pdbx_keywords HIV-1 _struct_keywords.text 'HIV-1, TAR RNA, DRUG DESIGN, LIGAND-RNA INTERACTION, RNA BULGE, INHIBITOR' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 1UUI _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_db_accession 1UUI _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1UUI _struct_ref_seq.pdbx_strand_id B _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 29 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1UUI _struct_ref_seq.db_align_beg 17 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 45 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 17 _struct_ref_seq.pdbx_auth_seq_align_end 45 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 29 N3 ? ? B G 17 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 29 O2 ? ? B G 17 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 29 N4 ? ? B G 17 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 28 N3 ? ? B G 18 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 28 O2 ? ? B G 18 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 28 N4 ? ? B G 18 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 27 N1 ? ? B C 19 B G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 27 O6 ? ? B C 19 B G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 27 N2 ? ? B C 19 B G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 26 N3 ? ? B A 20 B U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 26 O4 ? ? B A 20 B U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 25 N3 ? ? B G 21 B C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 25 O2 ? ? B G 21 B C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 25 N4 ? ? B G 21 B C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 24 N3 ? ? B A 22 B U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 24 O4 ? ? B A 22 B U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 11 N7 ? ? B U 23 B A 27 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 11 N6 ? ? B U 23 B A 27 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog19 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 23 N3 ? ? B G 26 B C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 23 O2 ? ? B G 26 B C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 23 N4 ? ? B G 26 B C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 22 N3 ? ? B A 27 B U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 22 O4 ? ? B A 27 B U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? B G 28 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? B G 28 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? B G 28 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 20 N1 ? ? B C 29 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 20 O6 ? ? B C 29 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 20 N2 ? ? B C 29 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id ? _struct_site.pdbx_auth_comp_id ? _struct_site.pdbx_auth_seq_id ? _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 7 _struct_site.details 'BINDING SITE FOR RESIDUE P12 B1046' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 7 A A 6 ? A B 22 . ? 1_555 ? 2 AC1 7 U A 7 ? U B 23 . ? 1_555 ? 3 AC1 7 G A 10 ? G B 26 . ? 1_555 ? 4 AC1 7 A A 11 ? A B 27 . ? 1_555 ? 5 AC1 7 C A 21 ? C B 37 . ? 1_555 ? 6 AC1 7 U A 22 ? U B 38 . ? 1_555 ? 7 AC1 7 C A 23 ? C B 39 . ? 1_555 ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N7 B G 17 ? ? C8 B G 17 ? ? N9 B G 17 ? ? 117.71 113.10 4.61 0.50 N 2 1 C8 B G 17 ? ? N9 B G 17 ? ? C4 B G 17 ? ? 103.70 106.40 -2.70 0.40 N 3 1 N7 B G 18 ? ? C8 B G 18 ? ? N9 B G 18 ? ? 117.68 113.10 4.58 0.50 N 4 1 C8 B G 18 ? ? N9 B G 18 ? ? C4 B G 18 ? ? 103.74 106.40 -2.66 0.40 N 5 1 N7 B A 20 ? ? C8 B A 20 ? ? N9 B A 20 ? ? 117.51 113.80 3.71 0.50 N 6 1 N7 B G 21 ? ? C8 B G 21 ? ? N9 B G 21 ? ? 117.66 113.10 4.56 0.50 N 7 1 C8 B G 21 ? ? N9 B G 21 ? ? C4 B G 21 ? ? 103.74 106.40 -2.66 0.40 N 8 1 N7 B A 22 ? ? C8 B A 22 ? ? N9 B A 22 ? ? 117.51 113.80 3.71 0.50 N 9 1 N7 B G 26 ? ? C8 B G 26 ? ? N9 B G 26 ? ? 117.61 113.10 4.51 0.50 N 10 1 C8 B G 26 ? ? N9 B G 26 ? ? C4 B G 26 ? ? 103.77 106.40 -2.63 0.40 N 11 1 N7 B A 27 ? ? C8 B A 27 ? ? N9 B A 27 ? ? 117.65 113.80 3.85 0.50 N 12 1 N7 B G 28 ? ? C8 B G 28 ? ? N9 B G 28 ? ? 117.62 113.10 4.52 0.50 N 13 1 C8 B G 28 ? ? N9 B G 28 ? ? C4 B G 28 ? ? 103.77 106.40 -2.63 0.40 N 14 1 N7 B G 32 ? ? C8 B G 32 ? ? N9 B G 32 ? ? 117.65 113.10 4.55 0.50 N 15 1 C8 B G 32 ? ? N9 B G 32 ? ? C4 B G 32 ? ? 103.77 106.40 -2.63 0.40 N 16 1 N7 B G 33 ? ? C8 B G 33 ? ? N9 B G 33 ? ? 117.64 113.10 4.54 0.50 N 17 1 C8 B G 33 ? ? N9 B G 33 ? ? C4 B G 33 ? ? 103.78 106.40 -2.62 0.40 N 18 1 N7 B G 34 ? ? C8 B G 34 ? ? N9 B G 34 ? ? 117.57 113.10 4.47 0.50 N 19 1 C8 B G 34 ? ? N9 B G 34 ? ? C4 B G 34 ? ? 103.79 106.40 -2.61 0.40 N 20 1 N7 B A 35 ? ? C8 B A 35 ? ? N9 B A 35 ? ? 117.56 113.80 3.76 0.50 N 21 1 N7 B G 36 ? ? C8 B G 36 ? ? N9 B G 36 ? ? 117.68 113.10 4.58 0.50 N 22 1 C8 B G 36 ? ? N9 B G 36 ? ? C4 B G 36 ? ? 103.71 106.40 -2.69 0.40 N 23 1 N7 B G 43 ? ? C8 B G 43 ? ? N9 B G 43 ? ? 117.64 113.10 4.54 0.50 N 24 1 C8 B G 43 ? ? N9 B G 43 ? ? C4 B G 43 ? ? 103.76 106.40 -2.64 0.40 N # _pdbx_nmr_ensemble.entry_id 1UUI _pdbx_nmr_ensemble.conformers_calculated_total_number 50 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria 'LEAST RESTRRAINT VIOLATION ENERGY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 20 _pdbx_nmr_exptl_sample_conditions.ionic_strength_units ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 NOESY 1 2 1 TOCSY 1 3 1 COSY 1 4 1 ROESY 1 # _pdbx_nmr_details.entry_id 1UUI _pdbx_nmr_details.text ;THE STRUCTURE WAS DETERMINED USING HOMONUCLEAR NMR SPECTROSCOPY, DETECTING INTERMOLECULAR NOES. RNA INTRAMOLECULAR RESTRAINTS WERE AS IN ABOUL-ELA ET AL, JMB 1995, AS THE NMR SPECTRA FOR THE RNA AS ABOUND BY THE LIGAND RBT203 SHOWED SIMILAR NOE AND CHEMICAL SHIFT PATTERNS TO THE LATTER ; # _pdbx_nmr_refine.entry_id 1UUI _pdbx_nmr_refine.method 'NOE-RESTRAINED DYNAMICS' _pdbx_nmr_refine.details ;REFINEMENT INCLUDED A NUMBER OF MODELLING CONSTRAINTS BASED UPON PREVIOUSLY PUBLISHED DATA, AS WELL AS FINAL GENTLE REFINEMENT STEP USING CHARMM. DETAILS CAN BE FOUND IN THE JOURNAL CITATION ABOVE ; _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR ? BRUNGER 1 'structure solution' XPLOR/CHARMM ? ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 P12 C5 C Y N 111 P12 C4 C Y N 112 P12 C3 C Y N 113 P12 C2 C Y N 114 P12 C1 C Y N 115 P12 C6 C Y N 116 P12 OA O N N 117 P12 CB C N N 118 P12 CG C N N 119 P12 CD C N N 120 P12 NE N N N 121 P12 CG1 C N N 122 P12 CD1 C N N 123 P12 NE1 N N N 124 P12 CD2 C N N 125 P12 CG2 C N N 126 P12 NB N N N 127 P12 CA C N N 128 P12 CZ C N N 129 P12 NH1 N N N 130 P12 NH2 N N N 131 P12 OA1 O N N 132 P12 CB1 C N N 133 P12 H5 H N N 134 P12 H3 H N N 135 P12 H6 H N N 136 P12 HB1 H N N 137 P12 HB2 H N N 138 P12 HG1 H N N 139 P12 HG2 H N N 140 P12 HD1 H N N 141 P12 HD2 H N N 142 P12 HE1 H N N 143 P12 HE2 H N N 144 P12 HE3 H N N 145 P12 HG11 H N N 146 P12 HG12 H N N 147 P12 HD11 H N N 148 P12 HD12 H N N 149 P12 HD21 H N N 150 P12 HD22 H N N 151 P12 HG21 H N N 152 P12 HG22 H N N 153 P12 HB H N N 154 P12 HA1 H N N 155 P12 HA2 H N N 156 P12 HH11 H N N 157 P12 HH21 H N N 158 P12 HH22 H N N 159 P12 HB11 H N N 160 P12 HB12 H N N 161 P12 HB3 H N N 162 U OP3 O N N 163 U P P N N 164 U OP1 O N N 165 U OP2 O N N 166 U "O5'" O N N 167 U "C5'" C N N 168 U "C4'" C N R 169 U "O4'" O N N 170 U "C3'" C N S 171 U "O3'" O N N 172 U "C2'" C N R 173 U "O2'" O N N 174 U "C1'" C N R 175 U N1 N N N 176 U C2 C N N 177 U O2 O N N 178 U N3 N N N 179 U C4 C N N 180 U O4 O N N 181 U C5 C N N 182 U C6 C N N 183 U HOP3 H N N 184 U HOP2 H N N 185 U "H5'" H N N 186 U "H5''" H N N 187 U "H4'" H N N 188 U "H3'" H N N 189 U "HO3'" H N N 190 U "H2'" H N N 191 U "HO2'" H N N 192 U "H1'" H N N 193 U H3 H N N 194 U H5 H N N 195 U H6 H N N 196 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 P12 C5 C4 doub Y N 116 P12 C5 C6 sing Y N 117 P12 C5 H5 sing N N 118 P12 C4 C3 sing Y N 119 P12 C4 OA1 sing N N 120 P12 C3 C2 doub Y N 121 P12 C3 H3 sing N N 122 P12 C2 C1 sing Y N 123 P12 C2 CA sing N N 124 P12 C1 C6 doub Y N 125 P12 C1 OA sing N N 126 P12 C6 H6 sing N N 127 P12 OA CB sing N N 128 P12 CB CG sing N N 129 P12 CB HB1 sing N N 130 P12 CB HB2 sing N N 131 P12 CG CD sing N N 132 P12 CG HG1 sing N N 133 P12 CG HG2 sing N N 134 P12 CD NE sing N N 135 P12 CD HD1 sing N N 136 P12 CD HD2 sing N N 137 P12 NE HE1 sing N N 138 P12 NE HE2 sing N N 139 P12 NE HE3 sing N N 140 P12 CG1 CD1 sing N N 141 P12 CG1 NB sing N N 142 P12 CG1 HG11 sing N N 143 P12 CG1 HG12 sing N N 144 P12 CD1 NE1 sing N N 145 P12 CD1 HD11 sing N N 146 P12 CD1 HD12 sing N N 147 P12 NE1 CD2 sing N N 148 P12 NE1 CZ sing N N 149 P12 CD2 CG2 sing N N 150 P12 CD2 HD21 sing N N 151 P12 CD2 HD22 sing N N 152 P12 CG2 NB sing N N 153 P12 CG2 HG21 sing N N 154 P12 CG2 HG22 sing N N 155 P12 NB CA sing N N 156 P12 NB HB sing N N 157 P12 CA HA1 sing N N 158 P12 CA HA2 sing N N 159 P12 CZ NH1 doub N E 160 P12 CZ NH2 sing N N 161 P12 NH1 HH11 sing N N 162 P12 NH2 HH21 sing N N 163 P12 NH2 HH22 sing N N 164 P12 OA1 CB1 sing N N 165 P12 CB1 HB11 sing N N 166 P12 CB1 HB12 sing N N 167 P12 CB1 HB3 sing N N 168 U OP3 P sing N N 169 U OP3 HOP3 sing N N 170 U P OP1 doub N N 171 U P OP2 sing N N 172 U P "O5'" sing N N 173 U OP2 HOP2 sing N N 174 U "O5'" "C5'" sing N N 175 U "C5'" "C4'" sing N N 176 U "C5'" "H5'" sing N N 177 U "C5'" "H5''" sing N N 178 U "C4'" "O4'" sing N N 179 U "C4'" "C3'" sing N N 180 U "C4'" "H4'" sing N N 181 U "O4'" "C1'" sing N N 182 U "C3'" "O3'" sing N N 183 U "C3'" "C2'" sing N N 184 U "C3'" "H3'" sing N N 185 U "O3'" "HO3'" sing N N 186 U "C2'" "O2'" sing N N 187 U "C2'" "C1'" sing N N 188 U "C2'" "H2'" sing N N 189 U "O2'" "HO2'" sing N N 190 U "C1'" N1 sing N N 191 U "C1'" "H1'" sing N N 192 U N1 C2 sing N N 193 U N1 C6 sing N N 194 U C2 O2 doub N N 195 U C2 N3 sing N N 196 U N3 C4 sing N N 197 U N3 H3 sing N N 198 U C4 O4 doub N N 199 U C4 C5 sing N N 200 U C5 C6 doub N N 201 U C5 H5 sing N N 202 U C6 H6 sing N N 203 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1UUI 'double helix' 1UUI 'a-form double helix' 1UUI 'hairpin loop' 1UUI 'bulge loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 29 1_555 -2.031 -0.555 0.067 -1.312 -2.607 -2.122 1 B_G17:C45_B B 17 ? B 45 ? 19 1 1 A G 2 1_555 A C 28 1_555 -0.965 -0.437 0.033 -2.811 -0.157 -6.356 2 B_G18:C44_B B 18 ? B 44 ? 19 1 1 A C 3 1_555 A G 27 1_555 -0.351 -0.147 -0.080 0.494 -1.599 -3.108 3 B_C19:G43_B B 19 ? B 43 ? 19 1 1 A A 4 1_555 A U 26 1_555 -0.852 -0.325 0.453 -2.200 -3.257 0.897 4 B_A20:U42_B B 20 ? B 42 ? 20 1 1 A G 5 1_555 A C 25 1_555 0.335 -0.059 -0.267 -3.412 -0.508 -4.577 5 B_G21:C41_B B 21 ? B 41 ? 19 1 1 A A 6 1_555 A U 24 1_555 -0.132 0.225 -0.224 -9.354 0.566 -17.480 6 B_A22:U40_B B 22 ? B 40 ? 20 1 1 A G 10 1_555 A C 23 1_555 -0.221 -0.160 0.111 4.047 2.869 -3.445 7 B_G26:C39_B B 26 ? B 39 ? 19 1 1 A A 11 1_555 A U 22 1_555 -0.750 -0.284 -0.693 2.894 7.123 -14.567 8 B_A27:U38_B B 27 ? B 38 ? 20 1 1 A G 12 1_555 A C 21 1_555 -1.118 -0.332 -0.623 0.211 4.352 -3.555 9 B_G28:C37_B B 28 ? B 37 ? 19 1 1 A C 13 1_555 A G 20 1_555 1.031 -0.191 0.220 -6.088 0.765 -0.430 10 B_C29:G36_B B 29 ? B 36 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 29 1_555 A G 2 1_555 A C 28 1_555 -1.089 -1.176 3.588 -4.041 4.982 40.358 -2.284 1.076 3.513 7.166 5.812 40.844 1 BB_G17G18:C44C45_BB B 17 ? B 45 ? B 18 ? B 44 ? 1 A G 2 1_555 A C 28 1_555 A C 3 1_555 A G 27 1_555 -0.122 -1.445 3.399 -0.454 10.883 33.552 -3.963 0.136 2.810 18.263 0.761 35.227 2 BB_G18C19:G43C44_BB B 18 ? B 44 ? B 19 ? B 43 ? 1 A C 3 1_555 A G 27 1_555 A A 4 1_555 A U 26 1_555 0.666 -1.687 3.264 -5.808 14.586 28.598 -5.209 -2.064 2.020 27.101 10.791 32.545 3 BB_C19A20:U42G43_BB B 19 ? B 43 ? B 20 ? B 42 ? 1 A A 4 1_555 A U 26 1_555 A G 5 1_555 A C 25 1_555 0.574 -1.261 3.274 5.193 8.451 38.339 -2.829 -0.255 2.991 12.612 -7.750 39.555 4 BB_A20G21:C41U42_BB B 20 ? B 42 ? B 21 ? B 41 ? 1 A G 5 1_555 A C 25 1_555 A A 6 1_555 A U 24 1_555 -0.062 -3.077 3.183 -0.436 7.332 22.265 -9.628 0.031 2.077 18.357 1.093 23.430 5 BB_G21A22:U40C41_BB B 21 ? B 41 ? B 22 ? B 40 ? 1 A A 6 1_555 A U 24 1_555 A G 10 1_555 A C 23 1_555 -2.326 -1.315 3.168 -0.604 -1.197 51.187 -1.441 2.651 3.221 -1.385 0.699 51.203 6 BB_A22G26:C39U40_BB B 22 ? B 40 ? B 26 ? B 39 ? 1 A G 10 1_555 A C 23 1_555 A A 11 1_555 A U 22 1_555 -0.726 -1.947 3.679 3.028 -6.149 29.392 -2.270 2.119 3.904 -11.915 -5.867 30.163 7 BB_G26A27:U38C39_BB B 26 ? B 39 ? B 27 ? B 38 ? 1 A A 11 1_555 A U 22 1_555 A G 12 1_555 A C 21 1_555 0.028 -2.249 3.768 -2.352 -13.094 23.697 -0.396 -0.850 4.366 -29.129 5.232 27.129 8 BB_A27G28:C37U38_BB B 27 ? B 38 ? B 28 ? B 37 ? 1 A G 12 1_555 A C 21 1_555 A C 13 1_555 A G 20 1_555 -0.003 -1.246 3.960 -3.416 9.192 44.124 -2.590 -0.356 3.634 12.059 4.482 45.147 9 BB_G28C29:G36C37_BB B 28 ? B 37 ? B 29 ? B 36 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 DRX Bruker 800 2 DRX Bruker 600 3 DMX Bruker 600 4 AMX Bruker 500 # _atom_sites.entry_id 1UUI _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_