data_1FYO # _entry.id 1FYO # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1FYO pdb_00001fyo 10.2210/pdb1fyo/pdb RCSB RCSB012021 ? ? WWPDB D_1000012021 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1FYP 'the eukaryotic decoding region A-site RNA bound to paromomycin' unspecified PDB 1A3M 'the prokaryotic decoding region A site RNA' unspecified PDB 1PBR 'the prokaryotic decoding region A site RNA bound to paromomycin' unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1FYO _pdbx_database_status.recvd_initial_deposition_date 2000-10-02 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lynch, S.R.' 1 'Puglisi, J.D.' 2 # _citation.id primary _citation.title 'Structure of a eukaryotic decoding region A-site RNA.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 306 _citation.page_first 1023 _citation.page_last 1035 _citation.year 2001 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11237616 _citation.pdbx_database_id_DOI 10.1006/jmbi.2000.4419 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lynch, S.R.' 1 ? primary 'Puglisi, J.D.' 2 ? # _cell.entry_id 1FYO _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1FYO _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'FRAGMENT OF 18S RIBOSOMAL RNA' _entity.formula_weight 8672.185 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation 'U1410A, A1490U' _entity.pdbx_fragment '18S RNA - NUCLEOTIDES 1404-1412, 1488-1497 (E. COLI NUMBERS)' _entity.details 'EUKARYOTIC DECODING REGION A-SITE RNA' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCGUCGCACCUUCGGGUGAAGUCGCC _entity_poly.pdbx_seq_one_letter_code_can GGCGUCGCACCUUCGGGUGAAGUCGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 C n 1 7 G n 1 8 C n 1 9 A n 1 10 C n 1 11 C n 1 12 U n 1 13 U n 1 14 C n 1 15 G n 1 16 G n 1 17 G n 1 18 U n 1 19 G n 1 20 A n 1 21 A n 1 22 G n 1 23 U n 1 24 C n 1 25 G n 1 26 C n 1 27 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'This sequence occurs naturally in Tetrahymena thermophila' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1FYO _struct_ref.pdbx_db_accession 1FYO _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1FYO _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1FYO _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 1 1 3D_13C-separated_NOESY 3 1 1 3D_15N-separated_NOESY 4 1 1 4D_13C-separated_NOESY 5 1 1 DQF-COSY # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.3 _pdbx_nmr_exptl_sample_conditions.ionic_strength '10 mM' _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '3 mM decoding site RNA, 13C/15N, 10 mM phosphate pH 6.3, 90% H20/10% D20, 100% D20' _pdbx_nmr_sample_details.solvent_system '90% H2O/10% D20; 100% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Varian INOVA 500 2 ? Varian INOVA 800 # _pdbx_nmr_refine.entry_id 1FYO _pdbx_nmr_refine.method 'simulated annealing molecular dynamics' _pdbx_nmr_refine.details '682 NOEs, 129 dihedral constraints, 36 Hydrogen bonds' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 1FYO _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 25 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations,structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1FYO _pdbx_nmr_representative.conformer_id 12 _pdbx_nmr_representative.selection_criteria ? # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal X-PLOR 3.83 refinement Brunger 1 X-PLOR 3.83 'structure solution' Brunger 2 VNMR 6.1 processing ? 3 Felix 6.1 processing ? 4 # _exptl.entry_id 1FYO _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 1FYO _struct.title 'EUKARYOTIC DECODING REGION A-SITE RNA' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1FYO _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'stem-internal loop-stem-tetraloop RNA, G-A base pair, bulged A, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 4 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 4 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 4 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A U 23 O4 ? ? A U 5 A U 23 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog14 hydrog ? ? A U 5 O2 ? ? ? 1_555 A U 23 N3 ? ? A U 5 A U 23 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog15 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 6 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 6 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 6 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 8 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 8 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 8 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A A 20 N6 ? ? A C 8 A A 20 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog22 hydrog ? ? A A 9 N6 ? ? ? 1_555 A G 17 O6 ? ? A A 9 A G 17 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog23 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 18 N3 ? ? A A 9 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 18 O4 ? ? A A 9 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 10 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 10 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 10 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 12 O2 ? ? ? 1_555 A G 15 N1 ? ? A U 12 A G 15 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1FYO _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1FYO _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 G 7 7 7 G G A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 U 12 12 12 U U A . n A 1 13 U 13 13 13 U U A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 G 25 25 25 G G A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2001-03-14 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 2 1 "HO2'" A U 12 ? ? O6 A G 15 ? ? 1.58 3 1 O6 A G 2 ? ? H41 A C 26 ? ? 1.59 4 1 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 5 1 H41 A C 3 ? ? O6 A G 25 ? ? 1.60 6 2 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.42 7 2 "HO2'" A U 12 ? ? O6 A G 15 ? ? 1.58 8 2 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 9 2 H41 A C 6 ? ? O6 A G 22 ? ? 1.60 10 2 H41 A C 3 ? ? O6 A G 25 ? ? 1.60 11 2 O6 A G 2 ? ? H41 A C 26 ? ? 1.60 12 3 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.46 13 3 "HO2'" A U 5 ? ? "O4'" A C 6 ? ? 1.57 14 3 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 15 4 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.43 16 4 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.57 17 4 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 18 4 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 19 4 H41 A C 11 ? ? O6 A G 16 ? ? 1.60 20 4 H41 A C 3 ? ? O6 A G 25 ? ? 1.60 21 5 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 22 5 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 23 5 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 24 6 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 25 6 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.45 26 6 H41 A C 3 ? ? O6 A G 25 ? ? 1.58 27 7 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 28 7 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 29 7 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 30 7 "O2'" A A 21 ? ? H8 A G 22 ? ? 1.60 31 8 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.47 32 8 "HO2'" A U 5 ? ? "O4'" A C 6 ? ? 1.57 33 8 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.58 34 8 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 35 9 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 36 9 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.47 37 9 O6 A G 2 ? ? H41 A C 26 ? ? 1.60 38 10 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.42 39 10 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.59 40 10 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 41 10 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 42 10 H41 A C 3 ? ? O6 A G 25 ? ? 1.60 43 11 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.42 44 11 H41 A C 6 ? ? O6 A G 22 ? ? 1.58 45 11 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.58 46 11 "HO2'" A U 12 ? ? O6 A G 15 ? ? 1.59 47 12 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 48 12 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 49 12 H41 A C 11 ? ? O6 A G 16 ? ? 1.60 50 12 H41 A C 3 ? ? O6 A G 25 ? ? 1.60 51 12 H41 A C 6 ? ? O6 A G 22 ? ? 1.60 52 12 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.60 53 13 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 54 13 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 55 13 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.59 56 13 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 57 13 H41 A C 11 ? ? O6 A G 16 ? ? 1.59 58 14 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 59 14 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 60 15 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 61 15 H41 A C 6 ? ? O6 A G 22 ? ? 1.58 62 15 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 63 15 H41 A C 11 ? ? O6 A G 16 ? ? 1.60 64 16 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 65 16 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.58 66 16 O6 A G 2 ? ? H41 A C 26 ? ? 1.59 67 17 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 68 17 H41 A C 6 ? ? O6 A G 22 ? ? 1.58 69 17 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.58 70 17 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 71 17 O6 A G 2 ? ? H41 A C 26 ? ? 1.60 72 18 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 73 18 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.54 74 18 H41 A C 6 ? ? O6 A G 22 ? ? 1.58 75 18 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 76 19 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.41 77 19 H41 A C 11 ? ? O6 A G 16 ? ? 1.59 78 19 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.59 79 19 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 80 20 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.45 81 21 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.43 82 21 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 83 21 H41 A C 3 ? ? O6 A G 25 ? ? 1.59 84 21 O6 A G 2 ? ? H41 A C 26 ? ? 1.60 85 22 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.44 86 22 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.51 87 22 O6 A G 1 ? ? H41 A C 27 ? ? 1.59 88 22 H41 A C 6 ? ? O6 A G 22 ? ? 1.59 89 23 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.42 90 23 H41 A C 3 ? ? O6 A G 25 ? ? 1.58 91 23 O6 A G 1 ? ? H41 A C 27 ? ? 1.60 92 24 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.42 93 24 "O2'" A A 21 ? ? H8 A G 22 ? ? 1.47 94 24 H41 A C 6 ? ? O6 A G 22 ? ? 1.56 95 25 "O2'" A A 20 ? ? "H5''" A A 21 ? ? 1.42 96 25 "O2'" A A 20 ? ? H8 A A 21 ? ? 1.57 97 25 "HO2'" A U 12 ? ? O6 A G 15 ? ? 1.57 98 25 H41 A C 6 ? ? O6 A G 22 ? ? 1.58 99 25 "HO2'" A G 2 ? ? "O4'" A C 3 ? ? 1.60 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1FYO 'double helix' 1FYO 'a-form double helix' 1FYO tetraloop 1FYO 'mismatched base pair' 1FYO 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 27 1_555 -0.346 -0.585 0.931 4.468 -9.505 -10.190 1 A_G1:C27_A A 1 ? A 27 ? 19 1 1 A G 2 1_555 A C 26 1_555 -0.480 -0.395 -0.105 -7.136 5.946 -5.306 2 A_G2:C26_A A 2 ? A 26 ? 19 1 1 A C 3 1_555 A G 25 1_555 0.478 -0.382 -0.328 13.771 -14.868 -3.873 3 A_C3:G25_A A 3 ? A 25 ? 19 1 1 A G 4 1_555 A C 24 1_555 -0.456 -0.449 0.363 3.171 -21.376 -4.379 4 A_G4:C24_A A 4 ? A 24 ? 19 1 1 A U 5 1_555 A U 23 1_555 2.921 -1.905 0.469 1.432 -14.194 3.734 5 A_U5:U23_A A 5 ? A 23 ? 16 1 1 A C 6 1_555 A G 22 1_555 0.447 -0.606 -0.700 -12.313 -6.295 -0.269 6 A_C6:G22_A A 6 ? A 22 ? 19 1 1 A C 8 1_555 A G 19 1_555 0.244 -0.768 1.329 -9.376 -14.682 -14.271 7 A_C8:G19_A A 8 ? A 19 ? 19 1 1 A A 9 1_555 A U 18 1_555 0.215 -0.376 1.284 9.176 -11.114 -10.898 8 A_A9:U18_A A 9 ? A 18 ? 20 1 1 A C 10 1_555 A G 17 1_555 0.328 -0.418 0.683 14.480 -9.947 -5.277 9 A_C10:G17_A A 10 ? A 17 ? 19 1 1 A C 11 1_555 A G 16 1_555 0.595 -0.361 -0.718 26.173 -19.205 -1.800 10 A_C11:G16_A A 11 ? A 16 ? 19 1 1 A U 12 1_555 A G 15 1_555 2.259 -4.255 0.119 -13.698 -34.618 -78.916 11 A_U12:G15_A A 12 ? A 15 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 27 1_555 A G 2 1_555 A C 26 1_555 3.634 -1.123 -0.501 -3.528 163.230 98.569 -0.257 -1.818 -1.160 83.620 1.807 169.108 1 AA_G1G2:C26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A G 2 1_555 A C 26 1_555 A C 3 1_555 A G 25 1_555 0.344 -0.838 2.809 2.781 3.847 35.626 -1.826 -0.221 2.725 6.253 -4.520 35.931 2 AA_G2C3:G25C26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A C 3 1_555 A G 25 1_555 A G 4 1_555 A C 24 1_555 0.552 -1.540 3.235 -3.804 12.140 31.209 -4.438 -1.511 2.405 21.482 6.731 33.642 3 AA_C3G4:C24G25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A G 4 1_555 A C 24 1_555 A U 5 1_555 A U 23 1_555 0.357 -1.062 3.242 -2.553 -5.152 51.399 -0.868 -0.582 3.307 -5.918 2.933 51.698 4 AA_G4U5:U23C24_AA A 4 ? A 24 ? A 5 ? A 23 ? 1 A U 5 1_555 A U 23 1_555 A C 6 1_555 A G 22 1_555 -0.087 -1.866 3.325 15.613 1.631 33.372 -3.180 2.271 2.910 2.664 -25.509 36.784 5 AA_U5C6:G22U23_AA A 5 ? A 23 ? A 6 ? A 22 ? 1 A C 8 1_555 A G 19 1_555 A A 9 1_555 A U 18 1_555 -0.282 -1.611 2.348 -0.368 -9.451 32.558 -1.566 0.438 2.700 -16.431 0.639 33.868 6 AA_C8A9:U18G19_AA A 8 ? A 19 ? A 9 ? A 18 ? 1 A A 9 1_555 A U 18 1_555 A C 10 1_555 A G 17 1_555 0.361 -1.511 3.238 2.325 -9.783 35.226 -0.985 -0.237 3.534 -15.773 -3.748 36.589 7 AA_A9C10:G17U18_AA A 9 ? A 18 ? A 10 ? A 17 ? 1 A C 10 1_555 A G 17 1_555 A C 11 1_555 A G 16 1_555 0.282 -1.190 2.927 7.776 -6.380 31.129 -1.074 0.767 3.084 -11.518 -14.038 32.676 8 AA_C10C11:G16G17_AA A 10 ? A 17 ? A 11 ? A 16 ? 1 A C 11 1_555 A G 16 1_555 A U 12 1_555 A G 15 1_555 -0.200 -1.409 3.504 10.778 15.426 93.716 -1.241 0.336 3.271 10.489 -7.328 95.152 9 AA_C11U12:G15G16_AA A 11 ? A 16 ? A 12 ? A 15 ? #