data_2HEM # _entry.id 2HEM # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2HEM pdb_00002hem 10.2210/pdb2hem/pdb RCSB RCSB038259 ? ? WWPDB D_1000038259 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2006-09-12 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2020-06-24 5 'Structure model' 1 4 2024-05-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' 'Source and taxonomy' 6 5 'Structure model' 'Data collection' 7 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' ndb_struct_na_base_pair 2 4 'Structure model' pdbx_entity_src_syn 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_ref 6 4 'Structure model' struct_ref_seq 7 5 'Structure model' chem_comp_atom 8 5 'Structure model' chem_comp_bond 9 5 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_ndb_struct_na_base_pair.hbond_type_12' 2 4 'Structure model' '_pdbx_entity_src_syn.ncbi_taxonomy_id' 3 4 'Structure model' '_pdbx_entity_src_syn.organism_scientific' 4 4 'Structure model' '_pdbx_entity_src_syn.pdbx_beg_seq_num' 5 4 'Structure model' '_pdbx_entity_src_syn.pdbx_end_seq_num' 6 5 'Structure model' '_database_2.pdbx_DOI' 7 5 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.entry_id 2HEM _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2006-06-21 _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1LR2 _pdbx_database_related.details 'Crystal structure of thaumatin at high hydrostatic pressure' _pdbx_database_related.content_type unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Zhao, Q.' 1 'Nagaswamy, U.' 2 'Lee, H.' 3 'Xia, Y.' 4 'Gao, X.' 5 'Fox, G.' 6 # _citation.id primary _citation.title 'NMR structure and Mg2+ binding of an RNA segment that underlies the L7/L12 stalk in the E.coli 50S ribosomal subunit' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 33 _citation.page_first 3145 _citation.page_last 3153 _citation.year 2005 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 15939932 _citation.pdbx_database_id_DOI 10.1093/nar/gki621 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Zhao, Q.' 1 ? primary 'Nagaswamy, U.' 2 ? primary 'Lee, H.' 3 ? primary 'Xia, Y.' 4 ? primary 'Huan, H.-C.' 5 ? primary 'Gao, X.' 6 ? primary 'Fox, G.E.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-R(P*GP*GP*GP*AP*AP*GP*GP*CP*GP*CP*UP*UP*CP*GP*GP*CP*GP*UP*CP*GP*GP*CP*CP*C)-3'" _entity.formula_weight 7770.670 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAAGGCGCUUCGGCGUCGGCCC _entity_poly.pdbx_seq_one_letter_code_can GGGAAGGCGCUUCGGCGUCGGCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 A n 1 6 G n 1 7 G n 1 8 C n 1 9 G n 1 10 C n 1 11 U n 1 12 U n 1 13 C n 1 14 G n 1 15 G n 1 16 C n 1 17 G n 1 18 U n 1 19 C n 1 20 G n 1 21 G n 1 22 C n 1 23 C n 1 24 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 24 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details 'This sequence occurs naturally in E. coli' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 A 5 5 5 A A A . n A 1 6 G 6 6 6 G G A . n A 1 7 G 7 7 7 G G A . n A 1 8 C 8 8 8 C C A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 U 12 12 12 U U A . n A 1 13 C 13 13 13 C C A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 G 20 20 20 G G A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n # _cell.entry_id 2HEM _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2HEM _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 2HEM _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 2HEM _struct.title 'NMR structure and Mg2+ binding of an RNA segment that underlies the L7/L12 stalk in the E.coli 50S ribosomal subunit.' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2HEM _struct_keywords.pdbx_keywords RNA _struct_keywords.text '23S rRNA, backbone dynamics, cis Watson-Crick G A pair, G A mismatch, helix 42, L7/L12 stalk, Mg2+ binding, tandem (G A)2, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2HEM _struct_ref.pdbx_db_accession 2HEM _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2HEM _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 24 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2HEM _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 24 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 24 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 3 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 3 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 3 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A G 21 N1 ? ? A A 4 A G 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A G 21 O6 ? ? A A 4 A G 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A G 20 N1 ? ? A A 5 A G 20 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A G 20 O6 ? ? A A 5 A G 20 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog14 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 6 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 6 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 6 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 7 N1 ? ? ? 1_555 A U 18 O2 ? ? A G 7 A U 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog18 hydrog ? ? A G 7 O6 ? ? ? 1_555 A U 18 N3 ? ? A G 7 A U 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 8 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 8 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 8 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 16 N3 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 16 O2 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 15 N1 ? ? A C 10 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 15 O6 ? ? A C 10 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 15 N2 ? ? A C 10 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 11 O2 ? ? ? 1_555 A G 14 N1 ? ? A U 11 A G 14 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A A 4 ? ? "O5'" A A 5 ? ? 1.41 2 1 O2 A U 11 ? ? H1 A G 14 ? ? 1.49 3 1 H1 A G 7 ? ? O2 A U 18 ? ? 1.56 4 1 "HO2'" A G 3 ? ? "O5'" A A 4 ? ? 1.60 5 2 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 6 2 "HO2'" A G 3 ? ? "O5'" A A 4 ? ? 1.56 7 3 "O2'" A A 5 ? ? H8 A G 6 ? ? 1.54 8 3 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 9 3 "HO2'" A G 3 ? ? "O5'" A A 4 ? ? 1.60 10 4 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 11 5 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 12 6 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 13 7 O2 A U 11 ? ? H1 A G 14 ? ? 1.50 14 7 H1 A G 7 ? ? O2 A U 18 ? ? 1.57 15 8 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 16 9 O2 A U 11 ? ? H1 A G 14 ? ? 1.54 # _pdbx_nmr_ensemble.entry_id 2HEM _pdbx_nmr_ensemble.conformers_calculated_total_number ? _pdbx_nmr_ensemble.conformers_submitted_total_number 9 _pdbx_nmr_ensemble.conformer_selection_criteria 'Lowest energy, fewest VDW violations' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 2HEM _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 'RNA, H2O/D2O' H2O/D2O 2 'RNA, D2O' D2O # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 298 1 6.5 0.1 atm K 2 276 1 6.5 0.1 atm K 3 285 1 6.5 0.1 atm K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 2 1 NOESY 2 1 1 TOCSY 3 1 1 P-HSQC 4 1 1 15N-HSQC 5 1 2 '2D NOESY' 6 1 3 '15N-1H HSQC' 7 1 3 '13C-1H HSQC' 8 1 3 HNN-COSY # _pdbx_nmr_refine.entry_id 2HEM _pdbx_nmr_refine.method 'distance geometry simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal CNS ? refinement 'Brunger, et. al' 1 CNS ? 'structure solution' 'Brunger, et. al' 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2HEM 'double helix' 2HEM 'a-form double helix' 2HEM tetraloop 2HEM 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 24 1_555 -1.211 -0.315 -0.002 -0.435 0.065 5.415 1 A_G1:C24_A A 1 ? A 24 ? 19 1 1 A G 2 1_555 A C 23 1_555 -0.877 -0.128 0.020 0.508 -0.813 4.676 2 A_G2:C23_A A 2 ? A 23 ? 19 1 1 A G 3 1_555 A C 22 1_555 -1.416 -0.382 0.005 0.335 -0.459 -0.831 3 A_G3:C22_A A 3 ? A 22 ? 19 1 1 A A 4 1_555 A G 21 1_555 -0.009 1.386 0.017 -0.940 -0.613 -15.087 4 A_A4:G21_A A 4 ? A 21 ? 8 1 1 A A 5 1_555 A G 20 1_555 0.189 1.413 -0.065 1.938 -1.031 -14.366 5 A_A5:G20_A A 5 ? A 20 ? 8 1 1 A G 6 1_555 A C 19 1_555 0.162 -0.215 0.038 -0.220 -1.862 -1.565 6 A_G6:C19_A A 6 ? A 19 ? 19 1 1 A G 7 1_555 A U 18 1_555 -2.649 -0.285 0.001 -0.488 -0.609 15.091 7 A_G7:U18_A A 7 ? A 18 ? 28 1 1 A C 8 1_555 A G 17 1_555 0.885 -0.486 0.016 0.373 -1.530 -1.073 8 A_C8:G17_A A 8 ? A 17 ? 19 1 1 A G 9 1_555 A C 16 1_555 -0.893 -0.438 -0.044 1.920 -0.456 0.921 9 A_G9:C16_A A 9 ? A 16 ? 19 1 1 A C 10 1_555 A G 15 1_555 1.002 -0.490 -0.066 0.307 1.270 -8.860 10 A_C10:G15_A A 10 ? A 15 ? 19 1 1 A U 11 1_555 A G 14 1_555 1.113 -4.208 -0.099 -7.214 -3.834 -96.388 11 A_U11:G14_A A 11 ? A 14 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 24 1_555 A G 2 1_555 A C 23 1_555 -0.415 0.363 4.104 -1.348 12.045 26.919 -2.589 0.445 3.920 24.366 2.728 29.476 1 AA_G1G2:C23C24_AA A 1 ? A 24 ? A 2 ? A 23 ? 1 A G 2 1_555 A C 23 1_555 A G 3 1_555 A C 22 1_555 0.088 -0.080 3.683 -6.139 31.130 26.630 -3.949 -0.881 2.339 50.016 9.863 41.202 2 AA_G2G3:C22C23_AA A 2 ? A 23 ? A 3 ? A 22 ? 1 A G 3 1_555 A C 22 1_555 A A 4 1_555 A G 21 1_555 -0.833 -0.135 3.819 -1.736 27.755 35.980 -3.106 0.900 3.021 38.639 2.416 45.191 3 AA_G3A4:G21C22_AA A 3 ? A 22 ? A 4 ? A 21 ? 1 A A 4 1_555 A G 21 1_555 A A 5 1_555 A G 20 1_555 -0.342 -0.089 3.669 -0.337 28.582 27.141 -4.003 0.464 2.505 47.349 0.559 39.221 4 AA_A4A5:G20G21_AA A 4 ? A 21 ? A 5 ? A 20 ? 1 A A 5 1_555 A G 20 1_555 A G 6 1_555 A C 19 1_555 -0.114 -0.683 3.320 -9.766 6.696 34.731 -2.009 -1.164 3.061 10.834 15.802 36.635 5 AA_A5G6:C19G20_AA A 5 ? A 20 ? A 6 ? A 19 ? 1 A G 6 1_555 A C 19 1_555 A G 7 1_555 A U 18 1_555 1.924 -1.357 3.734 -0.810 -1.172 19.843 -3.296 -6.006 3.727 -3.396 2.345 19.894 6 AA_G6G7:U18C19_AA A 6 ? A 19 ? A 7 ? A 18 ? 1 A G 7 1_555 A U 18 1_555 A C 8 1_555 A G 17 1_555 -2.164 -0.072 3.235 -0.798 21.521 45.448 -1.642 2.500 2.958 26.194 0.971 50.047 7 AA_G7C8:G17U18_AA A 7 ? A 18 ? A 8 ? A 17 ? 1 A C 8 1_555 A G 17 1_555 A G 9 1_555 A C 16 1_555 -0.037 -0.368 5.248 0.887 -22.999 28.740 4.660 0.260 4.366 -39.335 -1.517 36.668 8 AA_C8G9:C16G17_AA A 8 ? A 17 ? A 9 ? A 16 ? 1 A G 9 1_555 A C 16 1_555 A C 10 1_555 A G 15 1_555 -0.828 0.162 3.794 -2.338 34.045 32.735 -3.234 0.803 2.838 47.333 3.250 46.948 9 AA_G9C10:G15C16_AA A 9 ? A 16 ? A 10 ? A 15 ? 1 A C 10 1_555 A G 15 1_555 A U 11 1_555 A G 14 1_555 0.996 -0.702 3.211 16.911 15.060 86.916 -0.811 -0.360 3.200 10.794 -12.121 89.245 10 AA_C10U11:G14G15_AA A 10 ? A 15 ? A 11 ? A 14 ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model ? _pdbx_nmr_spectrometer.field_strength 600 # _atom_sites.entry_id 2HEM _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_