data_2KPV # _entry.id 2KPV # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2KPV pdb_00002kpv 10.2210/pdb2kpv/pdb RCSB RCSB101424 ? ? WWPDB D_1000101424 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2010-08-04 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2011-09-07 4 'Structure model' 1 3 2024-05-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_nmr_software # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2KPV _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2009-10-20 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Cevec, M.' 1 'Thibaudeau, C.' 2 'Plavec, J.' 3 # _citation.id primary _citation.title 'NMR structure of the let-7 miRNA interacting with the site LCS1 of lin-41 mRNA from Caenorhabditis elegans.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 38 _citation.page_first 7814 _citation.page_last 7821 _citation.year 2010 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 20660479 _citation.pdbx_database_id_DOI 10.1093/nar/gkq640 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Cevec, M.' 1 ? primary 'Thibaudeau, C.' 2 ? primary 'Plavec, J.' 3 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (34-MER)' _entity.formula_weight 10954.567 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAGGUAGUAGGUCGAAAGACCGUUCUACACUCC _entity_poly.pdbx_seq_one_letter_code_can GGAGGUAGUAGGUCGAAAGACCGUUCUACACUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 G n 1 6 U n 1 7 A n 1 8 G n 1 9 U n 1 10 A n 1 11 G n 1 12 G n 1 13 U n 1 14 C n 1 15 G n 1 16 A n 1 17 A n 1 18 A n 1 19 G n 1 20 A n 1 21 C n 1 22 C n 1 23 G n 1 24 U n 1 25 U n 1 26 C n 1 27 U n 1 28 A n 1 29 C n 1 30 A n 1 31 C n 1 32 U n 1 33 C n 1 34 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'RNA was prepared by in vitro transcription using T7 RNA polymerase and DNA oligonucleotide template' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 G 4 4 4 G G A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 G 8 8 8 G G A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 G 11 11 11 G G A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 G 23 23 23 G G A . n A 1 24 U 24 24 24 U U A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 U 27 27 27 U U A . n A 1 28 A 28 28 28 A A A . n A 1 29 C 29 29 29 C C A . n A 1 30 A 30 30 30 A A A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 C 33 33 33 C C A . n A 1 34 C 34 34 34 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2KPV _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2KPV _struct.title ;NMR model of the first let-7 miRNA complementary site (LCS1) in 3'-UTR of lin-41 mRNA from C. elegans ; _struct.pdbx_model_details 'closest to the average, model 1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2KPV _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'stem-loop, adenine bulge, asymmetric internal loop, residual dipolar couplings, GAAA tetraloop, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_code 2KPV _struct_ref.db_name PDB _struct_ref.entity_id 1 _struct_ref.pdbx_db_accession 2KPV _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_seq_one_letter_code GGAGGUAGUAGGUCGAAAGACCGUUCUACACUCC _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2KPV _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 34 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2KPV _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 34 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 34 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 1 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 1 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 1 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 2 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 2 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 2 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 3 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 3 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 4 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 4 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 4 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 5 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 5 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 5 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 28 N1 ? ? A U 6 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 6 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 27 N3 ? ? A A 7 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 27 O4 ? ? A A 7 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 8 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 8 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 8 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 24 N3 ? ? A A 10 A U 24 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog23 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 11 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 11 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 11 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 20 N1 ? ? A U 13 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 20 N6 ? ? A U 13 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 15 N2 ? ? ? 1_555 A A 18 N7 ? ? A G 15 A A 18 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 4 "HO2'" A A 28 ? ? "O4'" A C 29 ? ? 1.59 2 7 "HO2'" A U 24 ? ? OP1 A U 25 ? ? 1.58 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A A 30 ? ? "C1'" A A 30 ? ? N9 A A 30 ? ? 112.70 108.50 4.20 0.70 N 2 1 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.42 101.50 4.92 0.80 N 3 2 "C3'" A C 29 ? ? "C2'" A C 29 ? ? "C1'" A C 29 ? ? 106.42 101.50 4.92 0.80 N 4 2 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.36 101.50 4.86 0.80 N 5 3 "O4'" A A 30 ? ? "C1'" A A 30 ? ? N9 A A 30 ? ? 113.01 108.50 4.51 0.70 N 6 3 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.35 101.50 4.85 0.80 N 7 4 "C3'" A C 29 ? ? "C2'" A C 29 ? ? "C1'" A C 29 ? ? 106.36 101.50 4.86 0.80 N 8 4 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.36 101.50 4.86 0.80 N 9 5 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.35 101.50 4.85 0.80 N 10 6 "O4'" A A 30 ? ? "C1'" A A 30 ? ? N9 A A 30 ? ? 113.04 108.50 4.54 0.70 N 11 6 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.64 101.50 5.14 0.80 N 12 7 "O4'" A A 30 ? ? "C1'" A A 30 ? ? N9 A A 30 ? ? 112.74 108.50 4.24 0.70 N 13 7 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.37 101.50 4.87 0.80 N 14 8 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.33 101.50 4.83 0.80 N 15 9 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.31 101.50 4.81 0.80 N 16 10 "O4'" A A 30 ? ? "C1'" A A 30 ? ? N9 A A 30 ? ? 113.42 108.50 4.92 0.70 N 17 10 "C3'" A C 34 ? ? "C2'" A C 34 ? ? "C1'" A C 34 ? ? 106.56 101.50 5.06 0.80 N # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy and least restraint violations' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2KPV _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2KPV _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '2mM [U-100% 13C; U-100% 15N] RNA (34-MER)-1, 10mM sodium phosphate-2, 20mM sodium chloride-3, 95% H2O/5% D2O' 1 '95% H2O/5% D2O' '2mM [U-100% 13C; U-100% 15N] RNA (34-MER)-4, 10mM sodium phosphate-5, 20mM sodium chloride-6, 100% D2O' 2 '100% D2O' '1mM [U-100% 13C; U-100% 15N] RNA (34-MER)-7, 10mM sodium phosphate-8, 20mM sodium chloride-9, 17mg/mL Pf1 phage-10, 90% H2O/10% D2O' 3 '90% H2O/10% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'RNA (34-MER)-1' 2 ? mM '[U-100% 13C; U-100% 15N]' 1 'sodium phosphate-2' 10 ? mM ? 1 'sodium chloride-3' 20 ? mM ? 1 'RNA (34-MER)-4' 2 ? mM '[U-100% 13C; U-100% 15N]' 2 'sodium phosphate-5' 10 ? mM ? 2 'sodium chloride-6' 20 ? mM ? 2 'RNA (34-MER)-7' 1 ? mM '[U-100% 13C; U-100% 15N]' 3 'sodium phosphate-8' 10 ? mM ? 3 'sodium chloride-9' 20 ? mM ? 3 'Pf1 phage-10' 17 ? mg/mL ? 3 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 20 6.8 ambient ? 303 K 2 20 6.8 ambient ? 278 K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 2 '2D NOESY' 2 2 1 '2D 15N-HSQC' 1 3 2 '2D 13C-HSQC' 1 4 2 '2D DQF-COSY' 2 5 1 '2D HNN-COSY' 1 6 2 '2D TOCSY' 1 7 2 '2D 1H-31P COSY' 1 8 3 '2D 15N-IPAP-HSQC' 1 9 2 '3D HCCH-TOCSY' 1 10 2 '3D HCCH-COSY' 1 11 2 '3D 13C-separated-NOESY' # _pdbx_nmr_refine.entry_id 2KPV _pdbx_nmr_refine.method 'simulated annealing, energy minimization' _pdbx_nmr_refine.details ;810 NOE-derived distance restraints, 138 torsion angle restraints, 52 residual dipolar coupling restraints, 32 hydrogen bond restraints and 24 planarity restraints. ; _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, Kollm' refinement Amber 9 1 'Accelrys Software Inc.' 'data analysis' Felix 2002 2 'Accelrys Software Inc.' processing Felix 2002 3 Varian 'data collection' VnmrJ 2.1B 4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2KPV 'double helix' 2KPV 'a-form double helix' 2KPV tetraloop 2KPV 'bulge loop' 2KPV 'mismatched base pair' 2KPV 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 34 1_555 -0.635 -0.260 -0.465 -14.003 7.909 -3.772 1 A_G1:C34_A A 1 ? A 34 ? 19 1 1 A G 2 1_555 A C 33 1_555 -0.464 -0.016 -0.024 -9.203 -1.124 3.176 2 A_G2:C33_A A 2 ? A 33 ? 19 1 1 A A 3 1_555 A U 32 1_555 -0.649 -0.100 0.029 -5.682 -4.871 7.462 3 A_A3:U32_A A 3 ? A 32 ? 20 1 1 A G 4 1_555 A C 31 1_555 -0.357 -0.161 0.033 -0.887 -5.161 -2.741 4 A_G4:C31_A A 4 ? A 31 ? 19 1 1 A G 5 1_555 A C 29 1_555 0.028 -0.120 -0.770 -25.737 -23.760 0.712 5 A_G5:C29_A A 5 ? A 29 ? 19 1 1 A U 6 1_555 A A 28 1_555 0.082 -0.067 0.013 -11.897 -9.832 -0.614 6 A_U6:A28_A A 6 ? A 28 ? 20 1 1 A A 7 1_555 A U 27 1_555 0.116 -0.039 0.136 -2.855 -8.139 0.560 7 A_A7:U27_A A 7 ? A 27 ? 20 1 1 A G 8 1_555 A C 26 1_555 -0.037 -0.089 0.186 3.946 -19.650 2.222 8 A_G8:C26_A A 8 ? A 26 ? 19 1 1 A A 10 1_555 A U 24 1_555 -0.256 0.256 -1.261 -13.842 -4.523 26.296 9 A_A10:U24_A A 10 ? A 24 ? ? 1 1 A G 11 1_555 A C 22 1_555 -0.054 0.060 0.084 -11.937 1.919 2.944 10 A_G11:C22_A A 11 ? A 22 ? 19 1 1 A G 12 1_555 A C 21 1_555 0.195 -0.182 0.511 5.976 -5.447 -3.669 11 A_G12:C21_A A 12 ? A 21 ? 19 1 1 A U 13 1_555 A A 20 1_555 -0.093 0.008 0.089 -5.326 -12.755 4.576 12 A_U13:A20_A A 13 ? A 20 ? 20 1 1 A C 14 1_555 A G 19 1_555 0.514 -0.188 -0.069 8.299 4.800 -1.513 13 A_C14:G19_A A 14 ? A 19 ? 19 1 1 A G 15 1_555 A A 18 1_555 7.491 -5.321 -0.193 45.826 10.505 -48.004 14 A_G15:A18_A A 15 ? A 18 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 34 1_555 A G 2 1_555 A C 33 1_555 1.560 -1.393 3.294 0.059 6.941 31.071 -3.761 -2.835 2.926 12.759 -0.109 31.819 1 AA_G1G2:C33C34_AA A 1 ? A 34 ? A 2 ? A 33 ? 1 A G 2 1_555 A C 33 1_555 A A 3 1_555 A U 32 1_555 0.568 -2.271 3.125 -0.035 3.306 26.720 -5.652 -1.228 2.828 7.118 0.075 26.920 2 AA_G2A3:U32C33_AA A 2 ? A 33 ? A 3 ? A 32 ? 1 A A 3 1_555 A U 32 1_555 A G 4 1_555 A C 31 1_555 -0.474 -2.058 3.058 0.378 0.203 33.362 -3.616 0.884 3.040 0.353 -0.658 33.364 3 AA_A3G4:C31U32_AA A 3 ? A 32 ? A 4 ? A 31 ? 1 A G 4 1_555 A C 31 1_555 A G 5 1_555 A C 29 1_555 1.270 -0.966 3.997 4.902 22.400 51.701 -2.545 -1.015 3.442 24.369 -5.333 56.236 4 AA_G4G5:C29C31_AA A 4 ? A 31 ? A 5 ? A 29 ? 1 A G 5 1_555 A C 29 1_555 A U 6 1_555 A A 28 1_555 0.454 -0.869 2.867 -5.087 3.533 32.549 -2.032 -1.526 2.661 6.233 8.974 33.118 5 AA_G5U6:A28C29_AA A 5 ? A 29 ? A 6 ? A 28 ? 1 A U 6 1_555 A A 28 1_555 A A 7 1_555 A U 27 1_555 0.107 -1.170 3.014 -0.527 7.463 29.466 -3.548 -0.297 2.643 14.382 1.015 30.380 6 AA_U6A7:U27A28_AA A 6 ? A 28 ? A 7 ? A 27 ? 1 A A 7 1_555 A U 27 1_555 A G 8 1_555 A C 26 1_555 -0.597 -1.910 3.185 -3.860 7.094 24.124 -6.191 0.350 2.589 16.395 8.921 25.421 7 AA_A7G8:C26U27_AA A 7 ? A 27 ? A 8 ? A 26 ? 1 A A 10 1_555 A U 24 1_555 A G 11 1_555 A C 22 1_555 2.104 -0.964 3.180 -1.405 2.718 55.001 -1.196 -2.355 3.083 2.940 1.520 55.080 8 AA_A10G11:C22U24_AA A 10 ? A 24 ? A 11 ? A 22 ? 1 A G 11 1_555 A C 22 1_555 A G 12 1_555 A C 21 1_555 -0.176 -1.586 2.769 -3.856 6.111 29.023 -4.090 -0.300 2.395 11.961 7.547 29.890 9 AA_G11G12:C21C22_AA A 11 ? A 22 ? A 12 ? A 21 ? 1 A G 12 1_555 A C 21 1_555 A U 13 1_555 A A 20 1_555 -0.241 -2.079 3.460 1.211 5.563 34.378 -4.325 0.589 3.086 9.332 -2.032 34.832 10 AA_G12U13:A20C21_AA A 12 ? A 21 ? A 13 ? A 20 ? 1 A U 13 1_555 A A 20 1_555 A C 14 1_555 A G 19 1_555 -0.648 -1.767 2.952 -1.615 6.357 29.559 -4.481 0.963 2.556 12.270 3.118 30.263 11 AA_U13C14:G19A20_AA A 13 ? A 20 ? A 14 ? A 19 ? 1 A C 14 1_555 A G 19 1_555 A G 15 1_555 A A 18 1_555 -2.236 -1.502 2.754 5.745 -1.228 53.540 -1.597 2.760 2.550 -1.359 -6.355 53.837 12 AA_C14G15:A18G19_AA A 14 ? A 19 ? A 15 ? A 18 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 800 Varian 'NMR system' 1 'Varian NMR system' 600 Varian 'NMR system' 2 'Varian NMR system' # _atom_sites.entry_id 2KPV _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_