data_2KUR # _entry.id 2KUR # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2KUR pdb_00002kur 10.2210/pdb2kur/pdb RCSB RCSB101597 ? ? WWPDB D_1000101597 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2010-05-19 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 4 'Structure model' 1 3 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' 5 4 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_nmr_spectrometer 4 3 'Structure model' pdbx_struct_assembly 5 3 'Structure model' pdbx_struct_oper_list 6 4 'Structure model' chem_comp_atom 7 4 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' 4 3 'Structure model' '_pdbx_nmr_spectrometer.model' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2KUR _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2010-02-25 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 2KE6 _pdbx_database_related.content_type unspecified _pdbx_database_related.details 'Solution Structure of K10 TLS RNA' # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Bullock, S.L.' 1 'Ringel, I.' 2 'Ish-Horowicz, D.' 3 'Lukavsky, P.J.' 4 # _citation.id primary _citation.title ;A'-form RNA helices are required for cytoplasmic mRNA transport in Drosophila. ; _citation.journal_abbrev Nat.Struct.Mol.Biol. _citation.journal_volume 17 _citation.page_first 703 _citation.page_last 709 _citation.year 2010 _citation.journal_id_ASTM ? _citation.country US _citation.journal_id_ISSN 1545-9993 _citation.journal_id_CSD ? _citation.book_publisher ? _citation.pdbx_database_id_PubMed 20473315 _citation.pdbx_database_id_DOI 10.1038/nsmb.1813 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Bullock, S.L.' 1 ? primary 'Ringel, I.' 2 ? primary 'Ish-Horowicz, D.' 3 ? primary 'Lukavsky, P.J.' 4 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'K10 TLS RNA' _entity.formula_weight 15255.014 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation 'U15A, A32U' _entity.pdbx_fragment ? _entity.details ;The wild-type sequence of K10 TLS RNA is GGCUUGAUUGUAUUUUUAAAUUAAUUCUUAAAAACUACAAAUUAAGCC The mutations in the AU mutant in upper helix RNA are: U15A, A32U ; # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCUUGAUUGUAUUAUUAAAUUAAUUCUUAAUAACUACAAAUUAAGCC _entity_poly.pdbx_seq_one_letter_code_can GGCUUGAUUGUAUUAUUAAAUUAAUUCUUAAUAACUACAAAUUAAGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 U n 1 5 U n 1 6 G n 1 7 A n 1 8 U n 1 9 U n 1 10 G n 1 11 U n 1 12 A n 1 13 U n 1 14 U n 1 15 A n 1 16 U n 1 17 U n 1 18 A n 1 19 A n 1 20 A n 1 21 U n 1 22 U n 1 23 A n 1 24 A n 1 25 U n 1 26 U n 1 27 C n 1 28 U n 1 29 U n 1 30 A n 1 31 A n 1 32 U n 1 33 A n 1 34 A n 1 35 C n 1 36 U n 1 37 A n 1 38 C n 1 39 A n 1 40 A n 1 41 A n 1 42 U n 1 43 U n 1 44 A n 1 45 A n 1 46 G n 1 47 C n 1 48 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'Drosophila melanogaster' _pdbx_entity_src_syn.organism_common_name 'Fruit fly' _pdbx_entity_src_syn.ncbi_taxonomy_id 7227 _pdbx_entity_src_syn.details 'PREPARED BY IN VITRO TRANSCRIPTION USING T7 RNA POLYMERASE' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 U 9 9 9 U U A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 A 15 15 15 A A A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 A 18 18 18 A A A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 A 23 23 23 A A A . n A 1 24 A 24 24 24 A A A . n A 1 25 U 25 25 25 U U A . n A 1 26 U 26 26 26 U U A . n A 1 27 C 27 27 27 C C A . n A 1 28 U 28 28 28 U U A . n A 1 29 U 29 29 29 U U A . n A 1 30 A 30 30 30 A A A . n A 1 31 A 31 31 31 A A A . n A 1 32 U 32 32 32 U U A . n A 1 33 A 33 33 33 A A A . n A 1 34 A 34 34 34 A A A . n A 1 35 C 35 35 35 C C A . n A 1 36 U 36 36 36 U U A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 A 39 39 39 A A A . n A 1 40 A 40 40 40 A A A . n A 1 41 A 41 41 41 A A A . n A 1 42 U 42 42 42 U U A . n A 1 43 U 43 43 43 U U A . n A 1 44 A 44 44 44 A A A . n A 1 45 A 45 45 45 A A A . n A 1 46 G 46 46 46 G G A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2KUR _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2KUR _struct.title 'Solution Structure of K10 TLS RNA (AU mutant in upper helix)' _struct.pdbx_model_details 'lowest energy, model 1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2KUR _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA transport, RNA hairpin, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2KUR _struct_ref.pdbx_db_accession 2KUR _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2KUR _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 48 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2KUR _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 48 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 48 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 1 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 1 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 1 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 2 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 2 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 2 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 46 N1 ? ? A C 3 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 3 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 46 N2 ? ? A C 3 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 45 N1 ? ? A U 4 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 45 N6 ? ? A U 4 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 44 N1 ? ? A U 5 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 44 N6 ? ? A U 5 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 6 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 6 A U 43 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog15 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 42 N3 ? ? A A 7 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 42 O4 ? ? A A 7 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 41 N1 ? ? A U 8 A A 41 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog18 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 40 N1 ? ? A U 9 A A 40 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog19 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 10 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 10 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 10 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 37 N1 ? ? A U 11 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 37 N6 ? ? A U 11 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 36 N3 ? ? A A 12 A U 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 36 O4 ? ? A A 12 A U 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 34 N1 ? ? A U 13 A A 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 34 N6 ? ? A U 13 A A 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 33 N1 ? ? A U 14 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 33 N6 ? ? A U 14 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 15 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 15 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 15 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 15 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 31 N1 ? ? A U 16 A A 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 31 N6 ? ? A U 16 A A 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 17 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 17 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 18 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 18 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 18 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 18 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 19 N1 ? ? ? 1_555 A U 28 N3 ? ? A A 19 A U 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A A 19 N6 ? ? ? 1_555 A U 28 O4 ? ? A A 19 A U 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 20 N6 ? ? ? 1_555 A C 27 N3 ? ? A A 20 A C 27 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog41 hydrog ? ? A U 21 O2 ? ? ? 1_555 A U 26 N3 ? ? A U 21 A U 26 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 5 "O2'" A U 43 ? ? H8 A A 44 ? ? 1.58 2 5 O4 A U 11 ? ? H61 A A 37 ? ? 1.58 3 6 "HO2'" A A 23 ? ? "O4'" A A 24 ? ? 1.52 4 7 "O2'" A U 43 ? ? H8 A A 44 ? ? 1.55 5 7 "HO2'" A U 14 ? ? "O4'" A A 15 ? ? 1.59 6 10 "HO2'" A A 19 ? ? "O4'" A A 20 ? ? 1.57 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 6 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 A _pdbx_validate_rmsd_angle.auth_seq_id_1 30 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 A _pdbx_validate_rmsd_angle.auth_seq_id_2 30 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N9 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 A _pdbx_validate_rmsd_angle.auth_seq_id_3 30 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 112.70 _pdbx_validate_rmsd_angle.angle_target_value 108.50 _pdbx_validate_rmsd_angle.angle_deviation 4.20 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.70 _pdbx_validate_rmsd_angle.linker_flag N # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2KUR _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2KUR _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '1.0 mM RNA (48-MER)-1, 95% H2O/5% D2O' 1 '95% H2O/5% D2O' '1.0 mM RNA (48-MER)-2, 100% D2O' 2 '100% D2O' '0.5 mM [U-99% 13C; U-99% 15N] RNA (48-MER)-3, 95% H2O/5% D2O' 3 '95% H2O/5% D2O' '0.5 mM [U-99% 13C; U-99% 15N] RNA (48-MER)-4, 100% D2O' 4 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'RNA (48-MER)-1' 1.0 ? mM ? 1 'RNA (48-MER)-2' 1.0 ? mM ? 2 'RNA (48-MER)-3' 0.5 ? mM '[U-99% 13C; U-99% 15N]' 3 'RNA (48-MER)-4' 0.5 ? mM '[U-99% 13C; U-99% 15N]' 4 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 0.01 _pdbx_nmr_exptl_sample_conditions.pH 6.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 1 2 2 '2D 1H-1H NOESY' 1 3 2 '2D 1H-1H TOCSY' 1 4 2 '2D DQF-COSY' 1 5 2 '2D HP COSY' 1 6 3 '2D HNN COSY' 1 7 4 '3D HCCH-TOCSY' 1 8 4 '3D HCCH-COSY' 1 9 4 '3D 13C NOESY-HSQC' 1 10 4 '3D HCP' 1 11 4 '3D 13C HMQC TOCSY' 1 12 4 '2D 13C CT-TROSY' # _pdbx_nmr_details.entry_id 2KUR _pdbx_nmr_details.text ;STRUCTURE WAS DETERMINED USING TRIPLE RESONANCE, MULTIDIMENSIONAL NMR SPECTROSCOPY AND TROSY-TYPE EXPERIMENTS TO MEASURE RESIDUAL DIPOLAR COUPLINGS ; # _pdbx_nmr_refine.entry_id 2KUR _pdbx_nmr_refine.method 'simulated annealing, restrained molecular dynamics with RDCs' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Bruker Biospin' collection TopSpin ? 1 'Bruker Biospin' processing TopSpin ? 2 Goddard 'peak picking' Sparky ? 3 Goddard 'chemical shift assignment' Sparky ? 4 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' ? 5 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 6 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2KUR 'double helix' 2KUR 'a-form double helix' 2KUR 'hairpin loop' 2KUR 'bulge loop' 2KUR 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 48 1_555 -0.416 -0.306 -0.219 -7.250 3.445 -5.498 1 A_G1:C48_A A 1 ? A 48 ? 19 1 1 A G 2 1_555 A C 47 1_555 0.302 -0.156 -0.206 -3.766 -5.553 2.028 2 A_G2:C47_A A 2 ? A 47 ? 19 1 1 A C 3 1_555 A G 46 1_555 -0.386 -0.195 0.011 0.511 -6.204 -1.368 3 A_C3:G46_A A 3 ? A 46 ? 19 1 1 A U 4 1_555 A A 45 1_555 0.183 -0.029 -0.291 2.769 1.308 12.035 4 A_U4:A45_A A 4 ? A 45 ? 20 1 1 A U 5 1_555 A A 44 1_555 0.653 -0.248 -0.079 5.901 3.323 4.762 5 A_U5:A44_A A 5 ? A 44 ? 20 1 1 A G 6 1_555 A U 43 1_555 -2.571 0.425 -1.217 -24.019 3.226 26.494 6 A_G6:U43_A A 6 ? A 43 ? ? 1 1 A A 7 1_555 A U 42 1_555 0.532 -0.094 -0.312 -3.200 -3.770 5.146 7 A_A7:U42_A A 7 ? A 42 ? 20 1 1 A U 8 1_555 A A 41 1_555 -0.130 0.087 -0.236 6.717 -5.489 18.682 8 A_U8:A41_A A 8 ? A 41 ? ? 1 1 A U 9 1_555 A A 40 1_555 1.012 -0.096 -0.024 2.924 -1.737 19.399 9 A_U9:A40_A A 9 ? A 40 ? ? 1 1 A G 10 1_555 A C 38 1_555 0.510 -0.172 -0.153 -2.098 -0.896 -0.948 10 A_G10:C38_A A 10 ? A 38 ? 19 1 1 A U 11 1_555 A A 37 1_555 -0.421 -0.141 -0.105 -3.114 -5.160 -6.938 11 A_U11:A37_A A 11 ? A 37 ? 20 1 1 A A 12 1_555 A U 36 1_555 2.130 0.041 -0.221 -2.396 -1.421 -16.859 12 A_A12:U36_A A 12 ? A 36 ? 20 1 1 A U 13 1_555 A A 34 1_555 -0.205 -0.055 0.004 1.811 -6.011 3.276 13 A_U13:A34_A A 13 ? A 34 ? 20 1 1 A U 14 1_555 A A 33 1_555 -0.341 -0.098 -0.036 0.661 -2.598 3.787 14 A_U14:A33_A A 14 ? A 33 ? 20 1 1 A A 15 1_555 A U 32 1_555 -0.261 -0.219 -0.313 2.804 -1.048 -0.270 15 A_A15:U32_A A 15 ? A 32 ? 20 1 1 A U 16 1_555 A A 31 1_555 -0.516 -0.092 -0.536 9.174 -6.193 7.499 16 A_U16:A31_A A 16 ? A 31 ? 20 1 1 A U 17 1_555 A A 30 1_555 0.236 -0.142 -0.142 3.223 -2.548 4.921 17 A_U17:A30_A A 17 ? A 30 ? 20 1 1 A A 18 1_555 A U 29 1_555 -0.304 -0.213 -0.162 -1.936 -3.542 0.800 18 A_A18:U29_A A 18 ? A 29 ? 20 1 1 A A 19 1_555 A U 28 1_555 0.905 -0.183 -0.226 2.871 -8.256 -3.920 19 A_A19:U28_A A 19 ? A 28 ? 20 1 1 A A 20 1_555 A C 27 1_555 -1.332 -0.652 -1.785 -2.572 -14.463 29.556 20 A_A20:C27_A A 20 ? A 27 ? ? 1 1 A U 21 1_555 A U 26 1_555 1.869 -0.988 0.393 16.261 -25.757 43.146 21 A_U21:U26_A A 21 ? A 26 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 48 1_555 A G 2 1_555 A C 47 1_555 0.321 -1.188 3.207 -0.128 4.535 43.446 -2.015 -0.443 3.073 6.106 0.172 43.670 1 AA_G1G2:C47C48_AA A 1 ? A 48 ? A 2 ? A 47 ? 1 A G 2 1_555 A C 47 1_555 A C 3 1_555 A G 46 1_555 -0.824 -0.980 3.082 -2.813 8.491 35.584 -2.627 0.956 2.837 13.629 4.515 36.656 2 AA_G2C3:G46C47_AA A 2 ? A 47 ? A 3 ? A 46 ? 1 A C 3 1_555 A G 46 1_555 A U 4 1_555 A A 45 1_555 1.607 -0.416 3.665 1.394 3.080 37.166 -1.108 -2.305 3.676 4.821 -2.182 37.314 3 AA_C3U4:A45G46_AA A 3 ? A 46 ? A 4 ? A 45 ? 1 A U 4 1_555 A A 45 1_555 A U 5 1_555 A A 44 1_555 -0.687 -1.598 3.417 -0.445 1.866 32.552 -3.181 1.143 3.332 3.325 0.793 32.607 4 AA_U4U5:A44A45_AA A 4 ? A 45 ? A 5 ? A 44 ? 1 A U 5 1_555 A A 44 1_555 A G 6 1_555 A U 43 1_555 2.859 -1.818 3.805 7.569 21.904 18.975 -8.373 -3.872 1.831 48.396 -16.724 29.870 5 AA_U5G6:U43A44_AA A 5 ? A 44 ? A 6 ? A 43 ? 1 A G 6 1_555 A U 43 1_555 A A 7 1_555 A U 42 1_555 -1.962 0.011 3.026 -2.477 3.637 41.098 -0.352 2.529 3.124 5.163 3.516 41.322 6 AA_G6A7:U42U43_AA A 6 ? A 43 ? A 7 ? A 42 ? 1 A A 7 1_555 A U 42 1_555 A U 8 1_555 A A 41 1_555 0.905 -0.385 3.732 0.919 -5.736 32.811 0.431 -1.402 3.766 -10.056 -1.611 33.307 7 AA_A7U8:A41U42_AA A 7 ? A 42 ? A 8 ? A 41 ? 1 A U 8 1_555 A A 41 1_555 A U 9 1_555 A A 40 1_555 0.217 -0.138 3.502 -1.395 21.723 34.404 -2.793 -0.479 2.911 32.962 2.117 40.535 8 AA_U8U9:A40A41_AA A 8 ? A 41 ? A 9 ? A 40 ? 1 A U 9 1_555 A A 40 1_555 A G 10 1_555 A C 38 1_555 -0.015 -1.221 5.875 -22.823 11.537 43.575 -2.916 -2.905 4.880 14.185 28.062 50.208 9 AA_U9G10:C38A40_AA A 9 ? A 40 ? A 10 ? A 38 ? 1 A G 10 1_555 A C 38 1_555 A U 11 1_555 A A 37 1_555 -0.164 -1.357 3.736 1.316 -3.760 34.665 -1.601 0.506 3.849 -6.284 -2.199 34.887 10 AA_G10U11:A37C38_AA A 10 ? A 38 ? A 11 ? A 37 ? 1 A U 11 1_555 A A 37 1_555 A A 12 1_555 A U 36 1_555 0.420 -0.626 3.429 4.006 2.377 48.925 -0.941 -0.190 3.420 2.863 -4.825 49.133 11 AA_U11A12:U36A37_AA A 11 ? A 37 ? A 12 ? A 36 ? 1 A A 12 1_555 A U 36 1_555 A U 13 1_555 A A 34 1_555 2.878 -1.848 3.175 -2.074 10.441 38.355 -3.783 -4.444 2.456 15.530 3.085 39.752 12 AA_A12U13:A34U36_AA A 12 ? A 36 ? A 13 ? A 34 ? 1 A U 13 1_555 A A 34 1_555 A U 14 1_555 A A 33 1_555 -0.311 -0.504 3.657 -1.479 11.197 38.494 -2.146 0.268 3.395 16.553 2.187 40.057 13 AA_U13U14:A33A34_AA A 13 ? A 34 ? A 14 ? A 33 ? 1 A U 14 1_555 A A 33 1_555 A A 15 1_555 A U 32 1_555 0.479 -0.869 3.565 2.108 1.385 32.874 -1.787 -0.454 3.549 2.442 -3.719 32.968 14 AA_U14A15:U32A33_AA A 14 ? A 33 ? A 15 ? A 32 ? 1 A A 15 1_555 A U 32 1_555 A U 16 1_555 A A 31 1_555 -0.070 -1.244 3.350 -0.026 -0.304 32.807 -2.148 0.119 3.361 -0.538 0.045 32.809 15 AA_A15U16:A31U32_AA A 15 ? A 32 ? A 16 ? A 31 ? 1 A U 16 1_555 A A 31 1_555 A U 17 1_555 A A 30 1_555 0.376 -0.883 3.587 -1.862 9.703 41.411 -2.264 -0.720 3.289 13.491 2.589 42.523 16 AA_U16U17:A30A31_AA A 16 ? A 31 ? A 17 ? A 30 ? 1 A U 17 1_555 A A 30 1_555 A A 18 1_555 A U 29 1_555 -0.838 -1.693 3.306 0.141 6.495 27.831 -4.837 1.730 2.841 13.275 -0.287 28.565 17 AA_U17A18:U29A30_AA A 17 ? A 30 ? A 18 ? A 29 ? 1 A A 18 1_555 A U 29 1_555 A A 19 1_555 A U 28 1_555 -0.276 -1.045 3.219 1.342 10.055 37.794 -2.705 0.565 2.848 15.190 -2.028 39.084 18 AA_A18A19:U28U29_AA A 18 ? A 29 ? A 19 ? A 28 ? 1 A A 19 1_555 A U 28 1_555 A A 20 1_555 A C 27 1_555 1.524 -0.087 3.884 9.444 6.980 23.698 -2.559 -0.130 4.005 15.813 -21.395 26.411 19 AA_A19A20:C27U28_AA A 19 ? A 28 ? A 20 ? A 27 ? 1 A A 20 1_555 A C 27 1_555 A U 21 1_555 A U 26 1_555 1.406 1.376 2.351 -11.870 16.024 46.409 0.768 -2.285 2.281 19.322 14.312 50.294 20 AA_A20U21:U26C27_AA A 20 ? A 27 ? A 21 ? A 26 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker DMX 1 'Bruker DMX' 800 Bruker AVANCE 2 'Bruker Avance' # _atom_sites.entry_id 2KUR _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_