data_2M12 # _entry.id 2M12 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2M12 pdb_00002m12 10.2210/pdb2m12/pdb RCSB RCSB103074 ? ? BMRB 18838 ? ? WWPDB D_1000103074 ? ? # _pdbx_database_related.db_id 18838 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2M12 _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2012-11-13 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Popovic, M.' 1 'Greenbaum, N.L.' 2 # _citation.id primary _citation.title ;Role of helical constraints of the EBS1-IBS1 duplex of a group II intron on demarcation of the 5' splice site. ; _citation.journal_abbrev Rna _citation.journal_volume 20 _citation.page_first 24 _citation.page_last 35 _citation.year 2014 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 24243113 _citation.pdbx_database_id_DOI 10.1261/rna.039701.113 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Popovic, M.' 1 ? primary 'Greenbaum, N.L.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;RNA (5'-R(*GP*GP*GP*UP*GP*UP*AP*UP*UP*GP*GP*AP*AP*AP*UP*GP*AP*GP*CP*AP*CP*CP*C)-3') ; _entity.formula_weight 7443.480 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGUGUAUUGGAAAUGAGCACCC _entity_poly.pdbx_seq_one_letter_code_can GGGUGUAUUGGAAAUGAGCACCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 U n 1 5 G n 1 6 U n 1 7 A n 1 8 U n 1 9 U n 1 10 G n 1 11 G n 1 12 A n 1 13 A n 1 14 A n 1 15 U n 1 16 G n 1 17 A n 1 18 G n 1 19 C n 1 20 A n 1 21 C n 1 22 C n 1 23 C n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2M12 _struct_ref.pdbx_db_accession 2M12 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2M12 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 23 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2M12 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 23 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 23 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 2 1 2 '2D 1H-1H NOESY' 2 2 2 '2D 1H-1H TOCSY' 2 3 2 '2D DQF-COSY' 1 4 3 '2D 1H-15N HSQC' 2 5 4 '2D 1H-13C HSQC' 2 6 4 '2D 1H-13C HSQC aliphatic' 2 7 4 '2D 1H-13C HSQC aromatic' 2 8 3 '3D 1H-15N NOESY' 2 9 4 '3D HCCH-COSY' 2 10 4 '3D HCCH-TOCSY' 1 11 1 '2D 1H-1H NOESY' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 0.06 6.4 ambient ? 277 K 2 0.06 6.4 ambient ? 303 K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '0.03-0.9 mM ID3, 60 mM sodium chloride, 90% H2O/10% D2O' 1 '90% H2O/10% D2O' '0.3-0.9 mM ID3, 60 mM sodium chloride, 100% D2O' 2 '100% D2O' '0.3-0.5 mM [U-100% 13C; U-100% 15N] ID3, 60 mM sodium chloride, 90% H2O/10% D2O' 3 '90% H2O/10% D2O' '0.3-0.5 mM [U-100% 13C; U-100% 15N] ID3, 60 mM potassium chloride, 100% D2O' 4 '100% D2O' # _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model AVANCE _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type 'Bruker Avance' # _pdbx_nmr_refine.entry_id 2M12 _pdbx_nmr_refine.method 'torsion angle dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2M12 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2M12 _pdbx_nmr_representative.selection_criteria 'fewest violations' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal CCPN 'chemical shift assignment' CCPN ? 1 'Bruker Biospin' collection TopSpin ? 2 'Bruker Biospin' processing TopSpin ? 3 Goddard 'chemical shift assignment' Sparky ? 4 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' processing NMRPipe ? 5 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' ? 6 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 7 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details 'RNA stem loop' _exptl.entry_id 2M12 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2M12 _struct.title 'Solution structure of the ID3 stem loop of domain 1 of the ai5gamma group II intron' _struct.pdbx_model_details 'fewest violations, model3' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2M12 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'EBS1, stem loop, ID3, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 2 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 2 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 2 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 3 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 3 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 3 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 20 N1 ? ? A U 4 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 20 N6 ? ? A U 4 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 5 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 5 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 5 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 18 O6 ? ? A U 6 A G 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 18 N1 ? ? A U 6 A G 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog17 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 17 N1 ? ? A U 9 A A 17 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog18 hydrog ? ? A G 11 N3 ? ? ? 1_555 A A 13 N6 ? ? A G 11 A A 13 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2M12 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G GUA A . n A 1 2 G 2 2 2 G GUA A . n A 1 3 G 3 3 3 G GUA A . n A 1 4 U 4 4 4 U URA A . n A 1 5 G 5 5 5 G GUA A . n A 1 6 U 6 6 6 U URA A . n A 1 7 A 7 7 7 A ADE A . n A 1 8 U 8 8 8 U URA A . n A 1 9 U 9 9 9 U URA A . n A 1 10 G 10 10 10 G GUA A . n A 1 11 G 11 11 11 G GUA A . n A 1 12 A 12 12 12 A ADE A . n A 1 13 A 13 13 13 A ADE A . n A 1 14 A 14 14 14 A ADE A . n A 1 15 U 15 15 15 U URA A . n A 1 16 G 16 16 16 G GUA A . n A 1 17 A 17 17 17 A ADE A . n A 1 18 G 18 18 18 G GUA A . n A 1 19 C 19 19 19 C CYT A . n A 1 20 A 20 20 20 A ADE A . n A 1 21 C 21 21 21 C CYT A . n A 1 22 C 22 22 22 C CYT A . n A 1 23 C 23 23 23 C CYT A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-10-23 2 'Structure model' 1 1 2014-02-05 3 'Structure model' 1 2 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_database_status 3 3 'Structure model' pdbx_nmr_software 4 3 'Structure model' pdbx_nmr_spectrometer # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 3 'Structure model' '_pdbx_nmr_software.name' 5 3 'Structure model' '_pdbx_nmr_spectrometer.model' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id ID3-1 ? 0.03-0.9 mM ? 1 'sodium chloride-2' 60 ? mM ? 1 ID3-3 ? 0.3-0.9 mM ? 2 'sodium chloride-4' 60 ? mM ? 2 ID3-5 ? 0.3-0.5 mM '[U-100% 13C; U-100% 15N]' 3 'sodium chloride-6' 60 ? mM ? 3 ID3-7 ? 0.3-0.5 mM '[U-100% 13C; U-100% 15N]' 4 'potassium chloride-8' 60 ? mM ? 4 # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2M12 _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count ? _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_other-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count ? _pdbx_nmr_constraints.NOE_constraints_total 287 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count 130 _pdbx_nmr_constraints.NOE_long_range_total_count 26 _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count 99 _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O2'" A G 1 ? ? H8 A G 2 ? ? 1.50 2 1 "O2'" A A 14 ? ? H6 A U 15 ? ? 1.58 3 2 "O2'" A U 8 ? ? "H5''" A U 9 ? ? 1.57 4 2 "H1'" A G 11 ? ? O4 A U 15 ? ? 1.57 5 3 "HO2'" A U 15 ? ? "O5'" A G 16 ? ? 1.52 6 4 "H4'" A G 10 ? ? OP1 A G 11 ? ? 1.59 7 5 "HO2'" A U 15 ? ? "O5'" A G 16 ? ? 1.51 8 5 "HO2'" A A 7 ? ? "O5'" A U 8 ? ? 1.53 9 6 "O2'" A G 1 ? ? H8 A G 2 ? ? 1.48 10 6 "HO2'" A G 1 ? ? "O5'" A G 2 ? ? 1.54 11 7 "O2'" A G 1 ? ? H8 A G 2 ? ? 1.47 12 7 "O2'" A U 15 ? ? "H5'" A G 16 ? ? 1.53 13 7 "HO2'" A G 1 ? ? "O5'" A G 2 ? ? 1.54 14 7 "HO2'" A A 17 ? ? "O5'" A G 18 ? ? 1.55 15 8 "HO2'" A U 15 ? ? "O4'" A G 16 ? ? 1.46 16 9 "HO2'" A U 9 ? ? OP1 A G 10 ? ? 1.36 17 9 "HO2'" A A 14 ? ? "O5'" A U 15 ? ? 1.53 18 9 "HO2'" A U 8 ? ? "O5'" A U 9 ? ? 1.59 19 10 "HO2'" A A 14 ? ? "O4'" A U 15 ? ? 1.29 20 10 "O2'" A G 1 ? ? H8 A G 2 ? ? 1.53 21 10 "HO2'" A U 15 ? ? "O5'" A G 16 ? ? 1.54 22 10 "H1'" A G 10 ? ? OP1 A A 12 ? ? 1.58 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2M12 'double helix' 2M12 'a-form double helix' 2M12 'hairpin loop' 2M12 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 23 1_555 -0.134 -0.234 -0.298 16.713 23.023 -4.772 1 A_G1:C23_A A 1 ? A 23 ? 19 1 1 A G 2 1_555 A C 22 1_555 -0.042 -0.248 0.646 4.243 -11.576 -4.313 2 A_G2:C22_A A 2 ? A 22 ? 19 1 1 A G 3 1_555 A C 21 1_555 -0.101 -0.183 0.110 -0.079 -9.923 -2.005 3 A_G3:C21_A A 3 ? A 21 ? 19 1 1 A U 4 1_555 A A 20 1_555 -0.041 -0.072 -0.221 0.585 -9.636 -4.059 4 A_U4:A20_A A 4 ? A 20 ? 20 1 1 A G 5 1_555 A C 19 1_555 -0.041 -0.175 0.184 -2.248 -8.696 -2.907 5 A_G5:C19_A A 5 ? A 19 ? 19 1 1 A U 6 1_555 A G 18 1_555 1.997 -0.391 0.421 -8.467 0.196 -4.437 6 A_U6:G18_A A 6 ? A 18 ? 28 1 1 A U 9 1_555 A A 17 1_555 1.283 -0.672 1.912 -17.049 3.242 22.952 7 A_U9:A17_A A 9 ? A 17 ? ? 1 1 A G 11 1_555 A A 13 1_555 4.473 -1.821 -2.491 -5.962 -31.384 -8.194 8 A_G11:A13_A A 11 ? A 13 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 23 1_555 A G 2 1_555 A C 22 1_555 -0.737 -1.361 4.029 -10.413 9.676 29.621 -4.427 -0.862 3.485 17.700 19.048 32.786 1 AA_G1G2:C22C23_AA A 1 ? A 23 ? A 2 ? A 22 ? 1 A G 2 1_555 A C 22 1_555 A G 3 1_555 A C 21 1_555 0.051 -1.622 3.649 1.314 8.594 30.400 -4.652 0.161 3.086 15.982 -2.443 31.591 2 AA_G2G3:C21C22_AA A 2 ? A 22 ? A 3 ? A 21 ? 1 A G 3 1_555 A C 21 1_555 A U 4 1_555 A A 20 1_555 -0.104 -1.606 3.410 1.334 9.857 30.066 -4.709 0.430 2.752 18.380 -2.488 31.632 3 AA_G3U4:A20C21_AA A 3 ? A 21 ? A 4 ? A 20 ? 1 A U 4 1_555 A A 20 1_555 A G 5 1_555 A C 19 1_555 0.140 -1.616 3.516 -1.935 10.561 29.705 -4.923 -0.614 2.778 19.803 3.629 31.544 4 AA_U4G5:C19A20_AA A 4 ? A 20 ? A 5 ? A 19 ? 1 A G 5 1_555 A C 19 1_555 A U 6 1_555 A G 18 1_555 0.449 -1.678 4.234 3.632 11.776 35.483 -4.499 -0.116 3.546 18.641 -5.750 37.497 5 AA_G5U6:G18C19_AA A 5 ? A 19 ? A 6 ? A 18 ? #