data_2MBJ # _entry.id 2MBJ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2MBJ pdb_00002mbj 10.2210/pdb2mbj/pdb RCSB RCSB103444 ? ? BMRB 19402 ? ? WWPDB D_1000103444 ? ? # loop_ _pdbx_database_related.content_type _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details unspecified 143D PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF NA' unspecified 1KF1 PDB 'STRUCTURE AND PACKING OF HUMAN TELOMERIC DNA' unspecified 2JSM PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS NATURAL FORM 1' unspecified 2JSL PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS NATURAL FORM 2' unspecified 2KF8 PDB 'STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN K+ SOLUTION' unspecified 19402 BMRB . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2MBJ _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2013-08-02 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lim, K.W.' 1 'Ng, V.C.M.' 2 'Martin-Pintado, N.' 3 'Heddi, B.' 4 'Phan, A.T.' 5 # _citation.id primary _citation.title 'Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 41 _citation.page_first 10556 _citation.page_last 10562 _citation.year 2013 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 23999095 _citation.pdbx_database_id_DOI 10.1093/nar/gkt771 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lim, K.W.' 1 ? primary 'Ng, V.C.' 2 ? primary 'Martin-Pintado, N.' 3 ? primary 'Heddi, B.' 4 ? primary 'Phan, A.T.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'DNA_(27-MER)' _entity.formula_weight 8592.370 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT) (DA)(BGM)(DG)(DG)(DT)(DT)(DA) ; _entity_poly.pdbx_seq_one_letter_code_can TTAGGGTTAGGGTTAGGGTTAGGGTTA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DT n 1 2 DT n 1 3 DA n 1 4 DG n 1 5 DG n 1 6 DG n 1 7 DT n 1 8 DT n 1 9 DA n 1 10 DG n 1 11 DG n 1 12 DG n 1 13 DT n 1 14 DT n 1 15 DA n 1 16 DG n 1 17 DG n 1 18 DG n 1 19 DT n 1 20 DT n 1 21 DA n 1 22 BGM n 1 23 DG n 1 24 DG n 1 25 DT n 1 26 DT n 1 27 DA n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2MBJ _struct_ref.pdbx_db_accession 2MBJ _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code TTAGGGTTAGGGTTAGGGTTAGGGTTA _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2MBJ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2MBJ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight BGM 'DNA linking' n "8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H13 Br N5 O7 P' 426.117 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 2 '2D 1H-1H NOESY' 1 2 1 '2D 1H-1H JR NOESY' 1 3 2 '2D 1H-1H COSY' 1 4 2 '2D 1H-1H TOCSY' 1 5 2 '2D 1H-13C HSQC' 1 6 1 '2D 1H-13C JR HMBC' 1 7 1 'H-D EXCHANGE' 1 8 3 15N-FILTERED 1 9 4 D-LABELED # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength '100 mM NA+' _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '1-2 mM DNA (27-MER), 90% H2O/10% D2O' 1 '90% H2O/10% D2O' '1-2 mM DNA (27-MER), 100% D2O' 2 '100% D2O' '0.5-2 mM [U-2% 15N] DNA (27-MER), 90% H2O/10% D2O' 3 '90% H2O/10% D2O' '0.2-1 mM [U-100% 2H] DNA (27-MER), 90% H2O/10% D2O' 4 '90% H2O/10% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AVANCE 1 'Bruker Avance' 700 Bruker AVANCE 2 'Bruker Avance' # _pdbx_nmr_refine.entry_id 2MBJ _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing, Distance-restrained molecular dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2MBJ _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2MBJ _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Bruker Biospin' processing TopSpin 2.1 1 'Bruker Biospin' collection TopSpin 2.1 2 'Felix NMR, Inc.' 'peak picking' Felix 2007 3 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' 2.29 4 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' 2.29 5 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2MBJ _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2MBJ _struct.title 'Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution)' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2MBJ _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'anticancer targets, G-quadruplex, human telomere, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A DA 21 "O3'" ? ? ? 1_555 A BGM 22 P ? ? A DA 21 A BGM 22 1_555 ? ? ? ? ? ? ? 1.613 ? ? covale2 covale both ? A BGM 22 "O3'" ? ? ? 1_555 A DG 23 P ? ? A BGM 22 A DG 23 1_555 ? ? ? ? ? ? ? 1.611 ? ? hydrog1 hydrog ? ? A DA 3 N3 ? ? ? 1_555 A DA 21 N6 ? ? A DA 3 A DA 21 1_555 ? ? ? ? ? ? 'DA-DA MISPAIR' ? ? ? hydrog2 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DG 12 O6 ? ? A DG 4 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DG 12 N7 ? ? A DG 4 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A BGM 22 N2 ? ? A DG 4 A BGM 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A BGM 22 N1 ? ? A DG 4 A BGM 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 11 O6 ? ? A DG 5 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 11 N7 ? ? A DG 5 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 23 N2 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 23 N1 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 6 N7 ? ? ? 1_555 A DG 10 N2 ? ? A DG 6 A DG 10 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 A DG 10 N1 ? ? A DG 6 A DG 10 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 6 N1 ? ? ? 1_555 A DG 24 O6 ? ? A DG 6 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 6 N2 ? ? ? 1_555 A DG 24 N7 ? ? A DG 6 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DA 9 N3 ? ? ? 1_555 A DG 10 N1 ? ? A DA 9 A DG 10 1_555 ? ? ? ? ? ? 'DA-DG MISPAIR' ? ? ? hydrog15 hydrog ? ? A DA 9 N1 ? ? ? 1_555 A DT 25 N3 ? ? A DA 9 A DT 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DA 9 N6 ? ? ? 1_555 A DT 25 O4 ? ? A DA 9 A DT 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DG 10 N7 ? ? ? 1_555 A DG 16 N2 ? ? A DG 10 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 10 O6 ? ? ? 1_555 A DG 16 N1 ? ? A DG 10 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DT 14 O4 ? ? A DG 11 A DT 14 1_555 ? ? ? ? ? ? 'DG-DT MISPAIR' ? ? ? hydrog20 hydrog ? ? A DG 11 N1 ? ? ? 1_555 A DG 17 O6 ? ? A DG 11 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DG 17 N7 ? ? A DG 11 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 12 N1 ? ? ? 1_555 A DG 18 O6 ? ? A DG 12 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 12 N2 ? ? ? 1_555 A DG 18 N7 ? ? A DG 12 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 16 N7 ? ? ? 1_555 A DG 24 N2 ? ? A DG 16 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 16 O6 ? ? ? 1_555 A DG 24 N1 ? ? A DG 16 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 17 N1 ? ? ? 1_555 A DG 23 O6 ? ? A DG 17 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 17 N2 ? ? ? 1_555 A DG 23 N7 ? ? A DG 17 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 18 N1 ? ? ? 1_555 A BGM 22 O6 ? ? A DG 18 A BGM 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog29 hydrog ? ? A DG 18 N2 ? ? ? 1_555 A BGM 22 N7 ? ? A DG 18 A BGM 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _atom_sites.entry_id 2MBJ _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol BR C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DT 1 1 1 DT DT A . n A 1 2 DT 2 2 2 DT DT A . n A 1 3 DA 3 3 3 DA DA A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DT 7 7 7 DT DT A . n A 1 8 DT 8 8 8 DT DT A . n A 1 9 DA 9 9 9 DA DA A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DG 12 12 12 DG DG A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DT 14 14 14 DT DT A . n A 1 15 DA 15 15 15 DA DA A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DT 20 20 20 DT DT A . n A 1 21 DA 21 21 21 DA DA A . n A 1 22 BGM 22 22 22 BGM BGM A . n A 1 23 DG 23 23 23 DG DG A . n A 1 24 DG 24 24 24 DG DG A . n A 1 25 DT 25 25 25 DT DT A . n A 1 26 DT 26 26 26 DT DT A . n A 1 27 DA 27 27 27 DA DA A . n # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id BGM _pdbx_struct_mod_residue.label_seq_id 22 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id BGM _pdbx_struct_mod_residue.auth_seq_id 22 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id DG _pdbx_struct_mod_residue.details ? # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-09-18 2 'Structure model' 1 1 2014-01-08 3 'Structure model' 1 2 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' 5 3 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_database_status 3 3 'Structure model' pdbx_nmr_software 4 3 'Structure model' pdbx_nmr_spectrometer 5 3 'Structure model' struct_conn # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 3 'Structure model' '_pdbx_nmr_software.name' 5 3 'Structure model' '_pdbx_nmr_spectrometer.model' 6 3 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'DNA (27-MER)-1' ? 1-2 mM ? 1 'DNA (27-MER)-2' ? 1-2 mM ? 2 'DNA (27-MER)-3' ? 0.5-2 mM '[U-2% 15N]' 3 'DNA (27-MER)-4' ? 0.2-1 mM '[U-100% 2H]' 4 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H22 A DG 11 ? ? O4 A DT 14 ? ? 1.50 2 1 "H1'" A DG 18 ? ? "O5'" A DT 19 ? ? 1.59 3 2 H22 A DG 11 ? ? O4 A DT 14 ? ? 1.59 4 4 H22 A DG 11 ? ? O4 A DT 14 ? ? 1.51 5 4 OP2 A DT 13 ? ? H73 A DT 14 ? ? 1.53 6 9 "H4'" A DA 21 ? ? OP2 A BGM 22 ? ? 1.55 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 8 _pdbx_validate_rmsd_angle.auth_atom_id_1 C6 _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 DT _pdbx_validate_rmsd_angle.auth_seq_id_1 7 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 C5 _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 DT _pdbx_validate_rmsd_angle.auth_seq_id_2 7 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 C7 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 DT _pdbx_validate_rmsd_angle.auth_seq_id_3 7 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 119.20 _pdbx_validate_rmsd_angle.angle_target_value 122.90 _pdbx_validate_rmsd_angle.angle_deviation -3.70 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.60 _pdbx_validate_rmsd_angle.linker_flag N #