data_2MGN # _entry.id 2MGN # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2MGN pdb_00002mgn 10.2210/pdb2mgn/pdb RCSB RCSB103593 ? ? BMRB 19594 ? ? WWPDB D_1000103593 ? ? # _pdbx_database_related.db_id 19594 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2MGN _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2013-11-01 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Chung, W.J.' 1 'Heddi, B.' 2 'Hamon, F.' 3 'Teulade-Fichou, M.P.' 4 'Phan, A.T.' 5 # _citation.id primary _citation.title 'Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3.' _citation.journal_abbrev Angew.Chem.Int.Ed.Engl. _citation.journal_volume 53 _citation.page_first 999 _citation.page_last 1002 _citation.year 2014 _citation.journal_id_ASTM ? _citation.country GE _citation.journal_id_ISSN 1433-7851 _citation.journal_id_CSD 9999 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 24356977 _citation.pdbx_database_id_DOI 10.1002/anie.201308063 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chung, W.J.' 1 ? primary 'Heddi, B.' 2 ? primary 'Hamon, F.' 3 ? primary 'Teulade-Fichou, M.P.' 4 ? primary 'Phan, A.T.' 5 ? # _cell.entry_id 2MGN _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2MGN _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn "5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*G)-3'" 7691.935 1 ? ? ? ? 2 non-polymer syn 'N2,N9-bis(1-methylquinolin-3-yl)-1,10-phenanthroline-2,9-dicarboxamide' 550.609 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)(DG)(DG) (DA)(DA)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can TGAGGGTGGTGAGGGTGGGGAAGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DT n 1 2 DG n 1 3 DA n 1 4 DG n 1 5 DG n 1 6 DG n 1 7 DT n 1 8 DG n 1 9 DG n 1 10 DT n 1 11 DG n 1 12 DA n 1 13 DG n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DG n 1 18 DG n 1 19 DG n 1 20 DG n 1 21 DA n 1 22 DA n 1 23 DG n 1 24 DG n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2MGN _struct_ref.pdbx_db_accession 2MGN _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_seq_one_letter_code TGAGGGTGGTGAGGGTGGGGAAGG _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2MGN _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 24 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2MGN _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 24 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 24 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 PQ3 non-polymer . 'N2,N9-bis(1-methylquinolin-3-yl)-1,10-phenanthroline-2,9-dicarboxamide' Phen-DC3 'C34 H26 N6 O2' 550.609 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 2 1 1 '2D 1H-1H NOESY' 2 2 3 '2D 1H-1H NOESY' 2 3 3 '2D 1H-1H TOCSY' 1 4 2 '2D 1H-13C HSQC' 1 5 2 '2D 13C-filtered HSQC-NOESY' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 90 7 ? ? 298 K 2 45 7 ? ? 298 K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '0.2-2.0 mM DNA, 0.2-2.0 mM PQ3, 90% H2O/10% D2O' 1 '90% H2O/10% D2O' '1.0 mM DNA, 1.0 mM [U-100% 13C]-CH3 PQ3, 100% D2O' 2 '100% D2O' '0.2-2.0 mM DNA, 0.2-2.0 mM PQ3, 100% D2O' 3 '100% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AMX 1 'Bruker AMX' 700 Bruker AMX 2 'Bruker AMX' # _pdbx_nmr_refine.entry_id 2MGN _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing, simulated annealing, molecular dynamics' _pdbx_nmr_refine.details 'Extracted distances from structure of free DNA (PDB entry 2A5P) were used during calculation' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2MGN _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2MGN _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' 'geometry optimization' Amber ? 1 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' refinement Amber ? 2 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' 'structure solution' Amber ? 3 Goddard 'chemical shift assignment' Sparky ? 4 Goddard 'data analysis' Sparky ? 5 Goddard 'peak picking' Sparky ? 6 'Bruker Biospin' collection TopSpin ? 7 'Bruker Biospin' processing TopSpin ? 8 'Schwieters, Kuszewski, Tjandra and Clore' 'geometry optimization' 'X-PLOR NIH' ? 9 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 10 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' ? 11 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2MGN _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2MGN _struct.title 'Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2MGN _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'ligand, c-MYC promoter, DNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DG 8 O6 ? ? A DG 4 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DG 8 N7 ? ? A DG 4 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A DG 17 N2 ? ? A DG 4 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DG 17 N1 ? ? A DG 4 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 18 N2 ? ? A DG 5 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 18 N1 ? ? A DG 5 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 6 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 6 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 6 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 6 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 6 N1 ? ? ? 1_555 A DG 24 O6 ? ? A DG 6 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 6 N2 ? ? ? 1_555 A DG 24 N7 ? ? A DG 6 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 8 N1 ? ? ? 1_555 A DG 13 O6 ? ? A DG 8 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DG 13 N7 ? ? A DG 8 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 14 O6 ? ? A DG 9 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 14 N7 ? ? A DG 9 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 13 N1 ? ? ? 1_555 A DG 17 O6 ? ? A DG 13 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 13 N2 ? ? ? 1_555 A DG 17 N7 ? ? A DG 13 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 14 N1 ? ? ? 1_555 A DG 18 O6 ? ? A DG 14 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 14 N2 ? ? ? 1_555 A DG 18 N7 ? ? A DG 14 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 15 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 15 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 24 N2 ? ? A DG 15 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 24 N1 ? ? A DG 15 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 20 N2 ? ? ? 1_555 A DA 22 N7 ? ? A DG 20 A DA 22 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog26 hydrog ? ? A DG 20 N3 ? ? ? 1_555 A DA 22 N6 ? ? A DG 20 A DA 22 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog27 hydrog ? ? A DG 20 N1 ? ? ? 1_555 A DG 23 O6 ? ? A DG 20 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 20 N2 ? ? ? 1_555 A DG 23 N7 ? ? A DG 20 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id PQ3 _struct_site.pdbx_auth_seq_id 25 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 5 _struct_site.details 'BINDING SITE FOR RESIDUE PQ3 A 25' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 5 DA A 3 ? DA A 3 . ? 1_555 ? 2 AC1 5 DG A 4 ? DG A 4 . ? 1_555 ? 3 AC1 5 DG A 8 ? DG A 8 . ? 1_555 ? 4 AC1 5 DG A 13 ? DG A 13 . ? 1_555 ? 5 AC1 5 DG A 17 ? DG A 17 . ? 1_555 ? # _atom_sites.entry_id 2MGN _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DT 1 1 1 DT DT A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DA 3 3 3 DA DA A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DT 7 7 7 DT DT A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DA 21 21 21 DA DA A . n A 1 22 DA 22 22 22 DA DA A . n A 1 23 DG 23 23 23 DG DG A . n A 1 24 DG 24 24 24 DG DG A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id PQ3 _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 25 _pdbx_nonpoly_scheme.auth_seq_num 25 _pdbx_nonpoly_scheme.pdb_mon_id PQ3 _pdbx_nonpoly_scheme.auth_mon_id PQ3 _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2014-01-22 2 'Structure model' 1 1 2014-02-05 3 'Structure model' 1 2 2014-04-02 4 'Structure model' 1 3 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Non-polymer description' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 4 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_nmr_software 4 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 4 'Structure model' '_pdbx_nmr_software.name' 5 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 6 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 7 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id DNA-1 ? 0.2-2 mM ? 1 PQ3-2 ? 0.2-2 mM ? 1 DNA-3 1 ? mM ? 2 PQ3-4 1 ? mM '[U-100% 13C]-CH3' 2 DNA-5 ? 0.2-2 mM ? 3 PQ3-6 ? 0.2-2 mM ? 3 # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2MGN _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count ? _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count 24 _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_other-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count ? _pdbx_nmr_constraints.NOE_constraints_total 111 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count ? _pdbx_nmr_constraints.NOE_long_range_total_count ? _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count ? _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 4 "O5'" A DT 1 ? ? H62 A DA 3 ? ? 1.58 2 5 "H1'" A DG 23 ? ? OP2 A DG 24 ? ? 1.57 3 7 "HO5'" A DT 1 ? ? OP2 A DG 2 ? ? 1.56 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 3 "C5'" A DG 23 ? ? "C4'" A DG 23 ? ? 1.556 1.512 0.044 0.007 N 2 5 "C5'" A DG 23 ? ? "C4'" A DG 23 ? ? 1.556 1.512 0.044 0.007 N 3 6 "C5'" A DG 23 ? ? "C4'" A DG 23 ? ? 1.557 1.512 0.045 0.007 N 4 10 C6 A DT 10 ? ? N1 A DT 10 ? ? 1.333 1.378 -0.045 0.007 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C6 A DT 7 ? ? C5 A DT 7 ? ? C7 A DT 7 ? ? 119.21 122.90 -3.69 0.60 N 2 2 C6 A DT 1 ? ? C5 A DT 1 ? ? C7 A DT 1 ? ? 119.28 122.90 -3.62 0.60 N 3 3 C6 A DT 10 ? ? C5 A DT 10 ? ? C7 A DT 10 ? ? 119.19 122.90 -3.71 0.60 N 4 4 C6 A DT 10 ? ? C5 A DT 10 ? ? C7 A DT 10 ? ? 119.09 122.90 -3.81 0.60 N 5 5 C6 A DT 10 ? ? C5 A DT 10 ? ? C7 A DT 10 ? ? 119.10 122.90 -3.80 0.60 N 6 6 C6 A DT 10 ? ? C5 A DT 10 ? ? C7 A DT 10 ? ? 119.25 122.90 -3.65 0.60 N 7 7 C6 A DT 7 ? ? C5 A DT 7 ? ? C7 A DT 7 ? ? 119.29 122.90 -3.61 0.60 N 8 8 C6 A DT 7 ? ? C5 A DT 7 ? ? C7 A DT 7 ? ? 119.29 122.90 -3.61 0.60 N 9 9 "O4'" A DA 22 ? ? "C1'" A DA 22 ? ? N9 A DA 22 ? ? 110.41 108.30 2.11 0.30 N 10 10 C6 A DT 7 ? ? C5 A DT 7 ? ? C7 A DT 7 ? ? 119.23 122.90 -3.67 0.60 N # _ndb_struct_conf_na.entry_id 2MGN _ndb_struct_conf_na.feature 'quadruple helix' # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'N2,N9-bis(1-methylquinolin-3-yl)-1,10-phenanthroline-2,9-dicarboxamide' _pdbx_entity_nonpoly.comp_id PQ3 #