data_2N4Y # _entry.id 2N4Y # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_code _database_2.database_id _database_2.pdbx_database_accession _database_2.pdbx_DOI RCSB104427 RCSB ? ? 2N4Y PDB pdb_00002n4y 10.2210/pdb2n4y/pdb 25686 BMRB ? 10.13018/BMR25686 D_1000104427 WWPDB ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2016-06-29 2 'Structure model' 1 1 2017-06-07 3 'Structure model' 1 2 2023-06-14 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' Other 5 4 'Structure model' 'Data collection' 6 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_database_status 3 3 'Structure model' pdbx_nmr_software 4 3 'Structure model' pdbx_nmr_spectrometer 5 4 'Structure model' chem_comp_atom 6 4 'Structure model' chem_comp_bond 7 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 3 'Structure model' '_pdbx_nmr_software.name' 5 3 'Structure model' '_pdbx_nmr_spectrometer.model' 6 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2N4Y _pdbx_database_status.methods_development_category ? _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2015-07-02 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # _pdbx_database_related.db_id 25686 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'DeNicola, B.' 1 'Lech, C.J.' 2 'Heddi, B.' 3 'Regmi, S.' 4 'Frasson, I.' 5 'Perrone, R.' 6 'Richter, S.N.' 7 'Phan, A.T.' 8 # _citation.id primary _citation.title 'Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 44 _citation.page_first 6442 _citation.page_last 6451 _citation.year 2016 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 1362-4962 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 27298260 _citation.pdbx_database_id_DOI 10.1093/nar/gkw432 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'De Nicola, B.' 1 ? primary 'Lech, C.J.' 2 ? primary 'Heddi, B.' 3 ? primary 'Regmi, S.' 4 ? primary 'Frasson, I.' 5 ? primary 'Perrone, R.' 6 ? primary 'Richter, S.N.' 7 ? primary 'Phan, A.T.' 8 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3')" _entity.formula_weight 6945.449 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DC)(DT)(DG)(DG)(DG)(DC)(DG)(DG)(DG)(DA)(DC)(DT)(DG)(DG)(DG)(DG)(DA)(DG)(DT)(DG) (DG)(DT) ; _entity_poly.pdbx_seq_one_letter_code_can CTGGGCGGGACTGGGGAGTGGT _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DC n 1 2 DT n 1 3 DG n 1 4 DG n 1 5 DG n 1 6 DC n 1 7 DG n 1 8 DG n 1 9 DG n 1 10 DA n 1 11 DC n 1 12 DT n 1 13 DG n 1 14 DG n 1 15 DG n 1 16 DG n 1 17 DA n 1 18 DG n 1 19 DT n 1 20 DG n 1 21 DG n 1 22 DT n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DC 1 1 1 DC DC A . n A 1 2 DT 2 2 2 DT DT A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DC 6 6 6 DC DC A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 DC 11 11 11 DC DC A . n A 1 12 DT 12 12 12 DT DT A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DT 22 22 22 DT DT A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2N4Y _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2N4Y _struct.title 'Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2N4Y _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'G-quadruplex, HIV-1, Long Terminal Repeat, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2N4Y _struct_ref.pdbx_db_accession 2N4Y _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2N4Y _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2N4Y _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 7 O6 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 7 N7 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 18 N2 ? ? A DG 3 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 18 N1 ? ? A DG 3 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DG 8 O6 ? ? A DG 4 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DG 8 N7 ? ? A DG 4 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A DG 20 N2 ? ? A DG 4 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DG 20 N1 ? ? A DG 4 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 4 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 4 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 5 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 5 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 7 N1 ? ? ? 1_555 A DG 14 O6 ? ? A DG 7 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 7 N2 ? ? ? 1_555 A DG 14 N7 ? ? A DG 7 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 8 N1 ? ? ? 1_555 A DG 15 O6 ? ? A DG 8 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DG 15 N7 ? ? A DG 8 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 16 O6 ? ? A DG 9 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 16 N7 ? ? A DG 9 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DA 10 N6 ? ? ? 1_555 A DG 13 N3 ? ? A DA 10 A DG 13 1_555 ? ? ? ? ? ? 'DA-DG MISPAIR' ? ? ? hydrog22 hydrog ? ? A DG 14 N1 ? ? ? 1_555 A DG 18 O6 ? ? A DG 14 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 14 N2 ? ? ? 1_555 A DG 18 N7 ? ? A DG 14 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 15 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 15 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 15 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 15 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 16 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 16 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 16 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DT 22 O4 ? ? A DG 16 A DT 22 1_555 ? ? ? ? ? ? 'DG-DT MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 4 "H1'" A DG 16 ? ? OP2 A DA 17 ? ? 1.55 2 4 "H1'" A DT 2 ? ? OP2 A DG 3 ? ? 1.58 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 4 C6 A DT 2 ? ? C5 A DT 2 ? ? C7 A DT 2 ? ? 119.30 122.90 -3.60 0.60 N 2 5 C6 A DT 19 ? ? C5 A DT 19 ? ? C7 A DT 19 ? ? 119.21 122.90 -3.69 0.60 N 3 5 C6 A DT 22 ? ? C5 A DT 22 ? ? C7 A DT 22 ? ? 119.18 122.90 -3.72 0.60 N 4 8 "C1'" A DT 19 ? ? "O4'" A DT 19 ? ? "C4'" A DT 19 ? ? 103.53 110.10 -6.57 1.00 N # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2N4Y _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation 0.001 _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation 0.330 _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_ensemble_rms.atom_type ? _pdbx_nmr_ensemble_rms.bond_angle_rms_dev ? _pdbx_nmr_ensemble_rms.bond_angle_rms_dev_error ? _pdbx_nmr_ensemble_rms.chain_range_begin ? _pdbx_nmr_ensemble_rms.chain_range_end ? _pdbx_nmr_ensemble_rms.coord_average_rmsd_method ? _pdbx_nmr_ensemble_rms.covalent_bond_rms_dev ? _pdbx_nmr_ensemble_rms.covalent_bond_rms_dev_error ? _pdbx_nmr_ensemble_rms.dihedral_angles_rms_dev ? _pdbx_nmr_ensemble_rms.dihedral_angles_rms_dev_error ? _pdbx_nmr_ensemble_rms.distance_rms_dev 0.013 _pdbx_nmr_ensemble_rms.distance_rms_dev_error ? _pdbx_nmr_ensemble_rms.entry_id 2N4Y _pdbx_nmr_ensemble_rms.improper_torsion_angle_rms_dev ? _pdbx_nmr_ensemble_rms.improper_torsion_angle_rms_dev_error ? _pdbx_nmr_ensemble_rms.peptide_planarity_rms_dev ? _pdbx_nmr_ensemble_rms.peptide_planarity_rms_dev_error ? _pdbx_nmr_ensemble_rms.residue_range_begin ? _pdbx_nmr_ensemble_rms.residue_range_end ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2N4Y _pdbx_nmr_representative.selection_criteria 'lowest energy' # _pdbx_nmr_sample_details.contents ;0.1-1 mM DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3')-1, 90% H2O/10% D2O ; _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.solvent_system '90% H2O/10% D2O' # _pdbx_nmr_exptl_sample.component ;DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3')-1 ; _pdbx_nmr_exptl_sample.concentration ? _pdbx_nmr_exptl_sample.concentration_range 0.1-1 _pdbx_nmr_exptl_sample.concentration_units mM _pdbx_nmr_exptl_sample.isotopic_labeling ? _pdbx_nmr_exptl_sample.solution_id 1 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 90 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 1 2 1 '2D 1H-1H TOCSY' 1 3 1 '2D 1H-13C HSQC aliphatic' 1 4 1 '1D JR-HMQC' # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2N4Y _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count 2 _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count 12 _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_other-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count 0 _pdbx_nmr_constraints.NOE_constraints_total 581 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count 406 _pdbx_nmr_constraints.NOE_long_range_total_count 70 _pdbx_nmr_constraints.NOE_medium_range_total_count 70 _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count 105 _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # _pdbx_nmr_refine.entry_id 2N4Y _pdbx_nmr_refine.method 'distance geometry, DGSA-distance geometry simulated annealing, simulated annealing, molecular dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.ordinal _pdbx_nmr_software.version Goddard 'chemical shift assignment' Sparky 1 ? Goddard 'data analysis' Sparky 2 ? Goddard 'peak picking' Sparky 3 ? 'Bruker Biospin' collection TopSpin 4 ? 'Schwieters, Kuszewski, Tjandra and Clore' 'geometry optimization' 'X-PLOR NIH' 5 ? 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' 6 ? 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' refinement Amber 7 ? 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' 'structure solution' Amber 8 ? ? refinement 'X-PLOR NIH' 9 ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DC OP3 O N N 37 DC P P N N 38 DC OP1 O N N 39 DC OP2 O N N 40 DC "O5'" O N N 41 DC "C5'" C N N 42 DC "C4'" C N R 43 DC "O4'" O N N 44 DC "C3'" C N S 45 DC "O3'" O N N 46 DC "C2'" C N N 47 DC "C1'" C N R 48 DC N1 N N N 49 DC C2 C N N 50 DC O2 O N N 51 DC N3 N N N 52 DC C4 C N N 53 DC N4 N N N 54 DC C5 C N N 55 DC C6 C N N 56 DC HOP3 H N N 57 DC HOP2 H N N 58 DC "H5'" H N N 59 DC "H5''" H N N 60 DC "H4'" H N N 61 DC "H3'" H N N 62 DC "HO3'" H N N 63 DC "H2'" H N N 64 DC "H2''" H N N 65 DC "H1'" H N N 66 DC H41 H N N 67 DC H42 H N N 68 DC H5 H N N 69 DC H6 H N N 70 DG OP3 O N N 71 DG P P N N 72 DG OP1 O N N 73 DG OP2 O N N 74 DG "O5'" O N N 75 DG "C5'" C N N 76 DG "C4'" C N R 77 DG "O4'" O N N 78 DG "C3'" C N S 79 DG "O3'" O N N 80 DG "C2'" C N N 81 DG "C1'" C N R 82 DG N9 N Y N 83 DG C8 C Y N 84 DG N7 N Y N 85 DG C5 C Y N 86 DG C6 C N N 87 DG O6 O N N 88 DG N1 N N N 89 DG C2 C N N 90 DG N2 N N N 91 DG N3 N N N 92 DG C4 C Y N 93 DG HOP3 H N N 94 DG HOP2 H N N 95 DG "H5'" H N N 96 DG "H5''" H N N 97 DG "H4'" H N N 98 DG "H3'" H N N 99 DG "HO3'" H N N 100 DG "H2'" H N N 101 DG "H2''" H N N 102 DG "H1'" H N N 103 DG H8 H N N 104 DG H1 H N N 105 DG H21 H N N 106 DG H22 H N N 107 DT OP3 O N N 108 DT P P N N 109 DT OP1 O N N 110 DT OP2 O N N 111 DT "O5'" O N N 112 DT "C5'" C N N 113 DT "C4'" C N R 114 DT "O4'" O N N 115 DT "C3'" C N S 116 DT "O3'" O N N 117 DT "C2'" C N N 118 DT "C1'" C N R 119 DT N1 N N N 120 DT C2 C N N 121 DT O2 O N N 122 DT N3 N N N 123 DT C4 C N N 124 DT O4 O N N 125 DT C5 C N N 126 DT C7 C N N 127 DT C6 C N N 128 DT HOP3 H N N 129 DT HOP2 H N N 130 DT "H5'" H N N 131 DT "H5''" H N N 132 DT "H4'" H N N 133 DT "H3'" H N N 134 DT "HO3'" H N N 135 DT "H2'" H N N 136 DT "H2''" H N N 137 DT "H1'" H N N 138 DT H3 H N N 139 DT H71 H N N 140 DT H72 H N N 141 DT H73 H N N 142 DT H6 H N N 143 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2N4Y 'double helix' 2N4Y 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 10 1_555 A DG 13 1_555 -4.317 0.382 -1.350 7.170 -38.647 157.233 1 A_DA10:DG13_A A 10 ? A 13 ? ? ? 1 A DG 3 1_555 A DG 18 1_555 -1.877 -3.297 0.199 10.760 -9.576 86.716 2 A_DG3:DG18_A A 3 ? A 18 ? 6 3 1 A DG 7 1_555 A DG 14 1_555 1.656 3.339 -0.062 -8.264 9.568 -91.001 3 A_DG7:DG14_A A 7 ? A 14 ? 6 3 1 A DG 20 1_555 A DG 15 1_555 -1.369 -3.476 -0.161 7.280 2.521 92.329 4 A_DG20:DG15_A A 20 ? A 15 ? 6 3 1 A DG 21 1_555 A DG 16 1_555 -1.532 -3.609 -1.137 3.268 11.702 89.206 5 A_DG21:DG16_A A 21 ? A 16 ? 6 3 1 A DG 5 1_555 A DG 9 1_555 1.573 3.453 0.727 -3.098 -17.242 -90.636 6 A_DG5:DG9_A A 5 ? A 9 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 A DG 18 1_555 A DG 7 1_555 A DG 14 1_555 -1.809 -3.295 0.069 4.163 6.587 177.482 -1.648 0.905 0.063 3.294 -2.082 177.487 1 AA_DG3DG7:DG14DG18_AA A 3 ? A 18 ? A 7 ? A 14 ? 1 A DG 7 1_555 A DG 14 1_555 A DG 20 1_555 A DG 15 1_555 -1.388 -2.943 3.159 -2.250 2.076 117.290 -1.743 0.791 3.143 1.216 1.317 117.314 2 AA_DG7DG20:DG15DG14_AA A 7 ? A 14 ? A 20 ? A 15 ? 1 A DG 20 1_555 A DG 15 1_555 A DG 21 1_555 A DG 16 1_555 -0.227 -1.154 2.842 -0.205 11.125 29.586 -3.793 0.386 2.272 20.878 0.385 31.565 3 AA_DG20DG21:DG16DG15_AA A 20 ? A 15 ? A 21 ? A 16 ? 1 A DG 21 1_555 A DG 16 1_555 A DG 5 1_555 A DG 9 1_555 -1.652 -3.517 0.135 -26.792 3.490 178.689 -1.759 0.826 0.138 1.745 13.397 178.725 4 AA_DG21DG5:DG9DG16_AA A 21 ? A 16 ? A 5 ? A 9 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AVANCE 1 'Bruker Avance' 700 Bruker AVANCE 2 'Bruker Avance' # _atom_sites.entry_id 2N4Y _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_