data_2N6S # _entry.id 2N6S # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_code _database_2.database_id _database_2.pdbx_database_accession _database_2.pdbx_DOI RCSB104493 RCSB ? ? 2N6S PDB pdb_00002n6s 10.2210/pdb2n6s/pdb 25780 BMRB ? 10.13018/BMR25780 D_1000104493 WWPDB ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2016-08-03 2 'Structure model' 1 1 2016-11-23 3 'Structure model' 1 2 2023-06-14 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' 5 3 'Structure model' Other 6 4 'Structure model' 'Data collection' 7 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_database_status 3 3 'Structure model' pdbx_nmr_software 4 3 'Structure model' pdbx_nmr_spectrometer 5 3 'Structure model' struct_conn 6 4 'Structure model' chem_comp_atom 7 4 'Structure model' chem_comp_bond 8 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 3 'Structure model' '_pdbx_nmr_software.name' 5 3 'Structure model' '_pdbx_nmr_spectrometer.model' 6 3 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' 7 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2N6S _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2015-08-28 _pdbx_database_status.SG_entry Y _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.content_type _pdbx_database_related.details 25780 BMRB unspecified . 2N6T PDB unspecified . 2N6W PDB unspecified . 2N6X PDB unspecified . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Barnwal, R.' 1 'Godin, K.' 2 'Varani, G.' 3 'Seattle Structural Genomics Center for Infectious Disease (SSGCID)' 4 # _citation.id primary _citation.title 'Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 44 _citation.page_first 9426 _citation.page_last 9437 _citation.year 2016 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 27369378 _citation.pdbx_database_id_DOI 10.1093/nar/gkw584 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Barnwal, R.P.' 1 ? primary 'Loh, E.' 2 ? primary 'Godin, K.S.' 3 ? primary 'Yip, J.' 4 ? primary 'Lavender, H.' 5 ? primary 'Tang, C.M.' 6 ? primary 'Varani, G.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (36-MER)' _entity.formula_weight 11474.785 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC _entity_poly.pdbx_seq_one_letter_code_can GGAAUUUAUGAGUACCUUCGGAUACUUAUAGAUUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 A n 1 5 U n 1 6 U n 1 7 U n 1 8 A n 1 9 U n 1 10 G n 1 11 A n 1 12 G n 1 13 U n 1 14 A n 1 15 C n 1 16 C n 1 17 U n 1 18 U n 1 19 C n 1 20 G n 1 21 G n 1 22 A n 1 23 U n 1 24 A n 1 25 C n 1 26 U n 1 27 U n 1 28 A n 1 29 U n 1 30 A n 1 31 G n 1 32 A n 1 33 U n 1 34 U n 1 35 C n 1 36 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'Neisseria meningitidis' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 487 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 U 5 5 5 U U A . n A 1 6 U 6 6 6 U U A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 U 9 9 9 U U A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 G 20 20 20 G G A . n A 1 21 G 21 21 21 G G A . n A 1 22 A 22 22 22 A A A . n A 1 23 U 23 23 23 U U A . n A 1 24 A 24 24 24 A A A . n A 1 25 C 25 25 25 C C A . n A 1 26 U 26 26 26 U U A . n A 1 27 U 27 27 27 U U A . n A 1 28 A 28 28 28 A A A . n A 1 29 U 29 29 29 U U A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 A 32 32 32 A A A . n A 1 33 U 33 33 33 U U A . n A 1 34 U 34 34 34 U U A . n A 1 35 C 35 35 35 C C A . n A 1 36 C 36 36 36 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2N6S _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2N6S _struct.title 'Structure of CssA4 (bottom stem) of CssA thermometer' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2N6S _struct_keywords.pdbx_keywords RNA _struct_keywords.text ;RNA regulation, pathogen, RNA thermometer, RNA, Structural Genomics, Seattle Structural Genomics Center for Infectious Disease, SSGCID ; # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2N6S _struct_ref.pdbx_db_accession 2N6S _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2N6S _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 36 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2N6S _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 36 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 36 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A G 1 A G 2 1_555 ? ? ? ? ? ? ? 1.609 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 34 N3 ? ? A A 3 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 34 O4 ? ? A A 3 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 4 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 4 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 32 N1 ? ? A U 5 A A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 32 N6 ? ? A U 5 A A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 31 O6 ? ? A U 6 A G 31 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog11 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 31 N1 ? ? A U 6 A G 31 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 7 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 7 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 8 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 8 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 28 N1 ? ? A U 9 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 9 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 N1 ? ? ? 1_555 A U 27 O2 ? ? A G 10 A U 27 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A G 10 O6 ? ? ? 1_555 A U 27 N3 ? ? A G 10 A U 27 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 11 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 11 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 12 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 12 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 12 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 24 N1 ? ? A U 13 A A 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 24 N6 ? ? A U 13 A A 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 14 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 14 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 15 O2 ? ? ? 1_555 A A 22 N6 ? ? A C 15 A A 22 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog30 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 17 O2 ? ? ? 1_555 A G 20 N1 ? ? A U 17 A G 20 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog34 hydrog ? ? A U 17 N3 ? ? ? 1_555 A G 21 O6 ? ? A U 17 A G 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A U 17 O2 ? ? ? 1_555 A G 21 N1 ? ? A U 17 A G 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 19 A G 20 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 5 "HO2'" A A 14 ? ? "O4'" A C 15 ? ? 1.60 2 6 "HO2'" A U 33 ? ? "O4'" A U 34 ? ? 1.54 3 7 "H2'" A G 20 ? ? "O4'" A G 21 ? ? 1.59 4 8 "HO2'" A A 4 ? ? "O4'" A U 5 ? ? 1.60 5 9 "H2'" A G 20 ? ? "O4'" A G 21 ? ? 1.58 6 10 "HO2'" A U 13 ? ? "O4'" A A 14 ? ? 1.58 # _pdbx_SG_project.full_name_of_center 'Seattle Structural Genomics Center for Infectious Disease' _pdbx_SG_project.id 1 _pdbx_SG_project.initial_of_center SSGCID _pdbx_SG_project.project_name ? # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.conformers_calculated_total_number 50 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2N6S _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2N6S _pdbx_nmr_representative.selection_criteria 'lowest energy' # _pdbx_nmr_sample_details.contents ;0.4-1.1 mM CssA4 (36mer), 0.4-1.1 mM 13C/15N-uniformly labeled CssA4 (36mer), 0.4-1.1 mM 13C/15N-AU labeled CssA4 (36mer), 0.4-1.1 mM partially deuterated CssA4 (36mer), 95% H2O/5% D2O ; _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'CssA4 (36mer)-1' ? 0.4-1.1 mM ? 1 'CssA4 (36mer)-2' ? 0.4-1.1 mM '13C/15N-uniformly labeled' 1 'CssA4 (36mer)-3' ? 0.4-1.1 mM '13C/15N-AU labeled' 1 'CssA4 (36mer)-4' ? 0.4-1.1 mM 'partially deuterated' 1 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength ? _pdbx_nmr_exptl_sample_conditions.pH 6.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 1 2 1 '2D 1H-1H TOCSY' 1 3 1 '2D DQF-COSY' 1 4 1 '2D 1H-13C HSQC' 1 5 1 '2D 1H-15N HSQC' 1 6 1 '3D 1H-13C NOESY' 1 7 1 '3D HCCH-TOCSY' 1 8 1 ARTSY 1 9 1 ARTSY # _pdbx_nmr_refine.entry_id 2N6S _pdbx_nmr_refine.method 'torsion angle dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Bruker Biospin' collection TopSpin ? 1 'Bruker Biospin' processing TopSpin ? 2 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' processing NMRPipe ? 3 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' 'data analysis' NMRPipe ? 4 Goddard 'chemical shift assignment' Sparky ? 5 Goddard 'data analysis' Sparky ? 6 Goddard 'peak picking' Sparky ? 7 'Schwieters, Kuszewski, Tjandra and Clore' 'peak picking' 'X-PLOR NIH' ? 8 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' ? 9 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 10 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2N6S 'double helix' 2N6S 'a-form double helix' 2N6S 'mismatched base pair' 2N6S 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 35 1_555 -0.007 -0.294 0.051 3.448 -18.825 -6.833 1 A_G2:C35_A A 2 ? A 35 ? 19 1 1 A A 3 1_555 A U 34 1_555 -0.746 -0.226 -0.164 -3.358 -13.716 9.428 2 A_A3:U34_A A 3 ? A 34 ? 20 1 1 A A 4 1_555 A U 33 1_555 -0.388 -0.277 -0.295 -4.729 -16.184 15.832 3 A_A4:U33_A A 4 ? A 33 ? 20 1 1 A U 5 1_555 A A 32 1_555 0.054 -0.165 0.195 -1.315 -20.575 4.887 4 A_U5:A32_A A 5 ? A 32 ? 20 1 1 A U 6 1_555 A G 31 1_555 2.542 -0.436 -0.143 3.096 -14.354 11.017 5 A_U6:G31_A A 6 ? A 31 ? 28 1 1 A U 7 1_555 A A 30 1_555 0.018 0.129 -0.153 -0.875 -11.754 -1.797 6 A_U7:A30_A A 7 ? A 30 ? 20 1 1 A A 8 1_555 A U 29 1_555 0.077 0.024 -0.454 1.181 -14.269 0.593 7 A_A8:U29_A A 8 ? A 29 ? 20 1 1 A U 9 1_555 A A 28 1_555 0.075 -0.336 -0.849 1.743 -7.940 9.061 8 A_U9:A28_A A 9 ? A 28 ? 20 1 1 A G 10 1_555 A U 27 1_555 -2.155 -0.396 -0.649 -2.814 -8.732 8.869 9 A_G10:U27_A A 10 ? A 27 ? 28 1 1 A A 11 1_555 A U 26 1_555 -0.441 -0.041 -0.044 1.235 -19.562 -7.002 10 A_A11:U26_A A 11 ? A 26 ? 20 1 1 A G 12 1_555 A C 25 1_555 -0.461 -0.186 -0.534 -7.359 -16.925 5.385 11 A_G12:C25_A A 12 ? A 25 ? 19 1 1 A U 13 1_555 A A 24 1_555 0.056 -0.222 0.118 -15.160 8.654 4.620 12 A_U13:A24_A A 13 ? A 24 ? 20 1 1 A A 14 1_555 A U 23 1_555 -0.804 -0.191 -0.594 1.430 -3.237 2.180 13 A_A14:U23_A A 14 ? A 23 ? 20 1 1 A C 15 1_555 A A 22 1_555 3.557 -0.691 0.122 -5.262 -16.564 3.739 14 A_C15:A22_A A 15 ? A 22 ? ? 1 1 A C 16 1_555 A G 21 1_555 0.738 -0.514 -0.772 -5.896 8.477 -3.556 15 A_C16:G21_A A 16 ? A 21 ? 19 1 1 A U 17 1_555 A G 20 1_555 0.642 -4.844 -1.399 7.658 -10.059 -111.442 16 A_U17:G20_A A 17 ? A 20 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 35 1_555 A A 3 1_555 A U 34 1_555 1.602 -0.811 3.398 2.358 6.116 29.437 -2.848 -2.583 3.282 11.851 -4.570 30.142 1 AA_G2A3:U34C35_AA A 2 ? A 35 ? A 3 ? A 34 ? 1 A A 3 1_555 A U 34 1_555 A A 4 1_555 A U 33 1_555 -0.081 -0.890 3.467 -0.189 10.396 30.890 -3.436 0.111 3.017 18.860 0.342 32.553 2 AA_A3A4:U33U34_AA A 3 ? A 34 ? A 4 ? A 33 ? 1 A A 4 1_555 A U 33 1_555 A U 5 1_555 A A 32 1_555 0.073 -0.952 3.485 -1.655 1.688 33.038 -1.971 -0.423 3.426 2.963 2.905 33.120 3 AA_A4U5:A32U33_AA A 4 ? A 33 ? A 5 ? A 32 ? 1 A U 5 1_555 A A 32 1_555 A U 6 1_555 A G 31 1_555 -0.210 -0.612 3.224 5.267 6.290 36.879 -1.731 0.983 3.025 9.795 -8.201 37.749 4 AA_U5U6:G31A32_AA A 5 ? A 32 ? A 6 ? A 31 ? 1 A U 6 1_555 A G 31 1_555 A U 7 1_555 A A 30 1_555 -0.893 -1.103 3.375 1.243 9.965 23.057 -5.350 2.405 2.626 23.549 -2.938 25.122 5 AA_U6U7:A30G31_AA A 6 ? A 31 ? A 7 ? A 30 ? 1 A U 7 1_555 A A 30 1_555 A A 8 1_555 A U 29 1_555 0.765 -0.848 3.292 0.193 13.422 26.403 -4.367 -1.460 2.573 27.259 -0.393 29.565 6 AA_U7A8:U29A30_AA A 7 ? A 30 ? A 8 ? A 29 ? 1 A A 8 1_555 A U 29 1_555 A U 9 1_555 A A 28 1_555 0.519 -0.532 3.754 2.844 0.519 33.104 -1.030 -0.359 3.776 0.908 -4.979 33.227 7 AA_A8U9:A28U29_AA A 8 ? A 29 ? A 9 ? A 28 ? 1 A U 9 1_555 A A 28 1_555 A G 10 1_555 A U 27 1_555 0.079 -1.838 3.323 -5.915 22.287 17.975 -7.343 -1.138 0.653 50.795 13.481 29.162 8 AA_U9G10:U27A28_AA A 9 ? A 28 ? A 10 ? A 27 ? 1 A G 10 1_555 A U 27 1_555 A A 11 1_555 A U 26 1_555 -1.660 -0.438 3.457 -5.064 -2.815 38.449 -0.283 1.820 3.660 -4.245 7.636 38.866 9 AA_G10A11:U26U27_AA A 10 ? A 27 ? A 11 ? A 26 ? 1 A A 11 1_555 A U 26 1_555 A G 12 1_555 A C 25 1_555 1.547 -0.931 3.589 -0.519 6.910 32.216 -2.895 -2.823 3.299 12.275 0.923 32.934 10 AA_A11G12:C25U26_AA A 11 ? A 26 ? A 12 ? A 25 ? 1 A G 12 1_555 A C 25 1_555 A U 13 1_555 A A 24 1_555 -0.738 -1.343 3.498 -10.574 13.848 35.727 -3.657 -0.191 2.903 21.097 16.109 39.624 11 AA_G12U13:A24C25_AA A 12 ? A 25 ? A 13 ? A 24 ? 1 A U 13 1_555 A A 24 1_555 A A 14 1_555 A U 23 1_555 0.637 -1.055 3.258 5.692 2.027 25.951 -2.824 0.115 3.230 4.437 -12.461 26.633 12 AA_U13A14:U23A24_AA A 13 ? A 24 ? A 14 ? A 23 ? 1 A A 14 1_555 A U 23 1_555 A C 15 1_555 A A 22 1_555 0.155 -0.384 4.259 0.580 0.891 46.806 -0.580 -0.133 4.253 1.121 -0.730 46.818 13 AA_A14C15:A22U23_AA A 14 ? A 23 ? A 15 ? A 22 ? 1 A C 15 1_555 A A 22 1_555 A C 16 1_555 A G 21 1_555 -1.479 -1.158 4.069 -0.734 -9.612 17.613 2.669 3.789 4.181 -28.761 2.196 20.060 14 AA_C15C16:G21A22_AA A 15 ? A 22 ? A 16 ? A 21 ? 1 A C 16 1_555 A G 21 1_555 A U 17 1_555 A G 20 1_555 -0.437 -0.503 2.858 13.195 5.509 92.439 -0.434 0.512 2.767 3.797 -9.095 93.290 15 AA_C16U17:G20G21_AA A 16 ? A 21 ? A 17 ? A 20 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 800 Bruker AVANCE 1 'Bruker Avance' 600 Bruker AVANCE 2 'Bruker Avance' 900 Agilent INOVA 3 'Agilent INOVA' # _atom_sites.entry_id 2N6S _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P Q # loop_