data_2RPK # _entry.id 2RPK # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2RPK pdb_00002rpk 10.2210/pdb2rpk/pdb RCSB RCSB150130 ? ? WWPDB D_1000150130 ? ? # _pdbx_database_related.content_type unspecified _pdbx_database_related.db_id 2RO2 _pdbx_database_related.db_name PDB _pdbx_database_related.details . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2RPK _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2008-05-28 _pdbx_database_status.SG_entry . _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Gallego, J.' 1 'Dufour, D.' 2 'de la Pena, M.' 3 'Gago, S.' 4 'Flores, R.' 5 # _citation.id primary _citation.title ;Structure-function analysis of the ribozymes of chrysanthemum chlorotic mottle viroid: a loop-loop interaction motif conserved in most natural hammerheads ; _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 37 _citation.page_first 368 _citation.page_last 381 _citation.year 2009 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 19043070 _citation.pdbx_database_id_DOI 10.1093/nar/gkn918 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Dufour, D.' 1 ? primary 'de la Pena, M.' 2 ? primary 'Gago, S.' 3 ? primary 'Flores, R.' 4 ? primary 'Gallego, J.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3') ; _entity.formula_weight 6421.895 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAUCCAUGACAGGAUCCC _entity_poly.pdbx_seq_one_letter_code_can GGGAUCCAUGACAGGAUCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 U n 1 6 C n 1 7 C n 1 8 A n 1 9 U n 1 10 G n 1 11 A n 1 12 C n 1 13 A n 1 14 G n 1 15 G n 1 16 A n 1 17 U n 1 18 C n 1 19 C n 1 20 C n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2RPK _struct_ref.pdbx_db_accession 2RPK _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2RPK _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 20 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2RPK _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 20 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 20 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 2 2 2 '2D 1H-1H NOESY' 2 3 2 '2D 1H-1H TOCSY' 2 4 2 '2D 1H-1H COSY' 1 5 3 '2D 1H-15N HSQC' 2 6 4 '2D 1H-13C HSQC' 2 7 4 '3D 1H,13C HMQC-NOESY' 2 8 4 '3D HCCH-COSY' 2 9 4 '2D HCCH-TOCSY' 2 10 4 '3D HCP' 2 11 4 '3D 13C-ED-1H-31P HETCOR' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 12.4 6 ambient ? 281 K 2 12.4 6 ambient ? 296 K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system ;0.7 mM RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3'), 10 mM sodium phosphate, 0.1 mM EDTA, 90% H2O/10% D2O ; 1 '90% H2O/10% D2O' ;0.7 mM RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3'), 10 mM sodium phosphate, 0.1 mM EDTA, 100% D2O ; 2 '100% D2O' ;0.4 mM [U-100% 13C; U-100% 15N] RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3'), 10 mM sodium phosphate, 0.1 mM EDTA, 90% H2O/10% D2O ; 3 '90% H2O/10% D2O' ;0.4 mM [U-100% 13C; U-100% 15N] RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3'), 10 mM sodium phosphate, 0.1 mM EDTA, 100% D2O ; 4 '100% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AVANCE 1 'Bruker Avance' 600 Bruker AVANCE 2 'Bruker Avance' # _pdbx_nmr_refine.entry_id 2RPK _pdbx_nmr_refine.method 'simulated annealing and restrained energy minimization' _pdbx_nmr_refine.details 'minimized average structure of 33 converged conformers with the least restraint violation energy and total energy' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'minimized average structure of 33 converged conformers with the least restraint violation energy and total energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 60 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2RPK _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2RPK _pdbx_nmr_representative.selection_criteria 'minimized average structure' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Bruker Biospin' collection TopSpin 1.3 1 'Bruker Biospin' processing TopSpin 1.3 2 Goddard 'chemical shift assignment' Sparky 3.110 3 Goddard 'data analysis' Sparky 3.110 4 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, and Kollm' 'structure solution' Amber 8.0 5 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, and Kollm' refinement Amber 8.0 6 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2RPK _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2RPK _struct.title 'Solution Structure of Domain II of the Positive Polarity CCHMVD Hammerhead Ribozyme' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details 'minimized average' # _struct_keywords.entry_id 2RPK _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'HAMMERHEAD RIBOZYME, VIROID, CCHMVD, HEXALOOP, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 1 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 1 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 1 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 2 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 2 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 2 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 3 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 3 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 3 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 17 N3 ? ? A A 4 A U 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 17 O4 ? ? A A 4 A U 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 16 N1 ? ? A U 5 A A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 16 N6 ? ? A U 5 A A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 15 N1 ? ? A C 6 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 15 O6 ? ? A C 6 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 15 N2 ? ? A C 6 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 7 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 7 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 7 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 9 O2 ? ? ? 1_555 A A 13 N6 ? ? A U 9 A A 13 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2RPK _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 C 7 7 7 C C A . n A 1 8 A 8 8 8 A A A . n A 1 9 U 9 9 9 U U A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 C 12 12 12 C C A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2008-12-30 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_nmr_spectrometer 4 3 'Structure model' pdbx_struct_assembly 5 3 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' 4 3 'Structure model' '_pdbx_nmr_spectrometer.model' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id ;RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3') ; 0.7 mM ? 1 'sodium phosphate' 10 mM ? 1 EDTA 0.1 mM ? 1 ;RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3') ; 0.7 mM ? 2 'sodium phosphate' 10 mM ? 2 EDTA 0.1 mM ? 2 ;RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3') ; 0.4 mM '[U-100% 13C; U-100% 15N]' 3 'sodium phosphate' 10 mM ? 3 EDTA 0.1 mM ? 3 ;RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP*AP*CP*AP*GP*GP*AP*UP*CP*CP*C)-3') ; 0.4 mM '[U-100% 13C; U-100% 15N]' 4 'sodium phosphate' 10 mM ? 4 EDTA 0.1 mM ? 4 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C4 A A 4 ? ? C5 A A 4 ? ? C6 A A 4 ? ? 113.98 117.00 -3.02 0.50 N 2 1 C5 A A 4 ? ? C6 A A 4 ? ? N1 A A 4 ? ? 121.01 117.70 3.31 0.50 N 3 1 N1 A A 4 ? ? C6 A A 4 ? ? N6 A A 4 ? ? 113.69 118.60 -4.91 0.60 N 4 1 N3 A C 6 ? ? C2 A C 6 ? ? O2 A C 6 ? ? 117.04 121.90 -4.86 0.70 N 5 1 N3 A C 7 ? ? C2 A C 7 ? ? O2 A C 7 ? ? 116.92 121.90 -4.98 0.70 N 6 1 C4 A A 8 ? ? C5 A A 8 ? ? C6 A A 8 ? ? 113.51 117.00 -3.49 0.50 N 7 1 C5 A A 8 ? ? C6 A A 8 ? ? N1 A A 8 ? ? 121.31 117.70 3.61 0.50 N 8 1 N1 A A 8 ? ? C6 A A 8 ? ? N6 A A 8 ? ? 113.04 118.60 -5.56 0.60 N 9 1 "O4'" A G 10 ? ? "C1'" A G 10 ? ? N9 A G 10 ? ? 113.32 108.50 4.82 0.70 N 10 1 C5 A A 11 ? ? C6 A A 11 ? ? N1 A A 11 ? ? 121.23 117.70 3.53 0.50 N 11 1 N1 A A 11 ? ? C6 A A 11 ? ? N6 A A 11 ? ? 113.51 118.60 -5.09 0.60 N 12 1 "O4'" A C 12 ? ? "C1'" A C 12 ? ? N1 A C 12 ? ? 112.93 108.50 4.43 0.70 N 13 1 N3 A C 12 ? ? C2 A C 12 ? ? O2 A C 12 ? ? 117.33 121.90 -4.57 0.70 N 14 1 C4 A A 13 ? ? C5 A A 13 ? ? C6 A A 13 ? ? 113.87 117.00 -3.13 0.50 N 15 1 C5 A A 13 ? ? C6 A A 13 ? ? N1 A A 13 ? ? 121.60 117.70 3.90 0.50 N 16 1 N1 A A 13 ? ? C6 A A 13 ? ? N6 A A 13 ? ? 113.59 118.60 -5.01 0.60 N 17 1 C4 A A 16 ? ? C5 A A 16 ? ? C6 A A 16 ? ? 113.84 117.00 -3.16 0.50 N 18 1 C5 A A 16 ? ? C6 A A 16 ? ? N1 A A 16 ? ? 121.11 117.70 3.41 0.50 N 19 1 N1 A A 16 ? ? C6 A A 16 ? ? N6 A A 16 ? ? 113.57 118.60 -5.03 0.60 N 20 1 N3 A C 18 ? ? C2 A C 18 ? ? O2 A C 18 ? ? 116.98 121.90 -4.92 0.70 N 21 1 N3 A C 19 ? ? C2 A C 19 ? ? O2 A C 19 ? ? 116.87 121.90 -5.03 0.70 N 22 1 N3 A C 20 ? ? C2 A C 20 ? ? O2 A C 20 ? ? 116.90 121.90 -5.00 0.70 N # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 1 _pdbx_validate_planes.auth_comp_id A _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 8 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.058 _pdbx_validate_planes.type 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2RPK 'double helix' 2RPK 'a-form double helix' 2RPK 'hairpin loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 20 1_555 -0.506 -0.098 -0.280 -8.674 -5.320 0.057 1 A_G1:C20_A A 1 ? A 20 ? 19 1 1 A G 2 1_555 A C 19 1_555 -0.400 -0.083 -0.110 -4.131 -7.294 0.278 2 A_G2:C19_A A 2 ? A 19 ? 19 1 1 A G 3 1_555 A C 18 1_555 -0.433 -0.097 0.051 1.134 -7.556 0.418 3 A_G3:C18_A A 3 ? A 18 ? 19 1 1 A A 4 1_555 A U 17 1_555 -0.009 0.006 -0.156 1.229 -9.558 1.394 4 A_A4:U17_A A 4 ? A 17 ? 20 1 1 A U 5 1_555 A A 16 1_555 -0.058 0.002 -0.329 4.302 -10.849 0.944 5 A_U5:A16_A A 5 ? A 16 ? 20 1 1 A C 6 1_555 A G 15 1_555 0.499 -0.106 0.020 -0.213 -8.273 1.401 6 A_C6:G15_A A 6 ? A 15 ? 19 1 1 A C 7 1_555 A G 14 1_555 0.494 -0.104 0.015 5.587 -7.044 0.568 7 A_C7:G14_A A 7 ? A 14 ? 19 1 1 A U 9 1_555 A A 13 1_555 5.594 -2.470 2.376 -19.821 27.733 35.867 8 A_U9:A13_A A 9 ? A 13 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 20 1_555 A G 2 1_555 A C 19 1_555 -0.039 -1.946 3.216 -1.329 6.531 29.162 -5.018 -0.179 2.725 12.762 2.597 29.897 1 AA_G1G2:C19C20_AA A 1 ? A 20 ? A 2 ? A 19 ? 1 A G 2 1_555 A C 19 1_555 A G 3 1_555 A C 18 1_555 -0.109 -2.124 3.113 -2.614 7.154 29.109 -5.381 -0.259 2.530 13.935 5.091 30.068 2 AA_G2G3:C18C19_AA A 2 ? A 19 ? A 3 ? A 18 ? 1 A G 3 1_555 A C 18 1_555 A A 4 1_555 A U 17 1_555 -0.264 -2.122 3.234 -1.124 12.169 30.944 -5.492 0.297 2.268 21.774 2.012 33.215 3 AA_G3A4:U17C18_AA A 3 ? A 18 ? A 4 ? A 17 ? 1 A A 4 1_555 A U 17 1_555 A U 5 1_555 A A 16 1_555 -0.238 -1.979 3.239 0.018 8.143 28.201 -5.500 0.473 2.578 16.287 -0.037 29.330 4 AA_A4U5:A16U17_AA A 4 ? A 17 ? A 5 ? A 16 ? 1 A U 5 1_555 A A 16 1_555 A C 6 1_555 A G 15 1_555 0.184 -2.089 3.354 -1.284 15.468 31.117 -5.598 -0.482 2.102 26.843 2.228 34.687 5 AA_U5C6:G15A16_AA A 5 ? A 16 ? A 6 ? A 15 ? 1 A C 6 1_555 A G 15 1_555 A C 7 1_555 A G 14 1_555 0.264 -2.133 3.066 1.893 8.912 30.518 -5.276 -0.188 2.376 16.476 -3.499 31.818 6 AA_C6C7:G14G15_AA A 6 ? A 15 ? A 7 ? A 14 ? 1 A C 7 1_555 A G 14 1_555 A U 9 1_555 A A 13 1_555 0.046 -2.657 6.254 6.513 18.421 47.794 -5.314 0.743 4.950 21.710 -7.675 51.415 7 AA_C7U9:A13G14_AA A 7 ? A 14 ? A 9 ? A 13 ? #