data_2TPK # _entry.id 2TPK # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2TPK pdb_00002tpk 10.2210/pdb2tpk/pdb RCSB RCSB008047 ? ? WWPDB D_1000008047 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1998-11-04 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2011-12-07 5 'Structure model' 1 4 2023-12-27 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 5 'Structure model' 'Data collection' 5 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 5 'Structure model' chem_comp_atom 2 5 'Structure model' chem_comp_bond 3 5 'Structure model' database_2 4 5 'Structure model' pdbx_nmr_software # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 5 'Structure model' '_database_2.pdbx_DOI' 2 5 'Structure model' '_database_2.pdbx_database_accession' 3 5 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2TPK _pdbx_database_status.recvd_initial_deposition_date 1998-10-28 _pdbx_database_status.deposit_site BNL _pdbx_database_status.process_site RCSB _pdbx_database_status.SG_entry . _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Holland, J.A.' 1 'Hansen, M.R.' 2 'Du, Z.' 3 'Hoffman, D.W.' 4 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary ;An examination of coaxial stacking of helical stems in a pseudoknot motif: the gene 32 messenger RNA pseudoknot of bacteriophage T2. ; Rna 5 257 271 1999 RNARFU UK 1355-8382 2122 ? 10024177 10.1017/S1355838299981360 1 ;An NMR and Mutational Study of the Pseudoknot within the Gene 32 Mrna of Bacteriophage T2: Insights Into a Family of Structurally Related RNA Pseudoknots ; 'Nucleic Acids Res.' 25 1130 ? 1997 NARHAD UK 0305-1048 0389 ? ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Holland, J.A.' 1 ? primary 'Hansen, M.R.' 2 ? primary 'Du, Z.' 3 ? primary 'Hoffman, D.W.' 4 ? 1 'Du, Z.' 5 ? 1 'Hoffman, D.W.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (MRNA PSEUDOKNOT)' _entity.formula_weight 11509.891 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GCUGACCAGCUAUGAGGUCAUACAUCGUCAUAGCAC _entity_poly.pdbx_seq_one_letter_code_can GCUGACCAGCUAUGAGGUCAUACAUCGUCAUAGCAC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 C n 1 3 U n 1 4 G n 1 5 A n 1 6 C n 1 7 C n 1 8 A n 1 9 G n 1 10 C n 1 11 U n 1 12 A n 1 13 U n 1 14 G n 1 15 A n 1 16 G n 1 17 G n 1 18 U n 1 19 C n 1 20 A n 1 21 U n 1 22 A n 1 23 C n 1 24 A n 1 25 U n 1 26 C n 1 27 G n 1 28 U n 1 29 C n 1 30 A n 1 31 U n 1 32 A n 1 33 G n 1 34 C n 1 35 A n 1 36 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'RNA WAS CHEMICALLY SYNTHESIZED FROM GENE 32 OF BACTERIOPHAGE T2.' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 C 2 2 2 C C A . n A 1 3 U 3 3 3 U U A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 C 6 6 6 C C A . n A 1 7 C 7 7 7 C C A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 C 23 23 23 C C A . n A 1 24 A 24 24 24 A A A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 U 28 28 28 U U A . n A 1 29 C 29 29 29 C C A . n A 1 30 A 30 30 30 A A A . n A 1 31 U 31 31 31 U U A . n A 1 32 A 32 32 32 A A A . n A 1 33 G 33 33 33 G G A . n A 1 34 C 34 34 34 C C A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n # _cell.entry_id 2TPK _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2TPK _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 2TPK _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 2TPK _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2TPK _struct.title ;AN INVESTIGATION OF THE STRUCTURE OF THE PSEUDOKNOT WITHIN THE GENE 32 MESSENGER RNA OF BACTERIOPHAGE T2 USING HETERONUCLEAR NMR METHODS ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2TPK _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'PSEUDOKNOT, T2, RNA, RIBONUCLEIC ACID' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2TPK _struct_ref.pdbx_db_accession 2TPK _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2TPK _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 36 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2TPK _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 36 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 36 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 20 N1 ? ? A U 3 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 20 N6 ? ? A U 3 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A U 3 O2 ? ? ? 1_555 A A 22 N6 ? ? A U 3 A A 22 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog4 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 4 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 4 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 4 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 18 N3 ? ? A A 5 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 18 O4 ? ? A A 5 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 6 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 6 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 6 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 7 O2 ? ? ? 1_555 A C 26 N4 ? ? A C 7 A C 26 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 11 O4 ? ? A A 8 A U 11 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog17 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 10 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 10 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 10 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 32 N1 ? ? A U 11 A A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 32 N6 ? ? A U 11 A A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 31 N3 ? ? A A 12 A U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 31 O4 ? ? A A 12 A U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 13 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 13 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 14 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 14 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 14 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 15 N1 ? ? ? 1_555 A U 28 N3 ? ? A A 15 A U 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 15 N6 ? ? ? 1_555 A U 28 O4 ? ? A A 15 A U 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 17 N2 ? ? ? 1_555 A U 25 O4 ? ? A G 17 A U 25 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog35 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 26 N3 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog36 hydrog ? ? A U 18 O2 ? ? ? 1_555 A A 24 N6 ? ? A U 18 A A 24 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 "HO2'" _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 A _pdbx_validate_close_contact.auth_seq_id_1 22 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 "O5'" _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 C _pdbx_validate_close_contact.auth_seq_id_2 23 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.37 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.73 113.10 4.63 0.50 N 2 1 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.67 106.40 -2.73 0.40 N 3 1 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.75 113.10 4.65 0.50 N 4 1 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.78 106.40 -2.62 0.40 N 5 1 N7 A A 5 ? ? C8 A A 5 ? ? N9 A A 5 ? ? 117.62 113.80 3.82 0.50 N 6 1 "C3'" A A 8 ? ? "C2'" A A 8 ? ? "C1'" A A 8 ? ? 106.38 101.50 4.88 0.80 N 7 1 N7 A A 8 ? ? C8 A A 8 ? ? N9 A A 8 ? ? 117.45 113.80 3.65 0.50 N 8 1 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.56 113.10 4.46 0.50 N 9 1 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.94 106.40 -2.46 0.40 N 10 1 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.51 113.80 3.71 0.50 N 11 1 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.71 113.10 4.61 0.50 N 12 1 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.70 106.40 -2.70 0.40 N 13 1 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.42 113.80 3.62 0.50 N 14 1 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.69 113.10 4.59 0.50 N 15 1 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.86 106.40 -2.54 0.40 N 16 1 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.70 113.10 4.60 0.50 N 17 1 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.86 106.40 -2.54 0.40 N 18 1 N7 A A 20 ? ? C8 A A 20 ? ? N9 A A 20 ? ? 117.58 113.80 3.78 0.50 N 19 1 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.56 113.80 3.76 0.50 N 20 1 N7 A A 24 ? ? C8 A A 24 ? ? N9 A A 24 ? ? 117.56 113.80 3.76 0.50 N 21 1 "O4'" A G 27 ? ? "C1'" A G 27 ? ? N9 A G 27 ? ? 113.00 108.50 4.50 0.70 N 22 1 N7 A G 27 ? ? C8 A G 27 ? ? N9 A G 27 ? ? 117.43 113.10 4.33 0.50 N 23 1 C8 A G 27 ? ? N9 A G 27 ? ? C4 A G 27 ? ? 103.92 106.40 -2.48 0.40 N 24 1 N7 A A 30 ? ? C8 A A 30 ? ? N9 A A 30 ? ? 117.60 113.80 3.80 0.50 N 25 1 N7 A A 32 ? ? C8 A A 32 ? ? N9 A A 32 ? ? 117.64 113.80 3.84 0.50 N 26 1 N7 A G 33 ? ? C8 A G 33 ? ? N9 A G 33 ? ? 117.80 113.10 4.70 0.50 N 27 1 C8 A G 33 ? ? N9 A G 33 ? ? C4 A G 33 ? ? 103.65 106.40 -2.75 0.40 N 28 1 N7 A A 35 ? ? C8 A A 35 ? ? N9 A A 35 ? ? 117.56 113.80 3.76 0.50 N # _pdbx_nmr_ensemble.entry_id 2TPK _pdbx_nmr_ensemble.conformers_calculated_total_number 19 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 293 _pdbx_nmr_exptl_sample_conditions.pressure ? _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength ? _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 NOESY 1 2 1 DQFCOSY 1 3 1 TOCSY 1 4 1 NOESY-TOCSY 1 5 1 CT-HSQC 1 6 1 HCCH-COSY 1 7 1 NOESY-HMQC 1 8 1 HMQC 1 # _pdbx_nmr_details.entry_id 2TPK _pdbx_nmr_details.text ;THE STRUCTURE WAS DETERMINED USING NMR SPECTROSCOPY ON 13C,15N-LABELED AND SELECTIVELY DEUTERATED T2 PSEUDOKNOT SAMPLE ; # _pdbx_nmr_refine.entry_id 2TPK _pdbx_nmr_refine.method 'DISTANCE GEOMETRY-SIMULATED ANNEALING AND ENERGY MINIZATION PROTOCOLS' _pdbx_nmr_refine.details 'REFINEMNET DETAILS CAN BE FOUND IN THE JRNL CITATION ABOVE.' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR 3.1 BRUNGER 1 'structure solution' Felix ? ? 2 'structure solution' XPLOR 3.1 BRUNGER 3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2TPK 'double helix' 2TPK 'a-form double helix' 2TPK 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A U 3 1_555 A A 20 1_555 0.018 -0.081 -0.062 0.780 12.950 -5.460 1 A_U3:A20_A A 3 ? A 20 ? 20 1 1 A G 4 1_555 A C 19 1_555 -0.185 -0.230 -0.116 -0.561 9.439 -5.915 2 A_G4:C19_A A 4 ? A 19 ? 19 1 1 A A 5 1_555 A U 18 1_555 -0.028 -0.092 -0.120 -1.277 11.031 -5.954 3 A_A5:U18_A A 5 ? A 18 ? 20 1 1 A C 6 1_555 A G 17 1_555 0.240 -0.248 -0.126 1.371 12.449 -6.554 4 A_C6:G17_A A 6 ? A 17 ? 19 1 1 A C 7 1_555 A G 16 1_555 0.446 -0.156 -0.288 18.353 0.743 -2.288 5 A_C7:G16_A A 7 ? A 16 ? 19 1 1 A U 28 1_555 A A 15 1_555 0.130 -0.160 -0.473 13.490 -15.948 1.437 6 A_U28:A15_A A 28 ? A 15 ? 20 1 1 A C 29 1_555 A G 14 1_555 0.220 -0.240 -0.208 0.496 10.978 -6.302 7 A_C29:G14_A A 29 ? A 14 ? 19 1 1 A A 30 1_555 A U 13 1_555 0.035 -0.071 -0.124 -0.625 11.338 -5.646 8 A_A30:U13_A A 30 ? A 13 ? 20 1 1 A U 31 1_555 A A 12 1_555 0.006 -0.078 -0.113 1.417 10.556 -5.869 9 A_U31:A12_A A 31 ? A 12 ? 20 1 1 A A 32 1_555 A U 11 1_555 -0.041 -0.089 -0.148 -1.442 10.965 -5.784 10 A_A32:U11_A A 32 ? A 11 ? 20 1 1 A G 33 1_555 A C 10 1_555 -0.274 -0.265 -0.225 0.844 11.454 -6.336 11 A_G33:C10_A A 33 ? A 10 ? 19 1 1 A C 34 1_555 A G 9 1_555 0.420 -0.265 -0.391 -3.306 1.399 -1.340 12 A_C34:G9_A A 34 ? A 9 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A U 3 1_555 A A 20 1_555 A G 4 1_555 A C 19 1_555 0.020 -1.736 3.497 0.679 10.132 29.598 -5.114 0.090 2.766 19.137 -1.282 31.255 1 AA_U3G4:C19A20_AA A 3 ? A 20 ? A 4 ? A 19 ? 1 A G 4 1_555 A C 19 1_555 A A 5 1_555 A U 18 1_555 0.038 -1.627 3.465 -0.140 10.311 32.089 -4.467 -0.088 2.822 18.079 0.245 33.663 2 AA_G4A5:U18C19_AA A 4 ? A 19 ? A 5 ? A 18 ? 1 A A 5 1_555 A U 18 1_555 A C 6 1_555 A G 17 1_555 -0.036 -1.630 3.372 0.181 8.210 32.415 -4.156 0.092 2.884 14.420 -0.318 33.412 3 AA_A5C6:G17U18_AA A 5 ? A 18 ? A 6 ? A 17 ? 1 A C 6 1_555 A G 17 1_555 A C 7 1_555 A G 16 1_555 0.821 -1.285 3.423 10.159 17.786 33.427 -4.059 -0.007 2.584 27.907 -15.941 39.050 4 AA_C6C7:G16G17_AA A 6 ? A 17 ? A 7 ? A 16 ? 1 A C 7 1_555 A G 16 1_555 A U 28 1_555 A A 15 1_555 -1.952 -0.430 3.076 -8.164 9.919 41.124 -1.552 1.868 3.207 13.723 11.295 43.001 5 AA_C7U28:A15G16_AA A 7 ? A 16 ? A 28 ? A 15 ? 1 A U 28 1_555 A A 15 1_555 A C 29 1_555 A G 14 1_555 -1.879 -1.753 3.655 -5.343 11.343 30.294 -5.215 2.343 3.096 20.629 9.718 32.730 6 AA_U28C29:G14A15_AA A 28 ? A 15 ? A 29 ? A 14 ? 1 A C 29 1_555 A G 14 1_555 A A 30 1_555 A U 13 1_555 -0.016 -1.698 3.503 -0.697 11.122 29.960 -5.071 -0.095 2.715 20.637 1.292 31.921 7 AA_C29A30:U13G14_AA A 29 ? A 14 ? A 30 ? A 13 ? 1 A A 30 1_555 A U 13 1_555 A U 31 1_555 A A 12 1_555 -0.014 -1.674 3.372 0.090 8.308 31.075 -4.461 0.041 2.841 15.170 -0.165 32.140 8 AA_A30U31:A12U13_AA A 30 ? A 13 ? A 31 ? A 12 ? 1 A U 31 1_555 A A 12 1_555 A A 32 1_555 A U 11 1_555 0.009 -1.676 3.551 0.069 11.623 30.722 -4.961 -0.004 2.752 21.017 -0.125 32.798 9 AA_U31A32:U11A12_AA A 31 ? A 12 ? A 32 ? A 11 ? 1 A A 32 1_555 A U 11 1_555 A G 33 1_555 A C 10 1_555 -0.013 -1.693 3.393 -0.017 9.286 29.705 -4.869 0.020 2.751 17.580 0.032 31.091 10 AA_A32G33:C10U11_AA A 32 ? A 11 ? A 33 ? A 10 ? 1 A G 33 1_555 A C 10 1_555 A C 34 1_555 A G 9 1_555 1.389 -2.191 4.169 3.401 -3.003 29.685 -3.408 -1.750 4.491 -5.818 -6.590 30.022 11 AA_G33C34:G9C10_AA A 33 ? A 10 ? A 34 ? A 9 ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model ? _pdbx_nmr_spectrometer.manufacturer Varian _pdbx_nmr_spectrometer.field_strength 500 _pdbx_nmr_spectrometer.type ? # _atom_sites.entry_id 2TPK _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_