data_2KF8 # _entry.id 2KF8 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2KF8 pdb_00002kf8 10.2210/pdb2kf8/pdb RCSB RCSB101047 ? ? WWPDB D_1000101047 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2009-03-24 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2024-05-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' chem_comp_atom 2 3 'Structure model' chem_comp_bond 3 3 'Structure model' database_2 4 3 'Structure model' pdbx_nmr_software 5 3 'Structure model' pdbx_nmr_spectrometer # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' 4 3 'Structure model' '_pdbx_nmr_spectrometer.model' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2KF8 _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2009-02-12 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.content_type _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details unspecified 143D PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF NA' unspecified 1K8P PDB 'HUMAN TELOMERE DNA CRYSTAL STRUCTURE IN THE PRESENCE OF K' unspecified 2GKU PDB 'END-MODIFIED HUMAN TELOMERE DNA CRYSTAL STRUCTURE IN THE PRESENCE OF K' unspecified 2AQY PDB '3 REPEATS OF HUMAN TELOMERE DNA SOLUTION STRUCTURE' unspecified 2JSK PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS 16BRG FORM 1' unspecified 2JSL PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS NATURAL FORM 2' unspecified 2JSM PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS NATURAL FORM 1' unspecified 2JSQ PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS FORM 2 15BRG' unspecified 2KF7 PDB ;STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN K+ SOLUTION (WITH G7-TO-BRG SUBSTITUTION) ; # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lim, K.W.' 1 'Amrane, S.' 2 'Bouaziz, S.' 3 'Xu, W.' 4 'Mu, Y.' 5 'Patel, D.J.' 6 'Luu, K.N.' 7 'Phan, A.T.' 8 # _citation.id primary _citation.title 'Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers' _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_volume 131 _citation.page_first 4301 _citation.page_last 4309 _citation.year 2009 _citation.journal_id_ASTM JACSAT _citation.country US _citation.journal_id_ISSN 0002-7863 _citation.journal_id_CSD 0004 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 19271707 _citation.pdbx_database_id_DOI 10.1021/ja807503g # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lim, K.W.' 1 ? primary 'Amrane, S.' 2 ? primary 'Bouaziz, S.' 3 ? primary 'Xu, W.' 4 ? primary 'Mu, Y.' 5 ? primary 'Patel, D.J.' 6 ? primary 'Luu, K.N.' 7 ? primary 'Phan, A.T.' 8 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'HUMAN TELOMERE DNA' _entity.formula_weight 6974.483 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG) (DG)(DT) ; _entity_poly.pdbx_seq_one_letter_code_can GGGTTAGGGTTAGGGTTAGGGT _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DG n 1 4 DT n 1 5 DT n 1 6 DA n 1 7 DG n 1 8 DG n 1 9 DG n 1 10 DT n 1 11 DT n 1 12 DA n 1 13 DG n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DT n 1 18 DA n 1 19 DG n 1 20 DG n 1 21 DG n 1 22 DT n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'Nucleotide synthesis' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DT 4 4 4 DT DT A . n A 1 5 DT 5 5 5 DT DT A . n A 1 6 DA 6 6 6 DA DA A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DT 17 17 17 DT DT A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DT 22 22 22 DT DT A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2KF8 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2KF8 _struct.title 'Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution' _struct.pdbx_model_details 'lowest energy, model 1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2KF8 _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'anticancer targets, human telomere, intramolecular G-quadruplexes, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_code 2KF8 _struct_ref.db_name PDB _struct_ref.entity_id 1 _struct_ref.pdbx_db_accession 2KF8 _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_seq_one_letter_code GGGTTAGGGTTAGGGTTAGGGT _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2KF8 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2KF8 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 8 N2 ? ? A DG 1 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 8 N1 ? ? A DG 1 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 14 O6 ? ? A DG 1 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 14 N7 ? ? A DG 1 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DG 7 O6 ? ? A DG 2 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DG 7 N7 ? ? A DG 2 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 15 N2 ? ? A DG 2 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 15 N1 ? ? A DG 2 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DA 6 N7 ? ? A DG 3 A DA 6 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog10 hydrog ? ? A DG 3 N3 ? ? ? 1_555 A DA 6 N6 ? ? A DG 3 A DA 6 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog11 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DA 18 N1 ? ? A DG 3 A DA 18 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog12 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DA 18 N6 ? ? A DG 3 A DA 18 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A DG 7 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 7 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 7 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 7 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 8 N7 ? ? ? 1_555 A DG 20 N2 ? ? A DG 8 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 8 O6 ? ? ? 1_555 A DG 20 N1 ? ? A DG 8 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 13 O6 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog18 hydrog ? ? A DG 9 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 9 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 9 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 9 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DT 11 N3 ? ? ? 1_555 A DT 22 O4 ? ? A DT 11 A DT 22 1_555 ? ? ? ? ? ? TYPE_12_PAIR ? ? ? hydrog21 hydrog ? ? A DT 11 O4 ? ? ? 1_555 A DT 22 N3 ? ? A DT 11 A DT 22 1_555 ? ? ? ? ? ? TYPE_12_PAIR ? ? ? hydrog22 hydrog ? ? A DG 14 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 14 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O4 A DT 11 ? ? H3 A DT 22 ? ? 1.47 2 4 "O5'" A DG 1 ? ? H21 A DG 13 ? ? 1.49 3 5 OP2 A DG 3 ? ? H3 A DT 10 ? ? 1.48 4 5 O4 A DT 11 ? ? H3 A DT 22 ? ? 1.59 5 6 "O5'" A DG 1 ? ? H21 A DG 13 ? ? 1.41 6 7 H3 A DT 11 ? ? O2 A DT 22 ? ? 1.48 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'all calculated structures submitted' _pdbx_nmr_ensemble.conformers_calculated_total_number 10 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2KF8 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2KF8 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system ;0.5-2.5mM DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-1, 70mM potassium chloride-2, 20mM potassium phosphate-3, 90% H2O/10% D2O ; 1 '90% H2O/10% D2O' ;0.5-2.5mM DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-4, 70mM potassium chloride-5, 20mM potassium phosphate-6, 100% D2O ; 2 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id ;DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-1 ; 0.5 ? mM ? 1 'potassium chloride-2' 70 ? mM ? 1 'potassium phosphate-3' 20 ? mM ? 1 ;DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-4 ; 0.5 ? mM ? 2 'potassium chloride-5' 70 ? mM ? 2 'potassium phosphate-6' 20 ? mM ? 2 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength ? _pdbx_nmr_exptl_sample_conditions.pH 7 _pdbx_nmr_exptl_sample_conditions.pressure ? _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 2 '2D 1H-13C HSQC' 1 2 2 '2D 1H-1H TOCSY' 1 3 2 '2D 1H-1H COSY' 1 4 1 '2D 1H-1H NOESY' 1 5 2 '2D 1H-1H NOESY' # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2KF8 _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count 42 _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count 8 _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count 4 _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_other-angle_constraints_total_count 8 _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count 0 _pdbx_nmr_constraints.NOE_constraints_total ? _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count ? _pdbx_nmr_constraints.NOE_long_range_total_count ? _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count ? _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # _pdbx_nmr_refine.entry_id 2KF8 _pdbx_nmr_refine.method 'molecular dynamics' _pdbx_nmr_refine.details ;This natural sequence exhibits the same conformation as the 7BRG-substituted sequence, which has a much cleaner NMR spectrum. 10 relaxation matrix intensity-refined structures of the 7BRG form with the lowest energy were taken, the bromine atoms were replaced with hydrogen atoms, and the structures were subsequently subjected to distance-retrained molecular dynamics refinement. ; _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Felix NMR, Inc.' 'peak picking' Felix 2007 1 'Bruker Biospin' processing TopSpin . 2 'Schwieters, Kuszewski, Tjandra, Clore' 'structure solution' 'X-PLOR NIH' 2.21 3 'Schwieters, Kuszewski, Tjandra, Clore' refinement 'X-PLOR NIH' 2.21 4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DG OP3 O N N 37 DG P P N N 38 DG OP1 O N N 39 DG OP2 O N N 40 DG "O5'" O N N 41 DG "C5'" C N N 42 DG "C4'" C N R 43 DG "O4'" O N N 44 DG "C3'" C N S 45 DG "O3'" O N N 46 DG "C2'" C N N 47 DG "C1'" C N R 48 DG N9 N Y N 49 DG C8 C Y N 50 DG N7 N Y N 51 DG C5 C Y N 52 DG C6 C N N 53 DG O6 O N N 54 DG N1 N N N 55 DG C2 C N N 56 DG N2 N N N 57 DG N3 N N N 58 DG C4 C Y N 59 DG HOP3 H N N 60 DG HOP2 H N N 61 DG "H5'" H N N 62 DG "H5''" H N N 63 DG "H4'" H N N 64 DG "H3'" H N N 65 DG "HO3'" H N N 66 DG "H2'" H N N 67 DG "H2''" H N N 68 DG "H1'" H N N 69 DG H8 H N N 70 DG H1 H N N 71 DG H21 H N N 72 DG H22 H N N 73 DT OP3 O N N 74 DT P P N N 75 DT OP1 O N N 76 DT OP2 O N N 77 DT "O5'" O N N 78 DT "C5'" C N N 79 DT "C4'" C N R 80 DT "O4'" O N N 81 DT "C3'" C N S 82 DT "O3'" O N N 83 DT "C2'" C N N 84 DT "C1'" C N R 85 DT N1 N N N 86 DT C2 C N N 87 DT O2 O N N 88 DT N3 N N N 89 DT C4 C N N 90 DT O4 O N N 91 DT C5 C N N 92 DT C7 C N N 93 DT C6 C N N 94 DT HOP3 H N N 95 DT HOP2 H N N 96 DT "H5'" H N N 97 DT "H5''" H N N 98 DT "H4'" H N N 99 DT "H3'" H N N 100 DT "HO3'" H N N 101 DT "H2'" H N N 102 DT "H2''" H N N 103 DT "H1'" H N N 104 DT H3 H N N 105 DT H71 H N N 106 DT H72 H N N 107 DT H73 H N N 108 DT H6 H N N 109 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DG OP3 P sing N N 39 DG OP3 HOP3 sing N N 40 DG P OP1 doub N N 41 DG P OP2 sing N N 42 DG P "O5'" sing N N 43 DG OP2 HOP2 sing N N 44 DG "O5'" "C5'" sing N N 45 DG "C5'" "C4'" sing N N 46 DG "C5'" "H5'" sing N N 47 DG "C5'" "H5''" sing N N 48 DG "C4'" "O4'" sing N N 49 DG "C4'" "C3'" sing N N 50 DG "C4'" "H4'" sing N N 51 DG "O4'" "C1'" sing N N 52 DG "C3'" "O3'" sing N N 53 DG "C3'" "C2'" sing N N 54 DG "C3'" "H3'" sing N N 55 DG "O3'" "HO3'" sing N N 56 DG "C2'" "C1'" sing N N 57 DG "C2'" "H2'" sing N N 58 DG "C2'" "H2''" sing N N 59 DG "C1'" N9 sing N N 60 DG "C1'" "H1'" sing N N 61 DG N9 C8 sing Y N 62 DG N9 C4 sing Y N 63 DG C8 N7 doub Y N 64 DG C8 H8 sing N N 65 DG N7 C5 sing Y N 66 DG C5 C6 sing N N 67 DG C5 C4 doub Y N 68 DG C6 O6 doub N N 69 DG C6 N1 sing N N 70 DG N1 C2 sing N N 71 DG N1 H1 sing N N 72 DG C2 N2 sing N N 73 DG C2 N3 doub N N 74 DG N2 H21 sing N N 75 DG N2 H22 sing N N 76 DG N3 C4 sing N N 77 DT OP3 P sing N N 78 DT OP3 HOP3 sing N N 79 DT P OP1 doub N N 80 DT P OP2 sing N N 81 DT P "O5'" sing N N 82 DT OP2 HOP2 sing N N 83 DT "O5'" "C5'" sing N N 84 DT "C5'" "C4'" sing N N 85 DT "C5'" "H5'" sing N N 86 DT "C5'" "H5''" sing N N 87 DT "C4'" "O4'" sing N N 88 DT "C4'" "C3'" sing N N 89 DT "C4'" "H4'" sing N N 90 DT "O4'" "C1'" sing N N 91 DT "C3'" "O3'" sing N N 92 DT "C3'" "C2'" sing N N 93 DT "C3'" "H3'" sing N N 94 DT "O3'" "HO3'" sing N N 95 DT "C2'" "C1'" sing N N 96 DT "C2'" "H2'" sing N N 97 DT "C2'" "H2''" sing N N 98 DT "C1'" N1 sing N N 99 DT "C1'" "H1'" sing N N 100 DT N1 C2 sing N N 101 DT N1 C6 sing N N 102 DT C2 O2 doub N N 103 DT C2 N3 sing N N 104 DT N3 C4 sing N N 105 DT N3 H3 sing N N 106 DT C4 O4 doub N N 107 DT C4 C5 sing N N 108 DT C5 C7 sing N N 109 DT C5 C6 doub N N 110 DT C7 H71 sing N N 111 DT C7 H72 sing N N 112 DT C7 H73 sing N N 113 DT C6 H6 sing N N 114 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2KF8 'double helix' 2KF8 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 A DA 18 1_555 -0.080 1.407 0.089 26.097 9.123 -18.294 1 A_DG3:DA18_A A 3 ? A 18 ? 8 ? 1 A DG 15 1_555 A DG 2 1_555 1.831 3.295 -0.483 -2.686 5.554 -88.441 2 A_DG15:DG2_A A 15 ? A 2 ? 6 ? 1 A DG 19 1_555 A DG 7 1_555 -2.295 -2.988 0.133 -5.791 6.566 87.972 3 A_DG19:DG7_A A 19 ? A 7 ? 6 ? 1 A DG 20 1_555 A DG 14 1_555 -1.625 -3.318 -0.021 3.407 3.775 94.667 4 A_DG20:DG14_A A 20 ? A 14 ? 6 ? 1 A DG 9 1_555 A DG 13 1_555 2.146 1.678 0.353 14.166 -3.256 -57.034 5 A_DG9:DG13_A A 9 ? A 13 ? ? ? 1 A DT 22 1_555 A DT 11 1_555 -1.894 1.942 -0.255 -12.988 -4.227 -166.961 6 A_DT22:DT11_A A 22 ? A 11 ? 12 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 A DA 18 1_555 A DG 15 1_555 A DG 2 1_555 -1.659 -1.616 -2.864 4.309 -8.198 -112.579 0.887 -1.039 -2.895 4.923 2.588 -112.828 1 AA_DG3DG15:DG2DA18_AA A 3 ? A 18 ? A 15 ? A 2 ? 1 A DG 15 1_555 A DG 2 1_555 A DG 19 1_555 A DG 7 1_555 1.438 3.532 -0.275 0.513 -7.688 -176.191 -1.767 0.719 -0.267 3.846 0.257 -176.200 2 AA_DG15DG19:DG7DG2_AA A 15 ? A 2 ? A 19 ? A 7 ? 1 A DG 19 1_555 A DG 7 1_555 A DG 20 1_555 A DG 14 1_555 -2.032 -2.308 0.137 166.092 -58.484 128.522 -1.163 0.990 -0.375 -29.306 -83.229 178.301 3 AA_DG19DG20:DG14DG7_AA A 19 ? A 7 ? A 20 ? A 14 ? 1 A DG 20 1_555 A DG 14 1_555 A DG 9 1_555 A DG 13 1_555 3.545 4.305 2.950 3.375 0.980 -164.943 -2.173 1.794 2.931 -0.494 1.702 -164.950 4 AA_DG20DG9:DG13DG14_AA A 20 ? A 14 ? A 9 ? A 13 ? 1 A DG 9 1_555 A DG 13 1_555 A DT 22 1_555 A DT 11 1_555 4.081 2.055 3.098 6.152 -3.438 -15.804 -5.153 16.576 1.796 11.772 21.061 -17.295 5 AA_DG9DT22:DT11DG13_AA A 9 ? A 13 ? A 22 ? A 11 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AVANCE 1 'Bruker Avance' 700 Bruker AVANCE 2 'Bruker Avance' 600 Varian INOVA 3 'Varian INOVA' # _atom_sites.entry_id 2KF8 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_