data_5VY6 # _entry.id 5VY6 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5VY6 pdb_00005vy6 10.2210/pdb5vy6/pdb WWPDB D_1000228141 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2017-08-02 2 'Structure model' 1 1 2017-08-23 3 'Structure model' 1 2 2017-09-13 4 'Structure model' 1 3 2019-11-27 5 'Structure model' 1 4 2024-03-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Author supporting evidence' 3 4 'Structure model' 'Author supporting evidence' 4 5 'Structure model' 'Data collection' 5 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' pdbx_audit_support 4 4 'Structure model' pdbx_audit_support 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond 7 5 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation_author.name' 5 3 'Structure model' '_pdbx_audit_support.funding_organization' 6 4 'Structure model' '_pdbx_audit_support.funding_organization' 7 5 'Structure model' '_database_2.pdbx_DOI' 8 5 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 5VY6 _pdbx_database_status.recvd_initial_deposition_date 2017-05-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # _pdbx_database_related.content_type unspecified _pdbx_database_related.db_id 5VY7 _pdbx_database_related.db_name PDB _pdbx_database_related.details . # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 ? 'Yan, H.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'J. Am. Chem. Soc.' _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 139 _citation.language ? _citation.page_first 11254 _citation.page_last 11260 _citation.title 'Tuning the Cavity Size and Chirality of Self-Assembling 3D DNA Crystals.' _citation.year 2017 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.7b06485 _citation.pdbx_database_id_PubMed 28731332 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 ? primary 'Zhang, F.' 2 ? primary 'MacCulloch, T.' 3 ? primary 'Fahmi, N.' 4 ? primary 'Stephanopoulos, N.' 5 ? primary 'Liu, Y.' 6 ? primary 'Seeman, N.C.' 7 ? primary 'Yan, H.' 8 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*TP*GP*AP*CP*GP*GP*AP*AP*CP*TP*CP*A)-3') ; 6466.201 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*GP*TP*CP*A)-3') ; 1769.193 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*T)-3') ; 2432.614 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3') ; 2129.409 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DA)(DC)(DC)(DT)(DG)(DA)(DC)(DG)(DG)(DA)(DA)(DC)(DT)(DC) (DA) ; GAGCAGACCTGACGGAACTCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DG)(DT)(DC)(DA)' CCGTCA B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DT)' TCTGAGTT C ? 4 polydeoxyribonucleotide no no '(DG)(DG)(DT)(DC)(DT)(DG)(DC)' GGTCTGC D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DC n 1 10 DT n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DG n 2 4 DT n 2 5 DC n 2 6 DA n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DT n 4 1 DG n 4 2 DG n 4 3 DT n 4 4 DC n 4 5 DT n 4 6 DG n 4 7 DC n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample ? ? 'synthetic construct' ? 32630 ? 2 1 sample ? ? 'synthetic construct' ? 32630 ? 3 1 sample ? ? 'synthetic construct' ? 32630 ? 4 1 sample ? ? 'synthetic construct' ? 32630 ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 0 0 DC DC B . n B 2 2 DC 2 1 1 DC DC B . n B 2 3 DG 3 2 2 DG DG B . n B 2 4 DT 4 3 3 DT DT B . n B 2 5 DC 5 4 4 DC DC B . n B 2 6 DA 6 5 5 DA DA B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DT 8 8 8 DT DT C . n D 4 1 DG 1 10 10 DG DG D . n D 4 2 DG 2 11 11 DG DG D . n D 4 3 DT 3 12 12 DT DT D . n D 4 4 DC 4 13 13 DC DC D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DG 6 15 15 DG DG D . n D 4 7 DC 7 16 16 DC DC D . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A DG 1 ? "O5'" ? A DG 1 "O5'" 2 1 Y 1 A DG 1 ? "C5'" ? A DG 1 "C5'" 3 1 Y 1 C DT 1 ? "O5'" ? C DT 1 "O5'" 4 1 Y 1 C DT 1 ? "C5'" ? C DT 1 "C5'" # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 5VY6 _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.459 _cell.length_a_esd ? _cell.length_b 68.459 _cell.length_b_esd ? _cell.length_c 55.843 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 3 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 5VY6 _symmetry.cell_setting ? _symmetry.Int_Tables_number 145 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 5VY6 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.90 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 79.17 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details 'Crystals form by generating a temperature gradient from 60C-25C over 5 days' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '50 mM cacodylate pH 6.5, 18 mM MgCl2, 0.9 mM spermine, 0.9 mM cobalt(III)hexamine, and 9% isopropanol' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'ADSC QUANTUM 315r' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2015-06-16 # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.0 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 8.2.2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.0 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 8.2.2 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 5VY6 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.05 _reflns.d_resolution_low 34.23 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4710 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 89.25 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 7.6 _reflns.pdbx_Rmerge_I_obs 0.108 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 23.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 3.05 _reflns_shell.d_res_low 3.10 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 1.9 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs ? _reflns_shell.percent_possible_all 57.7 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.674 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 6.7 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 5VY6 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.064 _refine.ls_d_res_low 34.230 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4710 _refine.ls_number_reflns_R_free 233 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 85.40 _refine.ls_percent_reflns_R_free 4.95 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2127 _refine.ls_R_factor_R_free 0.2366 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2113 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.00 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 28.81 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.03 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 851 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 851 _refine_hist.d_res_high 3.064 _refine_hist.d_res_low 34.230 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.007 ? 952 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.923 ? 1461 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 35.131 ? 400 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.048 ? 164 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 42 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.0644 3.8600 . . 94 1901 72.00 . . . 0.2416 . 0.2369 . . . . . . . . . . 'X-RAY DIFFRACTION' 3.8600 34.2316 . . 139 2576 99.00 . . . 0.2346 . 0.2018 . . . . . . . . . . # _struct.entry_id 5VY6 _struct.title 'A self-assembling D-form DNA crystal lattice' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 5VY6 _struct_keywords.text 'DNA nanotechnology, self-assembly, DNA structure, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 5VY6 5VY6 ? 1 ? 1 2 PDB 5VY6 5VY6 ? 2 ? 1 3 PDB 5VY6 5VY6 ? 3 ? 1 4 PDB 5VY6 5VY6 ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 5VY6 A 1 ? 21 ? 5VY6 1 ? 21 ? 1 21 2 2 5VY6 B 1 ? 6 ? 5VY6 0 ? 5 ? 0 5 3 3 5VY6 C 1 ? 8 ? 5VY6 1 ? 8 ? 1 8 4 4 5VY6 D 1 ? 7 ? 5VY6 10 ? 16 ? 10 16 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 D DC 7 N3 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 D DC 7 O2 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 O6 ? ? ? 1_555 D DC 7 N4 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 N1 ? ? ? 1_555 D DC 4 N3 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 6 N2 ? ? ? 1_555 D DC 4 O2 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 D DC 4 N4 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DA 7 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DA 7 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 8 N3 ? ? ? 1_555 D DG 2 N1 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 8 N4 ? ? ? 1_555 D DG 2 O6 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 8 O2 ? ? ? 1_555 D DG 2 N2 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 N3 ? ? ? 1_555 D DG 1 N1 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 9 N4 ? ? ? 1_555 D DG 1 O6 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 9 O2 ? ? ? 1_555 D DG 1 N2 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 6 N1 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 6 N6 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 5 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 5 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 5 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 4 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 4 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 3 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 3 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 3 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 16 N1 ? ? ? 1_555 C DT 8 N3 ? ? A DA 16 C DT 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 16 N6 ? ? ? 1_555 C DT 8 O4 ? ? A DA 16 C DT 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_symm_contact.id _pdbx_validate_symm_contact.PDB_model_num _pdbx_validate_symm_contact.auth_atom_id_1 _pdbx_validate_symm_contact.auth_asym_id_1 _pdbx_validate_symm_contact.auth_comp_id_1 _pdbx_validate_symm_contact.auth_seq_id_1 _pdbx_validate_symm_contact.PDB_ins_code_1 _pdbx_validate_symm_contact.label_alt_id_1 _pdbx_validate_symm_contact.site_symmetry_1 _pdbx_validate_symm_contact.auth_atom_id_2 _pdbx_validate_symm_contact.auth_asym_id_2 _pdbx_validate_symm_contact.auth_comp_id_2 _pdbx_validate_symm_contact.auth_seq_id_2 _pdbx_validate_symm_contact.PDB_ins_code_2 _pdbx_validate_symm_contact.label_alt_id_2 _pdbx_validate_symm_contact.site_symmetry_2 _pdbx_validate_symm_contact.dist 1 1 O6 A DG 1 ? ? 1_555 H42 C DC 2 ? ? 1_445 1.38 2 1 OP2 B DC 0 ? ? 1_555 "O3'" B DA 5 ? ? 3_655 2.09 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" B DC 0 ? ? "C4'" B DC 0 ? ? "C3'" B DC 0 ? ? 101.13 104.50 -3.37 0.40 N 2 1 "O4'" B DC 0 ? ? "C1'" B DC 0 ? ? N1 B DC 0 ? ? 110.94 108.30 2.64 0.30 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DC OP3 O N N 37 DC P P N N 38 DC OP1 O N N 39 DC OP2 O N N 40 DC "O5'" O N N 41 DC "C5'" C N N 42 DC "C4'" C N R 43 DC "O4'" O N N 44 DC "C3'" C N S 45 DC "O3'" O N N 46 DC "C2'" C N N 47 DC "C1'" C N R 48 DC N1 N N N 49 DC C2 C N N 50 DC O2 O N N 51 DC N3 N N N 52 DC C4 C N N 53 DC N4 N N N 54 DC C5 C N N 55 DC C6 C N N 56 DC HOP3 H N N 57 DC HOP2 H N N 58 DC "H5'" H N N 59 DC "H5''" H N N 60 DC "H4'" H N N 61 DC "H3'" H N N 62 DC "HO3'" H N N 63 DC "H2'" H N N 64 DC "H2''" H N N 65 DC "H1'" H N N 66 DC H41 H N N 67 DC H42 H N N 68 DC H5 H N N 69 DC H6 H N N 70 DG OP3 O N N 71 DG P P N N 72 DG OP1 O N N 73 DG OP2 O N N 74 DG "O5'" O N N 75 DG "C5'" C N N 76 DG "C4'" C N R 77 DG "O4'" O N N 78 DG "C3'" C N S 79 DG "O3'" O N N 80 DG "C2'" C N N 81 DG "C1'" C N R 82 DG N9 N Y N 83 DG C8 C Y N 84 DG N7 N Y N 85 DG C5 C Y N 86 DG C6 C N N 87 DG O6 O N N 88 DG N1 N N N 89 DG C2 C N N 90 DG N2 N N N 91 DG N3 N N N 92 DG C4 C Y N 93 DG HOP3 H N N 94 DG HOP2 H N N 95 DG "H5'" H N N 96 DG "H5''" H N N 97 DG "H4'" H N N 98 DG "H3'" H N N 99 DG "HO3'" H N N 100 DG "H2'" H N N 101 DG "H2''" H N N 102 DG "H1'" H N N 103 DG H8 H N N 104 DG H1 H N N 105 DG H21 H N N 106 DG H22 H N N 107 DT OP3 O N N 108 DT P P N N 109 DT OP1 O N N 110 DT OP2 O N N 111 DT "O5'" O N N 112 DT "C5'" C N N 113 DT "C4'" C N R 114 DT "O4'" O N N 115 DT "C3'" C N S 116 DT "O3'" O N N 117 DT "C2'" C N N 118 DT "C1'" C N R 119 DT N1 N N N 120 DT C2 C N N 121 DT O2 O N N 122 DT N3 N N N 123 DT C4 C N N 124 DT O4 O N N 125 DT C5 C N N 126 DT C7 C N N 127 DT C6 C N N 128 DT HOP3 H N N 129 DT HOP2 H N N 130 DT "H5'" H N N 131 DT "H5''" H N N 132 DT "H4'" H N N 133 DT "H3'" H N N 134 DT "HO3'" H N N 135 DT "H2'" H N N 136 DT "H2''" H N N 137 DT "H1'" H N N 138 DT H3 H N N 139 DT H71 H N N 140 DT H72 H N N 141 DT H73 H N N 142 DT H6 H N N 143 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5VY6 'double helix' 5VY6 'a-form double helix' 5VY6 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 D DC 7 1_555 -0.120 -0.176 0.754 2.928 -13.067 -3.935 1 A_DG3:DC16_D A 3 ? D 16 ? 19 1 1 A DC 4 1_555 D DG 6 1_555 0.110 -0.122 0.500 -3.074 -4.521 -2.289 2 A_DC4:DG15_D A 4 ? D 15 ? 19 1 1 A DA 5 1_555 D DT 5 1_555 0.173 0.030 0.435 -0.310 -6.968 -10.453 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DG 6 1_555 D DC 4 1_555 -0.166 -0.186 0.252 -3.573 -7.038 -3.056 4 A_DG6:DC13_D A 6 ? D 13 ? 19 1 1 A DA 7 1_555 D DT 3 1_555 0.036 -0.100 0.061 3.382 1.267 -6.626 5 A_DA7:DT12_D A 7 ? D 12 ? 20 1 1 A DC 8 1_555 D DG 2 1_555 0.223 -0.225 0.053 7.495 1.270 2.473 6 A_DC8:DG11_D A 8 ? D 11 ? 19 1 1 A DC 9 1_555 D DG 1 1_555 0.216 -0.146 0.299 -1.310 -4.212 -0.703 7 A_DC9:DG10_D A 9 ? D 10 ? 19 1 1 A DT 10 1_555 B DA 6 1_555 -0.434 0.103 0.961 -3.648 -4.439 5.007 8 A_DT10:DA5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 5 1_555 -0.115 -0.130 0.657 10.223 0.827 1.800 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 4 1_555 0.234 -0.018 0.574 2.962 -5.408 -6.672 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 3 1_555 0.130 -0.257 0.683 -3.269 -4.416 -3.595 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DG 14 1_555 B DC 2 1_555 -0.109 -0.182 0.591 3.269 -6.530 -4.312 12 A_DG14:DC1_B A 14 ? B 1 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.249 -0.125 -0.103 1.247 -6.631 5.026 13 A_DG15:DC0_B A 15 ? B 0 ? 19 1 1 A DA 16 1_555 C DT 8 1_555 0.064 -0.033 0.526 4.569 -7.220 -2.460 14 A_DA16:DT8_C A 16 ? C 8 ? 20 1 1 A DA 17 1_555 C DT 7 1_555 0.241 -0.143 0.570 9.959 -10.289 -2.098 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 0.139 -0.256 0.273 -3.454 -2.984 1.074 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -0.225 -0.125 0.160 -4.433 -8.597 -2.350 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 0.149 -0.208 -0.303 -3.478 -1.389 -0.285 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 0.162 -0.064 0.225 0.551 -6.594 -0.802 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 D DC 7 1_555 A DC 4 1_555 D DG 6 1_555 0.432 -0.638 3.437 3.340 -0.355 38.716 -0.913 -0.220 3.467 -0.534 -5.027 38.855 1 AA_DG3DC4:DG15DC16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DC 4 1_555 D DG 6 1_555 A DA 5 1_555 D DT 5 1_555 -0.769 0.314 3.313 -2.235 0.727 32.843 0.428 0.967 3.362 1.284 3.946 32.925 2 AA_DC4DA5:DT14DG15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DG 6 1_555 D DC 4 1_555 0.673 -0.929 3.406 0.493 0.714 27.665 -2.121 -1.282 3.393 1.492 -1.031 27.679 3 AA_DA5DG6:DC13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DG 6 1_555 D DC 4 1_555 A DA 7 1_555 D DT 3 1_555 0.047 -0.671 3.025 2.463 2.845 39.500 -1.293 0.195 2.969 4.197 -3.634 39.672 4 AA_DG6DA7:DT12DC13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DA 7 1_555 D DT 3 1_555 A DC 8 1_555 D DG 2 1_555 0.923 -1.168 3.242 -4.394 5.064 32.272 -2.876 -2.335 2.884 8.989 7.800 32.943 5 AA_DA7DC8:DG11DT12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DC 8 1_555 D DG 2 1_555 A DC 9 1_555 D DG 1 1_555 -0.946 -1.581 3.494 -5.513 -1.083 35.027 -2.422 0.665 3.642 -1.785 9.087 35.461 6 AA_DC8DC9:DG10DG11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DC 9 1_555 D DG 1 1_555 A DT 10 1_555 B DA 6 1_555 -0.676 -2.183 3.299 -4.086 -2.600 19.540 -4.962 -0.085 3.619 -7.514 11.807 20.126 7 AA_DC9DT10:DA5DG10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DT 10 1_555 B DA 6 1_555 A DG 11 1_555 B DC 5 1_555 -0.382 0.688 3.208 0.803 2.241 31.275 0.857 0.856 3.238 4.149 -1.487 31.364 8 AA_DT10DG11:DC4DA5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 5 1_555 A DA 12 1_555 B DT 4 1_555 -0.559 0.028 3.481 -1.444 5.632 40.206 -0.628 0.633 3.471 8.141 2.087 40.606 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 4 1_555 A DC 13 1_555 B DG 3 1_555 0.356 -1.236 3.312 -1.933 1.316 35.265 -2.230 -0.873 3.242 2.169 3.187 35.340 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 3 1_555 A DG 14 1_555 B DC 2 1_555 -0.438 -0.310 3.162 -1.902 4.476 31.285 -1.366 0.464 3.110 8.238 3.500 31.652 11 AA_DC13DG14:DC1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 0.277 -0.399 3.519 -1.639 2.323 33.030 -1.117 -0.780 3.467 4.077 2.876 33.148 12 AA_DG14DG15:DC0DC1_BB A 14 ? B 1 ? A 15 ? B 0 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 C DT 8 1_555 -1.561 -1.020 2.976 -7.357 -4.176 30.538 -1.110 1.522 3.358 -7.744 13.642 31.661 13 AA_DG15DA16:DT8DC0_CB A 15 ? B 0 ? A 16 ? C 8 ? 1 A DA 16 1_555 C DT 8 1_555 A DA 17 1_555 C DT 7 1_555 -0.146 -0.426 2.984 -3.137 -1.516 38.867 -0.470 -0.128 3.000 -2.273 4.703 39.017 14 AA_DA16DA17:DT7DT8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 0.155 -1.102 3.589 -1.898 -2.996 33.576 -1.358 -0.609 3.656 -5.169 3.275 33.758 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 -0.563 -0.981 3.217 2.901 1.030 37.984 -1.630 1.219 3.141 1.579 -4.448 38.104 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.989 1.543 3.406 6.004 -4.719 37.798 2.945 -0.728 3.310 -7.195 -9.153 38.534 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.348 1.447 3.355 -4.628 2.874 36.125 1.892 -0.116 3.473 4.602 7.412 36.520 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Science Foundation (NSF, United States)' 'United States' 1334109 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 3 # _atom_sites.entry_id 5VY6 _atom_sites.fract_transf_matrix[1][1] 0.014607 _atom_sites.fract_transf_matrix[1][2] 0.008434 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016867 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.017907 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_