data_6WLK # _entry.id 6WLK # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6WLK pdb_00006wlk 10.2210/pdb6wlk/pdb WWPDB D_1000248524 ? ? EMDB EMD-21832 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-07-08 2 'Structure model' 1 1 2020-07-15 3 'Structure model' 1 2 2024-03-06 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.pdbx_database_id_PubMed' 5 2 'Structure model' '_citation.title' 6 2 'Structure model' '_citation_author.identifier_ORCID' 7 3 'Structure model' '_database_2.pdbx_DOI' 8 3 'Structure model' '_database_2.pdbx_database_accession' # loop_ _database_PDB_caveat.id _database_PDB_caveat.text 1 'In model 11, Residues G A 47 and G A 48 that are next to each other in the sample sequence are not properly linked.' 2 'In model 13, Residues G A 48 and C A 49 that are next to each other in the sample sequence are not properly linked.' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6WLK _pdbx_database_status.recvd_initial_deposition_date 2020-04-20 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type PDB 'ATP-TTR-3 with AMP' 6WLJ unspecified EMDB . EMD-21832 'associated EM volume' EMDB . EMD-21831 'other EM volume' EMDB . EMD-21833 'other EM volume' EMDB . EMD-21834 'other EM volume' EMDB . EMD-21835 'other EM volume' EMDB . EMD-21836 'other EM volume' EMDB . EMD-21838 'other EM volume' EMDB . EMD-21839 'other EM volume' EMDB . EMD-21840 'other EM volume' EMDB . EMD-21841 'other EM volume' EMDB . EMD-21842 'other EM volume' # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kappel, K.' 1 0000-0002-2129-199X 'Zhang, K.' 2 ? 'Su, Z.' 3 ? 'Watkins, A.M.' 4 ? 'Kladwang, W.' 5 ? 'Li, S.' 6 ? 'Pintilie, G.' 7 ? 'Topkar, V.V.' 8 ? 'Rangan, R.' 9 ? 'Zheludev, I.N.' 10 ? 'Yesselman, J.D.' 11 ? 'Chiu, W.' 12 ? 'Das, R.' 13 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Methods _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1548-7105 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 17 _citation.language ? _citation.page_first 699 _citation.page_last 707 _citation.title 'Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41592-020-0878-9 _citation.pdbx_database_id_PubMed 32616928 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kappel, K.' 1 ? primary 'Zhang, K.' 2 ? primary 'Su, Z.' 3 ? primary 'Watkins, A.M.' 4 ? primary 'Kladwang, W.' 5 ? primary 'Li, S.' 6 ? primary 'Pintilie, G.' 7 ? primary 'Topkar, V.V.' 8 ? primary 'Rangan, R.' 9 ? primary 'Zheludev, I.N.' 10 ? primary 'Yesselman, J.D.' 11 ? primary 'Chiu, W.' 12 ? primary 'Das, R.' 13 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (130-MER)' _entity.formula_weight 42145.086 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGCGAUAUGGCAUGGAAUCAGCUCAAGGAACUGUGAACGUAUAUCGGGCAACGACUAGGAAACUAGUCGUUGGGAAGAAA CUGCCGAUAUACGGGAGUUCCUUGAGCGGGAGAUUCCAUGCCUAAGUCGC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGCGAUAUGGCAUGGAAUCAGCUCAAGGAACUGUGAACGUAUAUCGGGCAACGACUAGGAAACUAGUCGUUGGGAAGAAA CUGCCGAUAUACGGGAGUUCCUUGAGCGGGAGAUUCCAUGCCUAAGUCGC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 A n 1 6 U n 1 7 A n 1 8 U n 1 9 G n 1 10 G n 1 11 C n 1 12 A n 1 13 U n 1 14 G n 1 15 G n 1 16 A n 1 17 A n 1 18 U n 1 19 C n 1 20 A n 1 21 G n 1 22 C n 1 23 U n 1 24 C n 1 25 A n 1 26 A n 1 27 G n 1 28 G n 1 29 A n 1 30 A n 1 31 C n 1 32 U n 1 33 G n 1 34 U n 1 35 G n 1 36 A n 1 37 A n 1 38 C n 1 39 G n 1 40 U n 1 41 A n 1 42 U n 1 43 A n 1 44 U n 1 45 C n 1 46 G n 1 47 G n 1 48 G n 1 49 C n 1 50 A n 1 51 A n 1 52 C n 1 53 G n 1 54 A n 1 55 C n 1 56 U n 1 57 A n 1 58 G n 1 59 G n 1 60 A n 1 61 A n 1 62 A n 1 63 C n 1 64 U n 1 65 A n 1 66 G n 1 67 U n 1 68 C n 1 69 G n 1 70 U n 1 71 U n 1 72 G n 1 73 G n 1 74 G n 1 75 A n 1 76 A n 1 77 G n 1 78 A n 1 79 A n 1 80 A n 1 81 C n 1 82 U n 1 83 G n 1 84 C n 1 85 C n 1 86 G n 1 87 A n 1 88 U n 1 89 A n 1 90 U n 1 91 A n 1 92 C n 1 93 G n 1 94 G n 1 95 G n 1 96 A n 1 97 G n 1 98 U n 1 99 U n 1 100 C n 1 101 C n 1 102 U n 1 103 U n 1 104 G n 1 105 A n 1 106 G n 1 107 C n 1 108 G n 1 109 G n 1 110 G n 1 111 A n 1 112 G n 1 113 A n 1 114 U n 1 115 U n 1 116 C n 1 117 C n 1 118 A n 1 119 U n 1 120 G n 1 121 C n 1 122 C n 1 123 U n 1 124 A n 1 125 A n 1 126 G n 1 127 U n 1 128 C n 1 129 G n 1 130 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 130 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 A 25 25 25 A A A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 G 33 33 33 G G A . n A 1 34 U 34 34 34 U U A . n A 1 35 G 35 35 35 G G A . n A 1 36 A 36 36 36 A A A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 A 41 41 41 A A A . n A 1 42 U 42 42 42 U U A . n A 1 43 A 43 43 43 A A A . n A 1 44 U 44 44 44 U U A . n A 1 45 C 45 45 45 C C A . n A 1 46 G 46 46 46 G G A . n A 1 47 G 47 47 47 G G A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 A 50 50 50 A A A . n A 1 51 A 51 51 51 A A A . n A 1 52 C 52 52 52 C C A . n A 1 53 G 53 53 53 G G A . n A 1 54 A 54 54 54 A A A . n A 1 55 C 55 55 55 C C A . n A 1 56 U 56 56 56 U U A . n A 1 57 A 57 57 57 A A A . n A 1 58 G 58 58 58 G G A . n A 1 59 G 59 59 59 G G A . n A 1 60 A 60 60 60 A A A . n A 1 61 A 61 61 61 A A A . n A 1 62 A 62 62 62 A A A . n A 1 63 C 63 63 63 C C A . n A 1 64 U 64 64 64 U U A . n A 1 65 A 65 65 65 A A A . n A 1 66 G 66 66 66 G G A . n A 1 67 U 67 67 67 U U A . n A 1 68 C 68 68 68 C C A . n A 1 69 G 69 69 69 G G A . n A 1 70 U 70 70 70 U U A . n A 1 71 U 71 71 71 U U A . n A 1 72 G 72 72 72 G G A . n A 1 73 G 73 73 73 G G A . n A 1 74 G 74 74 74 G G A . n A 1 75 A 75 75 75 A A A . n A 1 76 A 76 76 76 A A A . n A 1 77 G 77 77 77 G G A . n A 1 78 A 78 78 78 A A A . n A 1 79 A 79 79 79 A A A . n A 1 80 A 80 80 80 A A A . n A 1 81 C 81 81 81 C C A . n A 1 82 U 82 82 82 U U A . n A 1 83 G 83 83 83 G G A . n A 1 84 C 84 84 84 C C A . n A 1 85 C 85 85 85 C C A . n A 1 86 G 86 86 86 G G A . n A 1 87 A 87 87 87 A A A . n A 1 88 U 88 88 88 U U A . n A 1 89 A 89 89 89 A A A . n A 1 90 U 90 90 90 U U A . n A 1 91 A 91 91 91 A A A . n A 1 92 C 92 92 92 C C A . n A 1 93 G 93 93 93 G G A . n A 1 94 G 94 94 94 G G A . n A 1 95 G 95 95 95 G G A . n A 1 96 A 96 96 96 A A A . n A 1 97 G 97 97 97 G G A . n A 1 98 U 98 98 98 U U A . n A 1 99 U 99 99 99 U U A . n A 1 100 C 100 100 100 C C A . n A 1 101 C 101 101 101 C C A . n A 1 102 U 102 102 102 U U A . n A 1 103 U 103 103 103 U U A . n A 1 104 G 104 104 104 G G A . n A 1 105 A 105 105 105 A A A . n A 1 106 G 106 106 106 G G A . n A 1 107 C 107 107 107 C C A . n A 1 108 G 108 108 108 G G A . n A 1 109 G 109 109 109 G G A . n A 1 110 G 110 110 110 G G A . n A 1 111 A 111 111 111 A A A . n A 1 112 G 112 112 112 G G A . n A 1 113 A 113 113 113 A A A . n A 1 114 U 114 114 114 U U A . n A 1 115 U 115 115 115 U U A . n A 1 116 C 116 116 116 C C A . n A 1 117 C 117 117 117 C C A . n A 1 118 A 118 118 118 A A A . n A 1 119 U 119 119 119 U U A . n A 1 120 G 120 120 120 G G A . n A 1 121 C 121 121 121 C C A . n A 1 122 C 122 122 122 C C A . n A 1 123 U 123 123 123 U U A . n A 1 124 A 124 124 124 A A A . n A 1 125 A 125 125 125 A A A . n A 1 126 G 126 126 126 G G A . n A 1 127 U 127 127 127 U U A . n A 1 128 C 128 128 128 C C A . n A 1 129 G 129 129 129 G G A . n A 1 130 C 130 130 130 C C A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 2 2 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 3 3 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 4 4 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 5 5 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 6 6 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 7 7 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 8 8 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 9 9 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 10 10 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 11 11 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 12 12 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 13 13 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 14 14 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 15 15 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 16 16 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 17 17 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 18 18 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 19 19 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 20 20 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6WLK _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 6WLK _struct.title 'Apo ATP-TTR-3 models, 10.0 Angstrom resolution' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6WLK _struct_keywords.text 'aptamer, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6WLK _struct_ref.pdbx_db_accession 6WLK _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6WLK _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 130 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6WLK _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 130 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 130 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 21350 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 130 N3 ? ? A G 2 A C 130 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 130 O2 ? ? A G 2 A C 130 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 130 N4 ? ? A G 2 A C 130 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 129 N1 ? ? A C 3 A G 129 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 129 O6 ? ? A C 3 A G 129 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 129 N2 ? ? A C 3 A G 129 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 128 N3 ? ? A G 4 A C 128 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 128 O2 ? ? A G 4 A C 128 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 128 N4 ? ? A G 4 A C 128 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 127 N3 ? ? A A 5 A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 127 O4 ? ? A A 5 A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 126 O6 ? ? A U 6 A G 126 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 126 N1 ? ? A U 6 A G 126 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A A 7 N1 ? ? ? 1_555 A A 60 N6 ? ? A A 7 A A 60 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog15 hydrog ? ? A A 7 N6 ? ? ? 1_555 A A 60 N1 ? ? A A 7 A A 60 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog16 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 123 O2 ? ? A A 7 A U 123 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A A 7 N7 ? ? ? 1_555 A U 123 N3 ? ? A A 7 A U 123 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog18 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 125 N1 ? ? A U 8 A A 125 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 125 N6 ? ? A U 8 A A 125 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A A 62 N3 ? ? A G 9 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 122 N3 ? ? A G 9 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 122 O2 ? ? A G 9 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 122 N4 ? ? A G 9 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 121 N3 ? ? A G 10 A C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 121 O2 ? ? A G 10 A C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 121 N4 ? ? A G 10 A C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 120 N1 ? ? A C 11 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 120 O6 ? ? A C 11 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 120 N2 ? ? A C 11 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 119 N3 ? ? A A 12 A U 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 119 O4 ? ? A A 12 A U 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 13 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 13 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 117 N3 ? ? A G 14 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 117 O2 ? ? A G 14 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 117 N4 ? ? A G 14 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 116 N3 ? ? A G 15 A C 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 116 O2 ? ? A G 15 A C 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 116 N4 ? ? A G 15 A C 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 16 N1 ? ? ? 1_555 A U 115 N3 ? ? A A 16 A U 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 16 N6 ? ? ? 1_555 A U 115 O4 ? ? A A 16 A U 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A A 17 N1 ? ? ? 1_555 A U 114 N3 ? ? A A 17 A U 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 17 N6 ? ? ? 1_555 A U 114 O4 ? ? A A 17 A U 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 113 N1 ? ? A U 18 A A 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 113 N6 ? ? A U 18 A A 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 112 N1 ? ? A C 19 A G 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 112 O6 ? ? A C 19 A G 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 112 N2 ? ? A C 19 A G 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 107 N3 ? ? A G 21 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 107 O2 ? ? A G 21 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 107 N4 ? ? A G 21 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 106 N1 ? ? A C 22 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 106 O6 ? ? A C 22 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 106 N2 ? ? A C 22 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 105 N1 ? ? A U 23 A A 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 105 N6 ? ? A U 23 A A 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 104 N1 ? ? A C 24 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 104 O6 ? ? A C 24 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 104 N2 ? ? A C 24 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A A 25 N1 ? ? ? 1_555 A U 103 N3 ? ? A A 25 A U 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A A 25 N6 ? ? ? 1_555 A U 103 O4 ? ? A A 25 A U 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 102 N3 ? ? A A 26 A U 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 102 O4 ? ? A A 26 A U 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 101 N3 ? ? A G 27 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 101 O2 ? ? A G 27 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 101 N4 ? ? A G 27 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 100 N3 ? ? A G 28 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 100 O2 ? ? A G 28 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 100 N4 ? ? A G 28 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 29 N1 ? ? ? 1_555 A U 99 N3 ? ? A A 29 A U 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 29 N6 ? ? ? 1_555 A U 99 O4 ? ? A A 29 A U 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 98 N3 ? ? A A 30 A U 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 98 O4 ? ? A A 30 A U 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 31 N3 ? ? ? 1_555 A G 97 N1 ? ? A C 31 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 31 N4 ? ? ? 1_555 A G 97 O6 ? ? A C 31 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A C 31 O2 ? ? ? 1_555 A G 97 N2 ? ? A C 31 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A U 32 N3 ? ? ? 1_555 A A 96 N1 ? ? A U 32 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A U 32 O4 ? ? ? 1_555 A A 96 N6 ? ? A U 32 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 38 N3 ? ? ? 1_555 A G 93 N1 ? ? A C 38 A G 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A C 38 N4 ? ? ? 1_555 A G 93 O6 ? ? A C 38 A G 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 38 O2 ? ? ? 1_555 A G 93 N2 ? ? A C 38 A G 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 39 N1 ? ? ? 1_555 A C 92 N3 ? ? A G 39 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 39 N2 ? ? ? 1_555 A C 92 O2 ? ? A G 39 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 39 O6 ? ? ? 1_555 A C 92 N4 ? ? A G 39 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A U 40 N3 ? ? ? 1_555 A A 91 N1 ? ? A U 40 A A 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A U 40 O4 ? ? ? 1_555 A A 91 N6 ? ? A U 40 A A 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A A 41 N1 ? ? ? 1_555 A U 90 N3 ? ? A A 41 A U 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A A 41 N6 ? ? ? 1_555 A U 90 O4 ? ? A A 41 A U 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A U 42 N3 ? ? ? 1_555 A A 89 N1 ? ? A U 42 A A 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A U 42 O4 ? ? ? 1_555 A A 89 N6 ? ? A U 42 A A 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A A 43 N1 ? ? ? 1_555 A U 88 N3 ? ? A A 43 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A A 43 N6 ? ? ? 1_555 A U 88 O4 ? ? A A 43 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A U 44 N3 ? ? ? 1_555 A A 87 N1 ? ? A U 44 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A U 44 O4 ? ? ? 1_555 A A 87 N6 ? ? A U 44 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 45 N3 ? ? ? 1_555 A G 86 N1 ? ? A C 45 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 45 N4 ? ? ? 1_555 A G 86 O6 ? ? A C 45 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 45 O2 ? ? ? 1_555 A G 86 N2 ? ? A C 45 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A G 46 N1 ? ? ? 1_555 A C 85 N3 ? ? A G 46 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A G 46 N2 ? ? ? 1_555 A C 85 O2 ? ? A G 46 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A G 46 O6 ? ? ? 1_555 A C 85 N4 ? ? A G 46 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A G 47 N1 ? ? ? 1_555 A C 84 N3 ? ? A G 47 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A G 47 N2 ? ? ? 1_555 A C 84 O2 ? ? A G 47 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A G 47 O6 ? ? ? 1_555 A C 84 N4 ? ? A G 47 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A G 48 O6 ? ? ? 1_555 A G 83 N1 ? ? A G 48 A G 83 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog105 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 72 N1 ? ? A C 49 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 72 O6 ? ? A C 49 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 72 N2 ? ? A C 49 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A A 50 N1 ? ? ? 1_555 A U 71 N3 ? ? A A 50 A U 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A A 50 N6 ? ? ? 1_555 A U 71 O4 ? ? A A 50 A U 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A A 51 N1 ? ? ? 1_555 A U 70 N3 ? ? A A 51 A U 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A A 51 N6 ? ? ? 1_555 A U 70 O4 ? ? A A 51 A U 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A C 52 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 52 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A C 52 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 52 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A C 52 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 52 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A G 53 N1 ? ? ? 1_555 A C 68 N3 ? ? A G 53 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog116 hydrog ? ? A G 53 N2 ? ? ? 1_555 A C 68 O2 ? ? A G 53 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A G 53 O6 ? ? ? 1_555 A C 68 N4 ? ? A G 53 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 67 N3 ? ? A A 54 A U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 67 O4 ? ? A A 54 A U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A C 55 N3 ? ? ? 1_555 A G 66 N1 ? ? A C 55 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A C 55 N4 ? ? ? 1_555 A G 66 O6 ? ? A C 55 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A C 55 O2 ? ? ? 1_555 A G 66 N2 ? ? A C 55 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A U 56 N3 ? ? ? 1_555 A A 65 N1 ? ? A U 56 A A 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A U 56 O4 ? ? ? 1_555 A A 65 N6 ? ? A U 56 A A 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A A 57 N1 ? ? ? 1_555 A U 64 N3 ? ? A A 57 A U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A A 57 N6 ? ? ? 1_555 A U 64 O4 ? ? A A 57 A U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A G 58 N1 ? ? ? 1_555 A C 63 N3 ? ? A G 58 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A G 58 N2 ? ? ? 1_555 A C 63 O2 ? ? A G 58 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A G 58 O6 ? ? ? 1_555 A C 63 N4 ? ? A G 58 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A G 59 N2 ? ? ? 1_555 A A 62 N7 ? ? A G 59 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog131 hydrog ? ? A A 76 N1 ? ? ? 1_555 A A 80 N6 ? ? A A 76 A A 80 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog132 hydrog ? ? A A 76 N6 ? ? ? 1_555 A C 81 O2 ? ? A A 76 A C 81 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog133 hydrog ? ? A G 77 N2 ? ? ? 1_555 A A 80 N7 ? ? A G 77 A A 80 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog134 hydrog ? ? A G 77 N3 ? ? ? 1_555 A A 80 N6 ? ? A G 77 A A 80 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.04 2 2 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 3 2 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.13 4 3 "O2'" A A 37 ? ? "HO2'" A G 97 ? ? 1.60 5 3 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.10 6 4 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 7 4 "O2'" A A 75 ? ? O2 A U 82 ? ? 2.16 8 4 "O2'" A G 77 ? ? OP2 A A 79 ? ? 2.17 9 5 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.09 10 6 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 11 6 "O2'" A A 75 ? ? O2 A U 82 ? ? 2.11 12 6 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.12 13 7 OP2 A A 111 ? ? H62 A A 113 ? ? 1.55 14 7 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.13 15 8 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 16 8 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.11 17 8 "O2'" A A 75 ? ? O2 A U 82 ? ? 2.17 18 9 "O2'" A A 75 ? ? O2 A U 82 ? ? 2.11 19 10 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 20 10 "O2'" A G 74 ? ? N7 A A 76 ? ? 2.15 21 11 "HO2'" A G 74 ? ? N7 A A 76 ? ? 1.56 22 11 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.10 23 12 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 24 12 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.12 25 12 O6 A G 35 ? ? "O4'" A G 95 ? ? 2.19 26 13 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.07 27 14 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 28 14 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.12 29 15 "HO2'" A A 124 ? ? O6 A G 126 ? ? 1.52 30 15 "O2'" A A 7 ? ? OP2 A G 9 ? ? 2.10 31 16 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 32 16 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.06 33 18 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 34 19 "O2'" A U 34 ? ? H21 A G 94 ? ? 1.60 35 19 "O2'" A A 75 ? ? O2 A U 82 ? ? 2.14 36 20 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 37 20 "O2'" A U 34 ? ? OP2 A G 35 ? ? 1.76 38 20 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.12 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 11 "O3'" A G 47 ? ? P A G 48 ? ? 1.796 1.607 0.189 0.012 Y 2 13 "O3'" A G 48 ? ? P A C 49 ? ? 1.817 1.607 0.210 0.012 Y 3 15 "O3'" A G 47 ? ? P A G 48 ? ? 1.679 1.607 0.072 0.012 Y 4 19 "C2'" A G 1 ? ? "C1'" A G 1 ? ? 1.472 1.526 -0.054 0.008 N 5 19 "O3'" A G 48 ? ? P A C 49 ? ? 1.708 1.607 0.101 0.012 Y 6 19 "O4'" A A 79 ? ? "C1'" A A 79 ? ? 1.492 1.415 0.077 0.012 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 2 "C4'" A A 76 ? ? "C3'" A A 76 ? ? "C2'" A A 76 ? ? 95.11 102.60 -7.49 1.00 N 2 4 "C3'" A G 110 ? ? "C2'" A G 110 ? ? "C1'" A G 110 ? ? 96.46 101.30 -4.84 0.70 N 3 7 "C2'" A A 20 ? ? "C3'" A A 20 ? ? "O3'" A A 20 ? ? 128.35 113.70 14.65 1.60 N 4 11 "C3'" A G 83 ? ? "C2'" A G 83 ? ? "C1'" A G 83 ? ? 96.82 101.30 -4.48 0.70 N 5 19 "C3'" A G 1 ? ? "C2'" A G 1 ? ? "C1'" A G 1 ? ? 96.66 101.30 -4.64 0.70 N 6 19 "C2'" A A 79 ? ? "C3'" A A 79 ? ? "O3'" A A 79 ? ? 126.64 113.70 12.94 1.60 N # loop_ _pdbx_validate_polymer_linkage.id _pdbx_validate_polymer_linkage.PDB_model_num _pdbx_validate_polymer_linkage.auth_atom_id_1 _pdbx_validate_polymer_linkage.auth_asym_id_1 _pdbx_validate_polymer_linkage.auth_comp_id_1 _pdbx_validate_polymer_linkage.auth_seq_id_1 _pdbx_validate_polymer_linkage.PDB_ins_code_1 _pdbx_validate_polymer_linkage.label_alt_id_1 _pdbx_validate_polymer_linkage.auth_atom_id_2 _pdbx_validate_polymer_linkage.auth_asym_id_2 _pdbx_validate_polymer_linkage.auth_comp_id_2 _pdbx_validate_polymer_linkage.auth_seq_id_2 _pdbx_validate_polymer_linkage.PDB_ins_code_2 _pdbx_validate_polymer_linkage.label_alt_id_2 _pdbx_validate_polymer_linkage.dist 1 11 "O3'" A G 47 ? ? P A G 48 ? ? 1.80 2 13 "O3'" A G 48 ? ? P A C 49 ? ? 1.82 # _em_3d_fitting.entry_id 6WLK _em_3d_fitting.id 1 _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_protocol ? _em_3d_fitting.ref_space ? _em_3d_fitting.target_criteria ? _em_3d_fitting.method ? # _em_3d_reconstruction.entry_id 6WLK _em_3d_reconstruction.id 1 _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.details ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.num_particles 71045 _em_3d_reconstruction.resolution 10.0 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.symmetry_type POINT _em_3d_reconstruction.method ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.magnification_calibration ? # _em_buffer.id 1 _em_buffer.details ? _em_buffer.pH 8.0 _em_buffer.specimen_id 1 _em_buffer.name ? # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.details 'RNA generated by in vitro transcription' _em_entity_assembly.name 'Apo ATP-TTR-3' _em_entity_assembly.source NATURAL _em_entity_assembly.type COMPLEX _em_entity_assembly.entity_id_list 1 _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? # _em_imaging.id 1 _em_imaging.entry_id 6WLK _em_imaging.accelerating_voltage 200 _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.calibrated_defocus_max ? _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_magnification ? _em_imaging.cryogen ? _em_imaging.details ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.microscope_model 'FEI TALOS ARCTICA' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_max ? _em_imaging.nominal_defocus_min ? _em_imaging.nominal_magnification ? _em_imaging.recording_temperature_maximum ? _em_imaging.recording_temperature_minimum ? _em_imaging.residual_tilt ? _em_imaging.specimen_holder_model ? _em_imaging.specimen_id 1 _em_imaging.citation_id ? _em_imaging.date ? _em_imaging.temperature ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.astigmatism ? _em_imaging.detector_distance ? _em_imaging.electron_beam_tilt_params ? _em_imaging.specimen_holder_type ? # _em_sample_support.citation_id ? _em_sample_support.details unspecified _em_sample_support.film_material ? _em_sample_support.grid_material ? _em_sample_support.grid_mesh_size ? _em_sample_support.grid_type ? _em_sample_support.id 1 _em_sample_support.method ? _em_sample_support.specimen_id 1 # _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.chamber_temperature ? _em_vitrification.cryogen_name ETHANE _em_vitrification.details ? _em_vitrification.humidity ? _em_vitrification.instrument ? _em_vitrification.entry_id 6WLK _em_vitrification.citation_id ? _em_vitrification.method ? _em_vitrification.temp ? _em_vitrification.time_resolved_state ? # _em_experiment.entry_id 6WLK _em_experiment.id 1 _em_experiment.aggregation_state PARTICLE _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_ctf_correction.id 1 _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.type 'PHASE FLIPPING ONLY' _em_ctf_correction.details ? # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.experimental_flag YES _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.042 # _em_entity_assembly_naturalsource.id 1 _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.ncbi_tax_id 32630 _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organism 'synthetic construct' _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? # _em_image_processing.id 1 _em_image_processing.image_recording_id 1 _em_image_processing.details ? # _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.avg_electron_dose_per_image 30 _em_image_recording.average_exposure_time ? _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K2 SUMMIT (4k x 4k)' _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.id _em_software.category _em_software.details _em_software.name _em_software.version _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id 1 'PARTICLE SELECTION' ? ? ? 1 ? ? 2 'IMAGE ACQUISITION' ? ? ? ? ? 1 3 MASKING ? ? ? ? ? ? 4 'CTF CORRECTION' ? ? ? 1 ? ? 5 'LAYERLINE INDEXING' ? ? ? ? ? ? 6 'DIFFRACTION INDEXING' ? ? ? ? ? ? 7 'MODEL FITTING' ? ? ? ? ? ? 8 'MODEL REFINEMENT' ? ? ? ? ? ? 9 OTHER ? ? ? ? ? ? 10 'INITIAL EULER ASSIGNMENT' ? ? ? 1 ? ? 11 'FINAL EULER ASSIGNMENT' ? ? ? 1 ? ? 12 CLASSIFICATION ? ? ? 1 ? ? 13 RECONSTRUCTION ? ? ? 1 ? ? # _em_specimen.id 1 _em_specimen.experiment_id 1 _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6WLK 'double helix' 6WLK 'a-form double helix' 6WLK 'bulge loop' 6WLK 'mismatched base pair' 6WLK 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 130 1_555 -0.144 -0.138 -0.121 -5.520 -5.211 -0.825 1 A_G2:C130_A A 2 ? A 130 ? 19 1 1 A C 3 1_555 A G 129 1_555 0.162 -0.131 -0.023 -0.863 -1.373 -0.870 2 A_C3:G129_A A 3 ? A 129 ? 19 1 1 A G 4 1_555 A C 128 1_555 -0.098 -0.121 -0.135 -5.669 -3.298 -2.074 3 A_G4:C128_A A 4 ? A 128 ? 19 1 1 A A 5 1_555 A U 127 1_555 -0.198 -0.054 0.002 -7.289 -10.339 0.644 4 A_A5:U127_A A 5 ? A 127 ? 20 1 1 A U 6 1_555 A G 126 1_555 2.239 -0.666 -0.065 10.961 -13.762 0.756 5 A_U6:G126_A A 6 ? A 126 ? 28 1 1 A U 8 1_555 A A 125 1_555 0.084 0.025 -0.378 22.640 20.334 -14.553 6 A_U8:A125_A A 8 ? A 125 ? 20 1 1 A A 60 1_555 A A 7 1_555 1.456 0.963 0.490 -12.501 -6.283 -179.037 7 A_A60:A7_A A 60 ? A 7 ? 1 2 1 A G 9 1_555 A C 122 1_555 -0.198 -0.155 -0.431 -6.282 -12.095 -2.567 8 A_G9:C122_A A 9 ? A 122 ? 19 1 1 A G 10 1_555 A C 121 1_555 -0.562 0.020 -0.158 -13.179 -22.135 6.738 9 A_G10:C121_A A 10 ? A 121 ? 19 1 1 A C 11 1_555 A G 120 1_555 0.152 -0.128 -0.014 -0.530 -1.933 -1.213 10 A_C11:G120_A A 11 ? A 120 ? 19 1 1 A A 12 1_555 A U 119 1_555 0.028 -0.074 -0.120 -2.655 -3.282 -3.647 11 A_A12:U119_A A 12 ? A 119 ? 20 1 1 A U 13 1_555 A A 118 1_555 0.055 -0.088 -0.093 -2.302 -4.762 -2.524 12 A_U13:A118_A A 13 ? A 118 ? 20 1 1 A G 14 1_555 A C 117 1_555 -0.100 -0.125 -0.110 -4.982 -3.713 -1.897 13 A_G14:C117_A A 14 ? A 117 ? 19 1 1 A G 15 1_555 A C 116 1_555 -0.112 -0.125 -0.094 -4.445 -4.204 -1.776 14 A_G15:C116_A A 15 ? A 116 ? 19 1 1 A A 16 1_555 A U 115 1_555 0.014 -0.077 -0.123 -2.945 -3.815 -3.377 15 A_A16:U115_A A 16 ? A 115 ? 20 1 1 A A 17 1_555 A U 114 1_555 0.009 -0.082 -0.132 -1.710 -4.771 -2.845 16 A_A17:U114_A A 17 ? A 114 ? 20 1 1 A U 18 1_555 A A 113 1_555 0.077 -0.096 -0.126 -1.429 -5.685 -2.145 17 A_U18:A113_A A 18 ? A 113 ? 20 1 1 A C 19 1_555 A G 112 1_555 0.158 -0.128 -0.002 -1.323 -1.407 -1.284 18 A_C19:G112_A A 19 ? A 112 ? 19 1 1 A G 21 1_555 A C 107 1_555 -0.137 -0.137 -0.111 -4.995 -5.557 -1.071 19 A_G21:C107_A A 21 ? A 107 ? 19 1 1 A C 22 1_555 A G 106 1_555 0.163 -0.131 -0.045 -0.248 -2.032 -0.869 20 A_C22:G106_A A 22 ? A 106 ? 19 1 1 A U 23 1_555 A A 105 1_555 0.076 -0.084 -0.144 -1.402 -3.994 -3.109 21 A_U23:A105_A A 23 ? A 105 ? 20 1 1 A C 24 1_555 A G 104 1_555 0.153 -0.130 -0.011 -1.486 -0.702 -1.145 22 A_C24:G104_A A 24 ? A 104 ? 19 1 1 A A 25 1_555 A U 103 1_555 0.031 -0.071 -0.145 -3.155 -2.965 -3.823 23 A_A25:U103_A A 25 ? A 103 ? 20 1 1 A A 26 1_555 A U 102 1_555 0.011 -0.084 -0.167 -2.285 -4.497 -2.886 24 A_A26:U102_A A 26 ? A 102 ? 20 1 1 A G 27 1_555 A C 101 1_555 -0.108 -0.127 -0.135 -5.537 -4.210 -1.724 25 A_G27:C101_A A 27 ? A 101 ? 19 1 1 A G 28 1_555 A C 100 1_555 -0.106 -0.120 -0.108 -4.850 -3.827 -1.883 26 A_G28:C100_A A 28 ? A 100 ? 19 1 1 A A 29 1_555 A U 99 1_555 0.015 -0.078 -0.130 -3.229 -3.738 -3.349 27 A_A29:U99_A A 29 ? A 99 ? 20 1 1 A A 30 1_555 A U 98 1_555 0.012 -0.082 -0.139 -1.581 -5.021 -2.755 28 A_A30:U98_A A 30 ? A 98 ? 20 1 1 A C 31 1_555 A G 97 1_555 0.161 -0.128 -0.050 0.582 -2.359 -0.982 29 A_C31:G97_A A 31 ? A 97 ? 19 1 1 A U 32 1_555 A A 96 1_555 0.067 -0.089 -0.128 -0.893 -4.187 -2.592 30 A_U32:A96_A A 32 ? A 96 ? 20 1 1 A C 38 1_555 A G 93 1_555 0.148 -0.141 -0.078 2.388 -3.613 -0.676 31 A_C38:G93_A A 38 ? A 93 ? 19 1 1 A G 39 1_555 A C 92 1_555 -0.106 -0.126 -0.154 -6.667 -4.550 -1.737 32 A_G39:C92_A A 39 ? A 92 ? 19 1 1 A U 40 1_555 A A 91 1_555 0.052 -0.089 -0.079 -3.937 -5.579 -2.802 33 A_U40:A91_A A 40 ? A 91 ? 20 1 1 A A 41 1_555 A U 90 1_555 0.036 -0.073 -0.059 -4.139 -1.963 -3.384 34 A_A41:U90_A A 41 ? A 90 ? 20 1 1 A U 42 1_555 A A 89 1_555 0.048 -0.082 -0.066 -1.534 -3.316 -2.606 35 A_U42:A89_A A 42 ? A 89 ? 20 1 1 A A 43 1_555 A U 88 1_555 0.021 -0.082 -0.091 -2.079 -3.239 -2.857 36 A_A43:U88_A A 43 ? A 88 ? 20 1 1 A U 44 1_555 A A 87 1_555 0.075 -0.089 -0.121 -0.785 -4.739 -2.350 37 A_U44:A87_A A 44 ? A 87 ? 20 1 1 A C 45 1_555 A G 86 1_555 0.158 -0.131 -0.019 -0.748 -1.389 -1.062 38 A_C45:G86_A A 45 ? A 86 ? 19 1 1 A G 46 1_555 A C 85 1_555 -0.098 -0.124 -0.124 -4.663 -3.419 -2.042 39 A_G46:C85_A A 46 ? A 85 ? 19 1 1 A G 47 1_555 A C 84 1_555 -0.111 -0.125 -0.103 -5.337 -5.375 -1.813 40 A_G47:C84_A A 47 ? A 84 ? 19 1 1 A G 48 1_555 A G 83 1_555 -2.366 1.404 -1.409 42.351 -24.199 -33.383 41 A_G48:G83_A A 48 ? A 83 ? ? 1 1 A C 49 1_555 A G 72 1_555 0.146 -0.139 -0.077 2.376 -3.496 -0.639 42 A_C49:G72_A A 49 ? A 72 ? 19 1 1 A A 50 1_555 A U 71 1_555 0.019 -0.086 -0.177 -5.015 -2.425 -2.915 43 A_A50:U71_A A 50 ? A 71 ? 20 1 1 A A 51 1_555 A U 70 1_555 0.014 -0.081 -0.152 -3.379 -3.760 -2.795 44 A_A51:U70_A A 51 ? A 70 ? 20 1 1 A C 52 1_555 A G 69 1_555 0.159 -0.129 -0.031 -0.078 -2.048 -0.988 45 A_C52:G69_A A 52 ? A 69 ? 19 1 1 A G 53 1_555 A C 68 1_555 -0.097 -0.124 -0.123 -4.817 -3.323 -1.958 46 A_G53:C68_A A 53 ? A 68 ? 19 1 1 A A 54 1_555 A U 67 1_555 0.017 -0.076 -0.124 -2.878 -4.209 -3.259 47 A_A54:U67_A A 54 ? A 67 ? 20 1 1 A C 55 1_555 A G 66 1_555 0.161 -0.127 -0.046 0.538 -2.104 -0.999 48 A_C55:G66_A A 55 ? A 66 ? 19 1 1 A U 56 1_555 A A 65 1_555 0.050 -0.086 -0.103 -1.645 -3.330 -3.017 49 A_U56:A65_A A 56 ? A 65 ? 20 1 1 A A 57 1_555 A U 64 1_555 0.030 -0.082 -0.131 -3.605 -2.769 -3.114 50 A_A57:U64_A A 57 ? A 64 ? 20 1 1 A G 58 1_555 A C 63 1_555 -0.318 -0.106 0.013 0.186 9.489 2.636 51 A_G58:C63_A A 58 ? A 63 ? 19 1 1 A G 59 1_555 A A 62 1_555 6.767 -5.345 1.196 11.900 -5.814 -20.663 52 A_G59:A62_A A 59 ? A 62 ? ? ? 1 A A 76 1_555 A A 80 1_555 1.126 1.668 -1.269 2.028 49.636 -93.608 53 A_A76:A80_A A 76 ? A 80 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 130 1_555 A C 3 1_555 A G 129 1_555 0.034 -1.737 3.130 -0.134 4.337 33.626 -3.624 -0.077 2.890 7.458 0.230 33.897 1 AA_G2C3:G129C130_AA A 2 ? A 130 ? A 3 ? A 129 ? 1 A C 3 1_555 A G 129 1_555 A G 4 1_555 A C 128 1_555 0.048 -1.753 3.448 1.387 8.606 30.332 -4.800 0.165 2.855 16.035 -2.584 31.531 2 AA_C3G4:C128G129_AA A 3 ? A 129 ? A 4 ? A 128 ? 1 A G 4 1_555 A C 128 1_555 A A 5 1_555 A U 127 1_555 1.372 -1.878 3.708 7.285 14.108 27.206 -6.258 -1.091 2.706 27.247 -14.070 31.425 3 AA_G4A5:U127C128_AA A 4 ? A 128 ? A 5 ? A 127 ? 1 A A 5 1_555 A U 127 1_555 A U 6 1_555 A G 126 1_555 0.228 -1.308 2.835 4.254 6.700 40.372 -2.473 0.063 2.604 9.596 -6.093 41.113 4 AA_A5U6:G126U127_AA A 5 ? A 127 ? A 6 ? A 126 ? 1 A U 6 1_555 A G 126 1_555 A U 8 1_555 A A 125 1_555 -4.682 -0.383 2.748 3.804 32.790 54.508 -1.518 4.610 1.961 32.686 -3.792 63.062 5 AA_U6U8:A125G126_AA A 6 ? A 126 ? A 8 ? A 125 ? 1 A U 8 1_555 A A 125 1_555 A A 60 1_555 A A 7 1_555 1.953 -0.237 4.035 11.811 -8.511 -139.838 0.184 1.118 3.950 4.528 6.283 -140.175 6 AA_U8A60:A7A125_AA A 8 ? A 125 ? A 60 ? A 7 ? 1 A A 60 1_555 A A 7 1_555 A G 9 1_555 A C 122 1_555 -2.963 -4.557 4.948 26.705 19.454 -155.045 2.233 -1.382 5.257 -9.949 13.657 -156.091 7 AA_A60G9:C122A7_AA A 60 ? A 7 ? A 9 ? A 122 ? 1 A G 9 1_555 A C 122 1_555 A G 10 1_555 A C 121 1_555 0.960 -1.935 3.486 2.394 4.926 29.050 -4.869 -1.359 3.189 9.711 -4.719 29.551 8 AA_G9G10:C121C122_AA A 9 ? A 122 ? A 10 ? A 121 ? 1 A G 10 1_555 A C 121 1_555 A C 11 1_555 A G 120 1_555 -0.575 -1.272 3.183 -3.210 3.134 37.065 -2.388 0.489 3.106 4.908 5.027 37.326 9 AA_G10C11:G120C121_AA A 10 ? A 121 ? A 11 ? A 120 ? 1 A C 11 1_555 A G 120 1_555 A A 12 1_555 A U 119 1_555 0.018 -1.707 3.314 1.164 8.732 30.882 -4.570 0.165 2.741 15.994 -2.133 32.084 10 AA_C11A12:U119G120_AA A 11 ? A 120 ? A 12 ? A 119 ? 1 A A 12 1_555 A U 119 1_555 A U 13 1_555 A A 118 1_555 0.325 -1.690 3.349 0.604 7.183 32.135 -4.171 -0.474 2.918 12.777 -1.074 32.913 11 AA_A12U13:A118U119_AA A 12 ? A 119 ? A 13 ? A 118 ? 1 A U 13 1_555 A A 118 1_555 A G 14 1_555 A C 117 1_555 0.180 -1.663 3.311 0.225 9.675 31.595 -4.470 -0.280 2.699 17.269 -0.402 33.008 12 AA_U13G14:C117A118_AA A 13 ? A 118 ? A 14 ? A 117 ? 1 A G 14 1_555 A C 117 1_555 A G 15 1_555 A C 116 1_555 0.167 -1.645 3.267 -0.222 7.305 31.953 -4.105 -0.332 2.831 13.057 0.397 32.757 13 AA_G14G15:C116C117_AA A 14 ? A 117 ? A 15 ? A 116 ? 1 A G 15 1_555 A C 116 1_555 A A 16 1_555 A U 115 1_555 0.039 -1.613 3.215 -0.046 8.243 32.729 -4.017 -0.074 2.739 14.346 0.080 33.723 14 AA_G15A16:U115C116_AA A 15 ? A 116 ? A 16 ? A 115 ? 1 A A 16 1_555 A U 115 1_555 A A 17 1_555 A U 114 1_555 0.186 -1.666 3.238 0.011 7.580 31.744 -4.195 -0.330 2.776 13.616 -0.019 32.614 15 AA_A16A17:U114U115_AA A 16 ? A 115 ? A 17 ? A 114 ? 1 A A 17 1_555 A U 114 1_555 A U 18 1_555 A A 113 1_555 0.274 -1.698 3.298 0.618 6.742 32.150 -4.110 -0.384 2.896 12.007 -1.101 32.837 16 AA_A17U18:A113U114_AA A 17 ? A 114 ? A 18 ? A 113 ? 1 A U 18 1_555 A A 113 1_555 A C 19 1_555 A G 112 1_555 0.223 -1.714 3.258 0.004 7.664 32.655 -4.154 -0.386 2.795 13.400 -0.006 33.519 17 AA_U18C19:G112A113_AA A 18 ? A 113 ? A 19 ? A 112 ? 1 A G 21 1_555 A C 107 1_555 A C 22 1_555 A G 106 1_555 0.050 -1.749 3.094 -0.110 4.222 33.783 -3.603 -0.102 2.860 7.229 0.188 34.039 18 AA_G21C22:G106C107_AA A 21 ? A 107 ? A 22 ? A 106 ? 1 A C 22 1_555 A G 106 1_555 A U 23 1_555 A A 105 1_555 0.111 -1.799 3.320 1.952 5.981 30.653 -4.429 0.150 2.926 11.167 -3.645 31.276 19 AA_C22U23:A105G106_AA A 22 ? A 106 ? A 23 ? A 105 ? 1 A U 23 1_555 A A 105 1_555 A C 24 1_555 A G 104 1_555 0.309 -1.710 3.284 0.196 7.968 32.892 -4.155 -0.502 2.807 13.821 -0.339 33.818 20 AA_U23C24:G104A105_AA A 23 ? A 105 ? A 24 ? A 104 ? 1 A C 24 1_555 A G 104 1_555 A A 25 1_555 A U 103 1_555 0.015 -1.689 3.321 1.495 9.097 31.026 -4.553 0.223 2.727 16.554 -2.720 32.335 21 AA_C24A25:U103G104_AA A 24 ? A 104 ? A 25 ? A 103 ? 1 A A 25 1_555 A U 103 1_555 A A 26 1_555 A U 102 1_555 0.238 -1.657 3.265 0.166 7.936 32.033 -4.186 -0.393 2.787 14.112 -0.296 32.977 22 AA_A25A26:U102U103_AA A 25 ? A 103 ? A 26 ? A 102 ? 1 A A 26 1_555 A U 102 1_555 A G 27 1_555 A C 101 1_555 0.176 -1.740 3.391 -0.333 8.080 31.446 -4.493 -0.372 2.865 14.608 0.601 32.444 23 AA_A26G27:C101U102_AA A 26 ? A 102 ? A 27 ? A 101 ? 1 A G 27 1_555 A C 101 1_555 A G 28 1_555 A C 100 1_555 0.121 -1.672 3.276 -0.242 6.262 31.818 -4.046 -0.258 2.902 11.285 0.437 32.414 24 AA_G27G28:C100C101_AA A 27 ? A 101 ? A 28 ? A 100 ? 1 A G 28 1_555 A C 100 1_555 A A 29 1_555 A U 99 1_555 0.053 -1.614 3.215 -0.020 8.245 32.739 -4.018 -0.094 2.739 14.345 0.035 33.733 25 AA_G28A29:U99C100_AA A 28 ? A 100 ? A 29 ? A 99 ? 1 A A 29 1_555 A U 99 1_555 A A 30 1_555 A U 98 1_555 0.196 -1.659 3.221 0.098 7.413 31.723 -4.160 -0.334 2.774 13.333 -0.176 32.556 26 AA_A29A30:U98U99_AA A 29 ? A 99 ? A 30 ? A 98 ? 1 A A 30 1_555 A U 98 1_555 A C 31 1_555 A G 97 1_555 0.272 -1.700 3.225 -0.157 6.669 32.894 -3.970 -0.496 2.835 11.629 0.274 33.545 27 AA_A30C31:G97U98_AA A 30 ? A 98 ? A 31 ? A 97 ? 1 A C 31 1_555 A G 97 1_555 A U 32 1_555 A A 96 1_555 0.148 -1.779 3.330 1.766 6.269 30.535 -4.459 0.050 2.919 11.735 -3.306 31.205 28 AA_C31U32:A96G97_AA A 31 ? A 97 ? A 32 ? A 96 ? 1 A C 38 1_555 A G 93 1_555 A G 39 1_555 A C 92 1_555 -0.019 -1.906 3.477 1.119 8.231 30.836 -4.948 0.235 2.883 15.138 -2.057 31.909 29 AA_C38G39:C92G93_AA A 38 ? A 93 ? A 39 ? A 92 ? 1 A G 39 1_555 A C 92 1_555 A U 40 1_555 A A 91 1_555 0.145 -1.660 3.228 0.515 5.107 33.043 -3.688 -0.171 2.947 8.912 -0.898 33.428 30 AA_G39U40:A91C92_AA A 39 ? A 92 ? A 40 ? A 91 ? 1 A U 40 1_555 A A 91 1_555 A A 41 1_555 A U 90 1_555 0.120 -1.613 3.240 0.066 9.992 32.075 -4.301 -0.198 2.634 17.558 -0.115 33.556 31 AA_U40A41:U90A91_AA A 40 ? A 91 ? A 41 ? A 90 ? 1 A A 41 1_555 A U 90 1_555 A U 42 1_555 A A 89 1_555 0.312 -1.654 3.305 0.679 7.415 31.550 -4.212 -0.445 2.859 13.405 -1.227 32.395 32 AA_A41U42:A89U90_AA A 41 ? A 90 ? A 42 ? A 89 ? 1 A U 42 1_555 A A 89 1_555 A A 43 1_555 A U 88 1_555 0.143 -1.645 3.255 0.322 9.964 31.883 -4.391 -0.200 2.637 17.609 -0.568 33.367 33 AA_U42A43:U88A89_AA A 42 ? A 89 ? A 43 ? A 88 ? 1 A A 43 1_555 A U 88 1_555 A U 44 1_555 A A 87 1_555 0.284 -1.698 3.302 0.658 6.855 31.895 -4.165 -0.396 2.889 12.296 -1.180 32.611 34 AA_A43U44:A87U88_AA A 43 ? A 88 ? A 44 ? A 87 ? 1 A U 44 1_555 A A 87 1_555 A C 45 1_555 A G 86 1_555 0.242 -1.718 3.261 0.248 7.882 32.695 -4.180 -0.380 2.785 13.754 -0.432 33.608 35 AA_U44C45:G86A87_AA A 44 ? A 87 ? A 45 ? A 86 ? 1 A C 45 1_555 A G 86 1_555 A G 46 1_555 A C 85 1_555 0.102 -1.729 3.391 1.053 8.948 30.421 -4.756 -0.001 2.784 16.600 -1.953 31.696 36 AA_C45G46:C85G86_AA A 45 ? A 86 ? A 46 ? A 85 ? 1 A G 46 1_555 A C 85 1_555 A G 47 1_555 A C 84 1_555 0.214 -1.665 3.296 -0.184 7.219 32.124 -4.114 -0.408 2.863 12.843 0.327 32.905 37 AA_G46G47:C84C85_AA A 46 ? A 85 ? A 47 ? A 84 ? 1 A G 47 1_555 A C 84 1_555 A G 48 1_555 A G 83 1_555 -1.825 -0.080 2.794 19.573 5.386 20.288 -0.939 6.516 0.741 12.063 -43.839 28.625 38 AA_G47G48:G83C84_AA A 47 ? A 84 ? A 48 ? A 83 ? 1 A C 49 1_555 A G 72 1_555 A A 50 1_555 A U 71 1_555 -0.146 -1.861 3.446 1.205 8.866 31.497 -4.802 0.463 2.825 15.934 -2.166 32.713 39 AA_C49A50:U71G72_AA A 49 ? A 72 ? A 50 ? A 71 ? 1 A A 50 1_555 A U 71 1_555 A A 51 1_555 A U 70 1_555 0.161 -1.707 3.225 0.133 7.120 31.905 -4.183 -0.264 2.790 12.755 -0.238 32.670 40 AA_A50A51:U70U71_AA A 50 ? A 71 ? A 51 ? A 70 ? 1 A A 51 1_555 A U 70 1_555 A C 52 1_555 A G 69 1_555 0.297 -1.701 3.212 -0.019 5.906 32.675 -3.906 -0.522 2.869 10.392 0.033 33.190 41 AA_A51C52:G69U70_AA A 51 ? A 70 ? A 52 ? A 69 ? 1 A C 52 1_555 A G 69 1_555 A G 53 1_555 A C 68 1_555 0.068 -1.751 3.412 1.117 8.856 30.505 -4.777 0.075 2.807 16.395 -2.067 31.754 42 AA_C52G53:C68G69_AA A 52 ? A 69 ? A 53 ? A 68 ? 1 A G 53 1_555 A C 68 1_555 A A 54 1_555 A U 67 1_555 0.111 -1.613 3.206 -0.004 7.939 32.772 -3.977 -0.191 2.751 13.820 0.007 33.694 43 AA_G53A54:U67C68_AA A 53 ? A 68 ? A 54 ? A 67 ? 1 A A 54 1_555 A U 67 1_555 A C 55 1_555 A G 66 1_555 0.332 -1.683 3.209 -0.078 5.998 32.655 -3.889 -0.594 2.863 10.557 0.137 33.187 44 AA_A54C55:G66U67_AA A 54 ? A 67 ? A 55 ? A 66 ? 1 A C 55 1_555 A G 66 1_555 A U 56 1_555 A A 65 1_555 0.093 -1.789 3.375 1.595 7.247 30.759 -4.586 0.115 2.890 13.419 -2.953 31.621 45 AA_C55U56:A65G66_AA A 55 ? A 66 ? A 56 ? A 65 ? 1 A U 56 1_555 A A 65 1_555 A A 57 1_555 A U 64 1_555 0.180 -1.647 3.304 0.427 10.498 32.342 -4.391 -0.245 2.657 18.256 -0.743 33.962 46 AA_U56A57:U64A65_AA A 56 ? A 65 ? A 57 ? A 64 ? 1 A A 57 1_555 A U 64 1_555 A G 58 1_555 A C 63 1_555 -0.052 -1.432 3.426 -9.098 18.129 37.124 -3.792 -0.830 2.450 26.218 13.157 42.132 47 AA_A57G58:C63U64_AA A 57 ? A 64 ? A 58 ? A 63 ? 1 A G 58 1_555 A C 63 1_555 A G 59 1_555 A A 62 1_555 -2.528 -0.827 2.884 1.534 11.155 55.306 -1.412 2.751 2.621 11.880 -1.634 56.352 48 AA_G58G59:A62C63_AA A 58 ? A 63 ? A 59 ? A 62 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/Office of the Director' 'United States' 'S10 OD021600' 1 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' 'R21 AI145647' 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'P41GM103832, R01GM079429, U54GM103297, R35 GM112579' 3 # _atom_sites.entry_id 6WLK _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_