data_6WLQ # _entry.id 6WLQ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6WLQ pdb_00006wlq 10.2210/pdb6wlq/pdb WWPDB D_1000248533 ? ? EMDB EMD-21838 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-07-08 2 'Structure model' 1 1 2020-07-15 3 'Structure model' 1 2 2024-03-06 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.pdbx_database_id_PubMed' 5 2 'Structure model' '_citation.title' 6 2 'Structure model' '_citation_author.identifier_ORCID' 7 3 'Structure model' '_database_2.pdbx_DOI' 8 3 'Structure model' '_database_2.pdbx_database_accession' # _database_PDB_caveat.id 1 _database_PDB_caveat.text ;A A 5 HAS WRONG CHIRALITY AT ATOM C3' ; # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6WLQ _pdbx_database_status.recvd_initial_deposition_date 2020-04-20 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type EMDB . EMD-21838 'associated EM volume' EMDB . EMD-21831 'other EM volume' EMDB . EMD-21832 'other EM volume' EMDB . EMD-21833 'other EM volume' EMDB . EMD-21834 'other EM volume' EMDB . EMD-21835 'other EM volume' EMDB . EMD-21836 'other EM volume' EMDB . EMD-21839 'other EM volume' EMDB . EMD-21840 'other EM volume' EMDB . EMD-21841 'other EM volume' EMDB . EMD-21842 'other EM volume' # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kappel, K.' 1 0000-0002-2129-199X 'Zhang, K.' 2 ? 'Su, Z.' 3 ? 'Watkins, A.M.' 4 ? 'Kladwang, W.' 5 ? 'Li, S.' 6 ? 'Pintilie, G.' 7 ? 'Topkar, V.V.' 8 ? 'Rangan, R.' 9 ? 'Zheludev, I.N.' 10 ? 'Yesselman, J.D.' 11 ? 'Chiu, W.' 12 ? 'Das, R.' 13 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Methods _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1548-7105 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 17 _citation.language ? _citation.page_first 699 _citation.page_last 707 _citation.title 'Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41592-020-0878-9 _citation.pdbx_database_id_PubMed 32616928 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kappel, K.' 1 ? primary 'Zhang, K.' 2 ? primary 'Su, Z.' 3 ? primary 'Watkins, A.M.' 4 ? primary 'Kladwang, W.' 5 ? primary 'Li, S.' 6 ? primary 'Pintilie, G.' 7 ? primary 'Topkar, V.V.' 8 ? primary 'Rangan, R.' 9 ? primary 'Zheludev, I.N.' 10 ? primary 'Yesselman, J.D.' 11 ? primary 'Chiu, W.' 12 ? primary 'Das, R.' 13 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (119-MER)' _entity.formula_weight 38522.906 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCA GGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCA GGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 C n 1 5 A n 1 6 U n 1 7 G n 1 8 A n 1 9 G n 1 10 U n 1 11 G n 1 12 C n 1 13 C n 1 14 A n 1 15 G n 1 16 C n 1 17 G n 1 18 U n 1 19 C n 1 20 A n 1 21 A n 1 22 G n 1 23 C n 1 24 C n 1 25 C n 1 26 C n 1 27 G n 1 28 G n 1 29 C n 1 30 U n 1 31 U n 1 32 G n 1 33 C n 1 34 U n 1 35 G n 1 36 G n 1 37 C n 1 38 C n 1 39 G n 1 40 G n 1 41 C n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 C n 1 47 U n 1 48 C n 1 49 C n 1 50 A n 1 51 A n 1 52 C n 1 53 C n 1 54 G n 1 55 C n 1 56 G n 1 57 G n 1 58 U n 1 59 G n 1 60 G n 1 61 G n 1 62 G n 1 63 U n 1 64 G n 1 65 C n 1 66 C n 1 67 C n 1 68 C n 1 69 G n 1 70 G n 1 71 G n 1 72 U n 1 73 G n 1 74 A n 1 75 U n 1 76 G n 1 77 A n 1 78 C n 1 79 C n 1 80 A n 1 81 G n 1 82 G n 1 83 U n 1 84 U n 1 85 G n 1 86 A n 1 87 G n 1 88 U n 1 89 A n 1 90 G n 1 91 C n 1 92 C n 1 93 G n 1 94 U n 1 95 G n 1 96 A n 1 97 C n 1 98 G n 1 99 G n 1 100 C n 1 101 U n 1 102 A n 1 103 C n 1 104 G n 1 105 C n 1 106 G n 1 107 G n 1 108 C n 1 109 A n 1 110 A n 1 111 G n 1 112 C n 1 113 G n 1 114 C n 1 115 G n 1 116 G n 1 117 G n 1 118 U n 1 119 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 119 _pdbx_entity_src_syn.organism_scientific 'Mycobacterium sp.' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 1785 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 C 4 4 4 C C A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 C 13 13 13 C C A . n A 1 14 A 14 14 14 A A A . n A 1 15 G 15 15 15 G G A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 C 29 29 29 C C A . n A 1 30 U 30 30 30 U U A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 C 33 33 33 C C A . n A 1 34 U 34 34 34 U U A . n A 1 35 G 35 35 35 G G A . n A 1 36 G 36 36 36 G G A . n A 1 37 C 37 37 37 C C A . n A 1 38 C 38 38 38 C C A . n A 1 39 G 39 39 39 G G A . n A 1 40 G 40 40 40 G G A . n A 1 41 C 41 41 41 C C A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 C 44 44 44 C C A . n A 1 45 C 45 45 45 C C A . n A 1 46 C 46 46 46 C C A . n A 1 47 U 47 47 47 U U A . n A 1 48 C 48 48 48 C C A . n A 1 49 C 49 49 49 C C A . n A 1 50 A 50 50 50 A A A . n A 1 51 A 51 51 51 A A A . n A 1 52 C 52 52 52 C C A . n A 1 53 C 53 53 53 C C A . n A 1 54 G 54 54 54 G G A . n A 1 55 C 55 55 55 C C A . n A 1 56 G 56 56 56 G G A . n A 1 57 G 57 57 57 G G A . n A 1 58 U 58 58 58 U U A . n A 1 59 G 59 59 59 G G A . n A 1 60 G 60 60 60 G G A . n A 1 61 G 61 61 61 G G A . n A 1 62 G 62 62 62 G G A . n A 1 63 U 63 63 63 U U A . n A 1 64 G 64 64 64 G G A . n A 1 65 C 65 65 65 C C A . n A 1 66 C 66 66 66 C C A . n A 1 67 C 67 67 67 C C A . n A 1 68 C 68 68 68 C C A . n A 1 69 G 69 69 69 G G A . n A 1 70 G 70 70 70 G G A . n A 1 71 G 71 71 71 G G A . n A 1 72 U 72 72 72 U U A . n A 1 73 G 73 73 73 G G A . n A 1 74 A 74 74 74 A A A . n A 1 75 U 75 75 75 U U A . n A 1 76 G 76 76 76 G G A . n A 1 77 A 77 77 77 A A A . n A 1 78 C 78 78 78 C C A . n A 1 79 C 79 79 79 C C A . n A 1 80 A 80 80 80 A A A . n A 1 81 G 81 81 81 G G A . n A 1 82 G 82 82 82 G G A . n A 1 83 U 83 83 83 U U A . n A 1 84 U 84 84 84 U U A . n A 1 85 G 85 85 85 G G A . n A 1 86 A 86 86 86 A A A . n A 1 87 G 87 87 87 G G A . n A 1 88 U 88 88 88 U U A . n A 1 89 A 89 89 89 A A A . n A 1 90 G 90 90 90 G G A . n A 1 91 C 91 91 91 C C A . n A 1 92 C 92 92 92 C C A . n A 1 93 G 93 93 93 G G A . n A 1 94 U 94 94 94 U U A . n A 1 95 G 95 95 95 G G A . n A 1 96 A 96 96 96 A A A . n A 1 97 C 97 97 97 C C A . n A 1 98 G 98 98 98 G G A . n A 1 99 G 99 99 99 G G A . n A 1 100 C 100 100 100 C C A . n A 1 101 U 101 101 101 U U A . n A 1 102 A 102 102 102 A A A . n A 1 103 C 103 103 103 C C A . n A 1 104 G 104 104 104 G G A . n A 1 105 C 105 105 105 C C A . n A 1 106 G 106 106 106 G G A . n A 1 107 G 107 107 107 G G A . n A 1 108 C 108 108 108 C C A . n A 1 109 A 109 109 109 A A A . n A 1 110 A 110 110 110 A A A . n A 1 111 G 111 111 111 G G A . n A 1 112 C 112 112 112 C C A . n A 1 113 G 113 113 113 G G A . n A 1 114 C 114 114 114 C C A . n A 1 115 G 115 115 115 G G A . n A 1 116 G 116 116 116 G G A . n A 1 117 G 117 117 117 G G A . n A 1 118 U 118 118 118 U U A . n A 1 119 C 119 119 119 C C A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 2 2 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 3 3 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 4 4 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 5 5 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 6 6 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 7 7 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 8 8 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 9 9 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 10 10 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 11 11 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 12 12 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 13 13 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 14 14 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 15 15 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 16 16 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 17 17 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 18 18 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 19 19 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 20 20 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6WLQ _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 6WLQ _struct.title 'Apo SAM-IV riboswitch models, 4.7 Angstrom resolution' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6WLQ _struct_keywords.text 'aptamer, riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code CP000384.1 _struct_ref.pdbx_db_accession 108767400 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCA GGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC ; _struct_ref.pdbx_align_begin 1307439 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6WLQ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 119 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 108767400 _struct_ref_seq.db_align_beg 1307439 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 1307321 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 119 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 19470 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 1 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 1 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 1 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 78 N3 ? ? A G 2 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 78 O2 ? ? A G 2 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 78 N4 ? ? A G 2 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 77 N1 ? ? A U 3 A A 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 77 N6 ? ? A U 3 A A 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 76 N1 ? ? A C 4 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 76 O6 ? ? A C 4 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 76 N2 ? ? A C 4 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 75 O4 ? ? A A 5 A U 75 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog13 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 9 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 9 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 9 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 37 N3 ? ? A G 11 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 37 O2 ? ? A G 11 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 37 N4 ? ? A G 11 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 12 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 12 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 12 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 35 N1 ? ? A C 13 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 35 O6 ? ? A C 13 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 35 N2 ? ? A C 13 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 34 N3 ? ? A A 14 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 34 O4 ? ? A A 14 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 15 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 15 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 15 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 16 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 16 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 16 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 17 N2 ? ? ? 1_555 A A 20 N1 ? ? A G 17 A A 20 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog34 hydrog ? ? A A 21 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 21 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 21 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 21 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 22 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 22 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 22 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 22 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 22 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 22 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 71 N1 ? ? A C 24 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 71 O6 ? ? A C 24 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 71 N2 ? ? A C 24 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 70 N1 ? ? A C 25 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 70 O6 ? ? A C 25 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 70 N2 ? ? A C 25 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 26 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 26 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 26 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 68 N3 ? ? A G 27 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 68 O2 ? ? A G 27 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 68 N4 ? ? A G 27 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 28 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 28 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 28 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 39 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 39 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 39 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 39 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 39 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 39 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 65 N3 ? ? A G 40 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 65 O2 ? ? A G 40 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 65 N4 ? ? A G 40 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 41 N3 ? ? ? 1_555 A G 64 N1 ? ? A C 41 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 41 N4 ? ? ? 1_555 A G 64 O6 ? ? A C 41 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 41 O2 ? ? ? 1_555 A G 64 N2 ? ? A C 41 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A A 42 N1 ? ? ? 1_555 A C 44 N4 ? ? A A 42 A C 44 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog64 hydrog ? ? A A 42 N1 ? ? ? 1_555 A U 63 N3 ? ? A A 42 A U 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A A 42 N6 ? ? ? 1_555 A U 63 O4 ? ? A A 42 A U 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A A 43 N6 ? ? ? 1_555 A U 63 O2 ? ? A A 43 A U 63 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog67 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 44 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 44 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 44 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A C 45 N3 ? ? ? 1_555 A G 61 N1 ? ? A C 45 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A C 45 N4 ? ? ? 1_555 A G 61 O6 ? ? A C 45 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 45 O2 ? ? ? 1_555 A G 61 N2 ? ? A C 45 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 46 N3 ? ? ? 1_555 A G 60 N1 ? ? A C 46 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 46 N4 ? ? ? 1_555 A G 60 O6 ? ? A C 46 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 46 O2 ? ? ? 1_555 A G 60 N2 ? ? A C 46 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A U 47 N3 ? ? ? 1_555 A G 59 O6 ? ? A U 47 A G 59 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog77 hydrog ? ? A U 47 O2 ? ? ? 1_555 A G 59 N1 ? ? A U 47 A G 59 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog78 hydrog ? ? A C 48 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 48 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 48 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 48 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A C 48 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 48 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 49 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 49 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 49 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 49 O2 ? ? ? 1_555 A C 112 N4 ? ? A C 49 A C 112 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog85 hydrog ? ? A A 50 N1 ? ? ? 1_555 A C 119 N4 ? ? A A 50 A C 119 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog86 hydrog ? ? A A 51 N1 ? ? ? 1_555 A G 117 N1 ? ? A A 51 A G 117 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog87 hydrog ? ? A A 51 N6 ? ? ? 1_555 A G 117 O6 ? ? A A 51 A G 117 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog88 hydrog ? ? A C 52 N3 ? ? ? 1_555 A G 116 N1 ? ? A C 52 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 52 N4 ? ? ? 1_555 A G 116 O6 ? ? A C 52 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 52 O2 ? ? ? 1_555 A G 116 N2 ? ? A C 52 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 53 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 53 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A C 53 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 53 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A C 53 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 53 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 54 N1 ? ? ? 1_555 A C 114 N3 ? ? A G 54 A C 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 54 N2 ? ? ? 1_555 A C 114 O2 ? ? A G 54 A C 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A G 54 O6 ? ? ? 1_555 A C 114 N4 ? ? A G 54 A C 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 55 N3 ? ? ? 1_555 A G 113 N1 ? ? A C 55 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 55 N4 ? ? ? 1_555 A G 113 O6 ? ? A C 55 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 55 O2 ? ? ? 1_555 A G 113 N2 ? ? A C 55 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A G 57 N3 ? ? ? 1_555 A C 112 N4 ? ? A G 57 A C 112 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog101 hydrog ? ? A A 80 N6 ? ? ? 1_555 A A 110 N1 ? ? A A 80 A A 110 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog102 hydrog ? ? A G 81 N1 ? ? ? 1_555 A A 109 N1 ? ? A G 81 A A 109 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog103 hydrog ? ? A G 81 O6 ? ? ? 1_555 A A 109 N6 ? ? A G 81 A A 109 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog104 hydrog ? ? A G 82 N1 ? ? ? 1_555 A C 108 N3 ? ? A G 82 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A G 82 N2 ? ? ? 1_555 A C 108 O2 ? ? A G 82 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A G 82 O6 ? ? ? 1_555 A C 108 N4 ? ? A G 82 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A U 83 N3 ? ? ? 1_555 A G 107 O6 ? ? A U 83 A G 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog108 hydrog ? ? A U 83 O2 ? ? ? 1_555 A G 107 N1 ? ? A U 83 A G 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog109 hydrog ? ? A U 84 N3 ? ? ? 1_555 A G 106 O6 ? ? A U 84 A G 106 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog110 hydrog ? ? A U 84 O2 ? ? ? 1_555 A G 106 N1 ? ? A U 84 A G 106 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog111 hydrog ? ? A G 85 N1 ? ? ? 1_555 A C 105 N3 ? ? A G 85 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A G 85 N2 ? ? ? 1_555 A C 105 O2 ? ? A G 85 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A G 85 O6 ? ? ? 1_555 A C 105 N4 ? ? A G 85 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A A 86 N1 ? ? ? 1_555 A G 104 N1 ? ? A A 86 A G 104 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog115 hydrog ? ? A A 86 N6 ? ? ? 1_555 A G 104 O6 ? ? A A 86 A G 104 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog116 hydrog ? ? A G 87 N1 ? ? ? 1_555 A C 103 N3 ? ? A G 87 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A G 87 N2 ? ? ? 1_555 A C 103 O2 ? ? A G 87 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A G 87 O6 ? ? ? 1_555 A C 103 N4 ? ? A G 87 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A U 88 N3 ? ? ? 1_555 A A 102 N1 ? ? A U 88 A A 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A U 88 O4 ? ? ? 1_555 A A 102 N6 ? ? A U 88 A A 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A A 89 N1 ? ? ? 1_555 A U 101 N3 ? ? A A 89 A U 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A A 89 N6 ? ? ? 1_555 A U 101 O4 ? ? A A 89 A U 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A G 90 N1 ? ? ? 1_555 A C 100 N3 ? ? A G 90 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A G 90 N2 ? ? ? 1_555 A C 100 O2 ? ? A G 90 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A G 90 O6 ? ? ? 1_555 A C 100 N4 ? ? A G 90 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A C 91 N3 ? ? ? 1_555 A G 99 N1 ? ? A C 91 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A C 91 N4 ? ? ? 1_555 A G 99 O6 ? ? A C 91 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A C 91 O2 ? ? ? 1_555 A G 99 N2 ? ? A C 91 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A C 92 N3 ? ? ? 1_555 A G 98 N1 ? ? A C 92 A G 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A C 92 N4 ? ? ? 1_555 A G 98 O6 ? ? A C 92 A G 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A C 92 O2 ? ? ? 1_555 A G 98 N2 ? ? A C 92 A G 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A G 93 N1 ? ? ? 1_555 A C 97 N3 ? ? A G 93 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A G 93 N2 ? ? ? 1_555 A C 97 O2 ? ? A G 93 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A G 93 O6 ? ? ? 1_555 A C 97 N4 ? ? A G 93 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 3 "O2'" A U 3 ? ? OP2 A C 44 ? ? 2.10 2 4 H61 A A 5 ? ? O4 A U 75 ? ? 1.55 3 4 "O2'" A G 59 ? ? O6 A G 111 ? ? 2.15 4 6 "O4'" A C 24 ? ? H61 A A 74 ? ? 1.60 5 12 "O2'" A C 49 ? ? OP2 A G 113 ? ? 2.04 6 14 "HO2'" A G 9 ? ? OP2 A G 11 ? ? 1.54 7 14 "O4'" A C 49 ? ? OP2 A C 112 ? ? 2.16 8 15 "HO2'" A U 30 ? ? OP2 A G 32 ? ? 1.57 9 16 "O2'" A G 59 ? ? N2 A G 111 ? ? 2.17 10 18 "O2'" A C 45 ? ? "O4'" A A 80 ? ? 2.14 11 19 "HO2'" A C 49 ? ? OP2 A G 113 ? ? 1.56 12 20 "HO2'" A A 74 ? ? O6 A G 76 ? ? 1.57 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 9 "C2'" A U 63 ? ? "C1'" A U 63 ? ? 1.469 1.526 -0.057 0.008 N 2 13 "O3'" A G 22 ? ? P A C 23 ? ? 1.680 1.607 0.073 0.012 Y 3 18 "O4'" A C 38 ? ? "C1'" A C 38 ? ? 1.500 1.415 0.085 0.012 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C5'" A A 42 ? ? "C4'" A A 42 ? ? "O4'" A A 42 ? ? 118.69 109.80 8.89 0.90 N 2 5 "C2'" A A 8 ? ? "C3'" A A 8 ? ? "O3'" A A 8 ? ? 124.80 113.70 11.10 1.60 N 3 9 "O4'" A G 59 ? ? "C1'" A G 59 ? ? N9 A G 59 ? ? 112.98 108.50 4.48 0.70 N 4 10 "O4'" A C 38 ? ? "C1'" A C 38 ? ? N1 A C 38 ? ? 114.48 108.50 5.98 0.70 N 5 13 "O4'" A C 23 ? ? "C1'" A C 23 ? ? N1 A C 23 ? ? 113.35 108.50 4.85 0.70 N 6 14 "C3'" A A 51 ? ? "C2'" A A 51 ? ? "C1'" A A 51 ? ? 95.92 101.30 -5.38 0.70 N 7 15 "O4'" A A 80 ? ? "C1'" A A 80 ? ? N9 A A 80 ? ? 113.24 108.50 4.74 0.70 N 8 18 "C3'" A A 8 ? ? "C2'" A A 8 ? ? "C1'" A A 8 ? ? 96.24 101.30 -5.06 0.70 N 9 18 "O4'" A C 38 ? ? "C1'" A C 38 ? ? N1 A C 38 ? ? 115.86 108.50 7.36 0.70 N 10 19 "C2'" A A 5 ? ? "C3'" A A 5 ? ? "O3'" A A 5 ? ? 139.64 113.70 25.94 1.60 N 11 19 "C5'" A G 7 ? ? "C4'" A G 7 ? ? "O4'" A G 7 ? ? 116.52 109.80 6.72 0.90 N # _pdbx_validate_chiral.id 1 _pdbx_validate_chiral.PDB_model_num 19 _pdbx_validate_chiral.auth_atom_id "C3'" _pdbx_validate_chiral.label_alt_id ? _pdbx_validate_chiral.auth_asym_id A _pdbx_validate_chiral.auth_comp_id A _pdbx_validate_chiral.auth_seq_id 5 _pdbx_validate_chiral.PDB_ins_code ? _pdbx_validate_chiral.details PLANAR _pdbx_validate_chiral.omega . # _em_3d_fitting.entry_id 6WLQ _em_3d_fitting.id 1 _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_protocol ? _em_3d_fitting.ref_space ? _em_3d_fitting.target_criteria ? _em_3d_fitting.method ? # _em_3d_reconstruction.entry_id 6WLQ _em_3d_reconstruction.id 1 _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.details ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.num_particles 260244 _em_3d_reconstruction.resolution 4.7 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.symmetry_type POINT _em_3d_reconstruction.method ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.magnification_calibration ? # _em_buffer.id 1 _em_buffer.details ? _em_buffer.pH 8.0 _em_buffer.specimen_id 1 _em_buffer.name ? # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.details 'RNA generated by in vitro transcription' _em_entity_assembly.name 'Apo SAM-IV riboswitch' _em_entity_assembly.source NATURAL _em_entity_assembly.type COMPLEX _em_entity_assembly.entity_id_list 1 _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? # _em_imaging.id 1 _em_imaging.entry_id 6WLQ _em_imaging.accelerating_voltage 300 _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.calibrated_defocus_max ? _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_magnification ? _em_imaging.cryogen ? _em_imaging.details ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.microscope_model 'FEI TITAN KRIOS' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_max ? _em_imaging.nominal_defocus_min ? _em_imaging.nominal_magnification ? _em_imaging.recording_temperature_maximum ? _em_imaging.recording_temperature_minimum ? _em_imaging.residual_tilt ? _em_imaging.specimen_holder_model ? _em_imaging.specimen_id 1 _em_imaging.citation_id ? _em_imaging.date ? _em_imaging.temperature ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.astigmatism ? _em_imaging.detector_distance ? _em_imaging.electron_beam_tilt_params ? _em_imaging.specimen_holder_type ? # _em_sample_support.citation_id ? _em_sample_support.details unspecified _em_sample_support.film_material ? _em_sample_support.grid_material ? _em_sample_support.grid_mesh_size ? _em_sample_support.grid_type ? _em_sample_support.id 1 _em_sample_support.method ? _em_sample_support.specimen_id 1 # _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.chamber_temperature ? _em_vitrification.cryogen_name ETHANE _em_vitrification.details ? _em_vitrification.humidity ? _em_vitrification.instrument ? _em_vitrification.entry_id 6WLQ _em_vitrification.citation_id ? _em_vitrification.method ? _em_vitrification.temp ? _em_vitrification.time_resolved_state ? # _em_experiment.entry_id 6WLQ _em_experiment.id 1 _em_experiment.aggregation_state PARTICLE _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_ctf_correction.id 1 _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.type 'PHASE FLIPPING ONLY' _em_ctf_correction.details ? # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.experimental_flag YES _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.039 # _em_entity_assembly_naturalsource.id 1 _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.ncbi_tax_id 32630 _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organism 'synthetic construct' _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? # _em_image_processing.id 1 _em_image_processing.image_recording_id 1 _em_image_processing.details ? # _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.avg_electron_dose_per_image 45.6 _em_image_recording.average_exposure_time ? _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K2 SUMMIT (4k x 4k)' _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.id _em_software.category _em_software.details _em_software.name _em_software.version _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id 1 'PARTICLE SELECTION' ? ? ? 1 ? ? 2 'IMAGE ACQUISITION' ? ? ? ? ? 1 3 MASKING ? ? ? ? ? ? 4 'CTF CORRECTION' ? ? ? 1 ? ? 5 'LAYERLINE INDEXING' ? ? ? ? ? ? 6 'DIFFRACTION INDEXING' ? ? ? ? ? ? 7 'MODEL FITTING' ? ? ? ? ? ? 8 'MODEL REFINEMENT' ? ? ? ? ? ? 9 OTHER ? ? ? ? ? ? 10 'INITIAL EULER ASSIGNMENT' ? ? ? 1 ? ? 11 'FINAL EULER ASSIGNMENT' ? ? ? 1 ? ? 12 CLASSIFICATION ? ? ? 1 ? ? 13 RECONSTRUCTION ? ? ? 1 ? ? # _em_specimen.id 1 _em_specimen.experiment_id 1 _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6WLQ 'double helix' 6WLQ 'a-form double helix' 6WLQ 'hairpin loop' 6WLQ 'bulge loop' 6WLQ 'mismatched base pair' 6WLQ 'internal loop' 6WLQ 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 79 1_555 -0.145 -0.138 -0.130 -5.354 -4.829 -0.809 1 A_G1:C79_A A 1 ? A 79 ? 19 1 1 A G 2 1_555 A C 78 1_555 0.229 -0.305 0.632 -5.473 -13.394 -8.473 2 A_G2:C78_A A 2 ? A 78 ? 19 1 1 A U 3 1_555 A A 77 1_555 0.159 -0.185 -0.058 -1.969 -17.289 -2.321 3 A_U3:A77_A A 3 ? A 77 ? 20 1 1 A C 4 1_555 A G 76 1_555 0.164 -0.123 -0.007 -1.176 -0.624 -1.271 4 A_C4:G76_A A 4 ? A 76 ? 19 1 1 A A 5 1_555 A U 75 1_555 0.360 -2.872 0.375 18.362 -8.933 143.893 5 A_A5:U75_A A 5 ? A 75 ? ? ? 1 A A 20 1_555 A G 17 1_555 -3.388 3.548 2.407 -28.569 -36.654 93.503 6 A_A20:G17_A A 20 ? A 17 ? ? 5 1 A G 32 1_555 A C 16 1_555 -0.164 -0.127 -0.045 -0.614 -2.725 -1.188 7 A_G32:C16_A A 32 ? A 16 ? 19 1 1 A C 33 1_555 A G 15 1_555 0.107 -0.121 -0.124 5.230 -4.410 -1.671 8 A_C33:G15_A A 33 ? A 15 ? 19 1 1 A U 34 1_555 A A 14 1_555 -0.035 -0.075 -0.162 4.024 -2.761 -3.808 9 A_U34:A14_A A 34 ? A 14 ? 20 1 1 A G 35 1_555 A C 13 1_555 -0.153 -0.131 -0.052 0.540 -0.792 -1.258 10 A_G35:C13_A A 35 ? A 13 ? 19 1 1 A G 36 1_555 A C 12 1_555 -0.165 -0.133 -0.046 0.099 -2.442 -0.886 11 A_G36:C12_A A 36 ? A 12 ? 19 1 1 A C 37 1_555 A G 11 1_555 0.137 -0.136 -0.113 5.005 -5.574 -1.076 12 A_C37:G11_A A 37 ? A 11 ? 19 1 1 A C 38 1_555 A G 9 1_555 0.006 -0.168 -0.057 12.713 -23.256 -1.538 13 A_C38:G9_A A 38 ? A 9 ? 19 1 1 A G 39 1_555 A C 66 1_555 -0.145 -0.138 -0.130 -5.373 -4.850 -0.812 14 A_G39:C66_A A 39 ? A 66 ? 19 1 1 A G 40 1_555 A C 65 1_555 -0.114 -0.119 -0.130 -6.941 -4.969 -1.678 15 A_G40:C65_A A 40 ? A 65 ? 19 1 1 A C 41 1_555 A G 64 1_555 0.080 -0.179 0.675 -21.108 -12.325 -9.183 16 A_C41:G64_A A 41 ? A 64 ? 19 1 1 A A 42 1_555 A U 63 1_555 -0.134 -0.305 1.148 -5.073 -41.179 -7.953 17 A_A42:U63_A A 42 ? A 63 ? 20 1 1 A C 44 1_555 A G 62 1_555 0.152 -0.139 -0.080 2.080 -3.824 -0.688 18 A_C44:G62_A A 44 ? A 62 ? 19 1 1 A C 45 1_555 A G 61 1_555 0.170 -0.138 -0.065 -0.959 -1.085 -0.815 19 A_C45:G61_A A 45 ? A 61 ? 19 1 1 A C 46 1_555 A G 60 1_555 0.165 -0.131 -0.060 -0.731 -0.988 -1.255 20 A_C46:G60_A A 46 ? A 60 ? 19 1 1 A U 47 1_555 A G 59 1_555 1.972 -0.613 -0.312 -9.621 0.006 -16.398 21 A_U47:G59_A A 47 ? A 59 ? 28 1 1 A C 48 1_555 A G 57 1_555 0.151 -0.140 -0.079 2.053 -3.801 -0.699 22 A_C48:G57_A A 48 ? A 57 ? 19 1 1 A C 49 1_555 A G 56 1_555 0.167 -0.138 -0.064 -0.956 -1.130 -0.845 23 A_C49:G56_A A 49 ? A 56 ? 19 1 1 A G 113 1_555 A C 55 1_555 -0.165 -0.125 -0.037 -0.090 -1.850 -1.025 24 A_G113:C55_A A 113 ? A 55 ? 19 1 1 A C 114 1_555 A G 54 1_555 0.097 -0.125 -0.140 5.661 -3.656 -1.993 25 A_C114:G54_A A 114 ? A 54 ? 19 1 1 A G 115 1_555 A C 53 1_555 -0.163 -0.132 -0.056 0.864 -0.471 -0.923 26 A_G115:C53_A A 115 ? A 53 ? 19 1 1 A G 116 1_555 A C 52 1_555 -0.155 -0.138 -0.071 -1.835 -3.225 -0.560 27 A_G116:C52_A A 116 ? A 52 ? 19 1 1 A G 117 1_555 A A 51 1_555 0.135 0.821 -1.545 -18.788 -5.752 -20.570 28 A_G117:A51_A A 117 ? A 51 ? 8 1 1 A C 119 1_555 A A 50 1_555 -2.010 0.108 -0.945 -40.772 8.370 -8.096 29 A_C119:A50_A A 119 ? A 50 ? ? 1 1 A A 21 1_555 A U 30 1_555 -0.043 -0.122 -0.202 -1.101 -7.563 -0.938 30 A_A21:U30_A A 21 ? A 30 ? 20 1 1 A G 22 1_555 A C 29 1_555 -0.120 -0.131 -0.165 -7.015 -5.224 -1.180 31 A_G22:C29_A A 22 ? A 29 ? 19 1 1 A C 67 1_555 A G 28 1_555 0.105 -0.122 -0.108 6.011 -5.416 -1.879 32 A_C67:G28_A A 67 ? A 28 ? 19 1 1 A C 68 1_555 A G 27 1_555 0.089 -0.123 -0.153 5.740 -3.559 -2.148 33 A_C68:G27_A A 68 ? A 27 ? 19 1 1 A G 69 1_555 A C 26 1_555 -0.158 -0.133 -0.050 0.960 -0.807 -1.234 34 A_G69:C26_A A 69 ? A 26 ? 19 1 1 A G 70 1_555 A C 25 1_555 -0.168 -0.139 -0.064 0.968 -1.117 -0.815 35 A_G70:C25_A A 70 ? A 25 ? 19 1 1 A G 71 1_555 A C 24 1_555 -0.152 -0.140 -0.079 -2.060 -3.793 -0.678 36 A_G71:C24_A A 71 ? A 24 ? 19 1 1 A A 80 1_555 A A 110 1_555 -2.119 1.304 1.070 -9.240 24.576 -19.203 37 A_A80:A110_A A 80 ? A 110 ? ? 1 1 A G 81 1_555 A A 109 1_555 0.045 1.080 1.064 17.255 28.262 -1.832 38 A_G81:A109_A A 81 ? A 109 ? 8 1 1 A G 82 1_555 A C 108 1_555 -0.135 -0.127 -0.106 -5.113 -5.341 -1.482 39 A_G82:C108_A A 82 ? A 108 ? 19 1 1 A U 83 1_555 A G 107 1_555 2.116 -0.451 0.011 -4.078 -1.125 -2.360 40 A_U83:G107_A A 83 ? A 107 ? 28 1 1 A U 84 1_555 A G 106 1_555 2.139 -0.490 -0.022 -5.015 -1.616 -1.314 41 A_U84:G106_A A 84 ? A 106 ? 28 1 1 A G 85 1_555 A C 105 1_555 -0.113 -0.132 -0.232 -10.790 -5.709 -1.400 42 A_G85:C105_A A 85 ? A 105 ? 19 1 1 A A 86 1_555 A G 104 1_555 -0.105 1.093 -1.081 -12.362 -4.154 -15.124 43 A_A86:G104_A A 86 ? A 104 ? 8 1 1 A G 87 1_555 A C 103 1_555 -0.103 -0.276 0.654 -1.165 -14.178 -6.006 44 A_G87:C103_A A 87 ? A 103 ? 19 1 1 A U 88 1_555 A A 102 1_555 0.030 -0.061 0.067 1.130 -0.511 -3.552 45 A_U88:A102_A A 88 ? A 102 ? 20 1 1 A A 89 1_555 A U 101 1_555 -0.001 -0.091 -0.054 2.719 -4.455 -1.818 46 A_A89:U101_A A 89 ? A 101 ? 20 1 1 A G 90 1_555 A C 100 1_555 -0.129 -0.120 -0.114 -4.602 -4.546 -1.255 47 A_G90:C100_A A 90 ? A 100 ? 19 1 1 A C 91 1_555 A G 99 1_555 0.171 -0.128 -0.041 0.389 -2.248 -0.772 48 A_C91:G99_A A 91 ? A 99 ? 19 1 1 A C 92 1_555 A G 98 1_555 0.003 -0.185 0.084 4.287 -17.226 -5.384 49 A_C92:G98_A A 92 ? A 98 ? 19 1 1 A G 93 1_555 A C 97 1_555 -0.064 -0.227 0.219 16.418 0.468 -2.825 50 A_G93:C97_A A 93 ? A 97 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 79 1_555 A G 2 1_555 A C 78 1_555 -0.416 -1.848 3.325 -2.827 -5.815 34.105 -2.147 0.234 3.603 -9.805 4.767 34.695 1 AA_G1G2:C78C79_AA A 1 ? A 79 ? A 2 ? A 78 ? 1 A G 2 1_555 A C 78 1_555 A U 3 1_555 A A 77 1_555 0.412 -1.485 3.267 11.777 22.052 38.084 -3.721 0.423 2.175 30.164 -16.109 45.301 2 AA_G2U3:A77C78_AA A 2 ? A 78 ? A 3 ? A 77 ? 1 A U 3 1_555 A A 77 1_555 A C 4 1_555 A G 76 1_555 0.553 -1.432 3.432 -0.468 -5.307 34.052 -1.526 -1.012 3.600 -8.993 0.793 34.454 3 AA_U3C4:G76A77_AA A 3 ? A 77 ? A 4 ? A 76 ? 1 A C 4 1_555 A G 76 1_555 A A 5 1_555 A U 75 1_555 -2.162 -3.209 0.659 -162.874 26.215 118.760 -1.652 0.808 1.391 13.272 82.462 172.361 4 AA_C4A5:U75G76_AA A 4 ? A 76 ? A 5 ? A 75 ? 1 A A 20 1_555 A G 17 1_555 A G 32 1_555 A C 16 1_555 0.005 -3.097 2.725 11.898 23.885 -8.695 -1.905 4.144 3.484 -64.693 32.226 -28.041 5 AA_A20G32:C16G17_AA A 20 ? A 17 ? A 32 ? A 16 ? 1 A G 32 1_555 A C 16 1_555 A C 33 1_555 A G 15 1_555 -0.224 -1.645 3.099 0.042 4.684 33.233 -3.551 0.394 2.847 8.140 -0.073 33.552 6 AA_G32C33:G15C16_AA A 32 ? A 16 ? A 33 ? A 15 ? 1 A C 33 1_555 A G 15 1_555 A U 34 1_555 A A 14 1_555 -0.334 -1.710 3.333 0.152 7.393 31.424 -4.340 0.628 2.865 13.418 -0.275 32.261 7 AA_C33U34:A14G15_AA A 33 ? A 15 ? A 34 ? A 14 ? 1 A U 34 1_555 A A 14 1_555 A G 35 1_555 A C 13 1_555 -0.022 -1.731 3.378 -1.342 9.083 31.187 -4.626 -0.187 2.776 16.453 2.431 32.478 8 AA_U34G35:C13A14_AA A 34 ? A 14 ? A 35 ? A 13 ? 1 A G 35 1_555 A C 13 1_555 A G 36 1_555 A C 12 1_555 -0.157 -1.798 3.264 -1.166 6.995 31.670 -4.377 0.088 2.817 12.620 2.104 32.434 9 AA_G35G36:C12C13_AA A 35 ? A 13 ? A 36 ? A 12 ? 1 A G 36 1_555 A C 12 1_555 A C 37 1_555 A G 11 1_555 -0.060 -1.747 3.089 0.047 3.979 33.748 -3.571 0.110 2.870 6.823 -0.081 33.975 10 AA_G36C37:G11C12_AA A 36 ? A 12 ? A 37 ? A 11 ? 1 A C 37 1_555 A G 11 1_555 A C 38 1_555 A G 9 1_555 1.682 -1.928 2.976 2.019 3.442 13.216 -10.972 -5.267 2.616 14.530 -8.524 13.803 11 AA_C37C38:G9G11_AA A 37 ? A 11 ? A 38 ? A 9 ? 1 A C 38 1_555 A G 9 1_555 A G 39 1_555 A C 66 1_555 1.876 -0.920 3.544 8.600 13.071 49.678 -2.014 -1.509 3.474 15.131 -9.955 51.934 12 AA_C38G39:C66G9_AA A 38 ? A 9 ? A 39 ? A 66 ? 1 A G 39 1_555 A C 66 1_555 A G 40 1_555 A C 65 1_555 -0.013 -1.778 3.294 0.060 6.176 32.261 -4.160 0.033 2.913 10.988 -0.107 32.832 13 AA_G39G40:C65C66_AA A 39 ? A 66 ? A 40 ? A 65 ? 1 A G 40 1_555 A C 65 1_555 A C 41 1_555 A G 64 1_555 0.203 -2.128 3.746 -2.455 10.466 35.714 -4.798 -0.661 3.005 16.608 3.895 37.247 14 AA_G40C41:G64C65_AA A 40 ? A 65 ? A 41 ? A 64 ? 1 A C 41 1_555 A G 64 1_555 A A 42 1_555 A U 63 1_555 1.793 -2.073 3.139 10.449 -17.419 20.217 0.991 -0.518 4.130 -39.093 -23.450 28.584 15 AA_C41A42:U63G64_AA A 41 ? A 64 ? A 42 ? A 63 ? 1 A A 42 1_555 A U 63 1_555 A C 44 1_555 A G 62 1_555 -2.429 -1.704 2.746 9.105 24.406 59.553 -2.330 2.549 1.659 23.400 -8.729 64.519 16 AA_A42C44:G62U63_AA A 42 ? A 63 ? A 44 ? A 62 ? 1 A C 44 1_555 A G 62 1_555 A C 45 1_555 A G 61 1_555 0.082 -1.900 3.277 0.947 7.083 32.344 -4.459 0.007 2.810 12.526 -1.675 33.103 17 AA_C44C45:G61G62_AA A 44 ? A 62 ? A 45 ? A 61 ? 1 A C 45 1_555 A G 61 1_555 A C 46 1_555 A G 60 1_555 0.188 -1.809 3.250 1.332 6.060 31.603 -4.283 -0.114 2.868 10.995 -2.416 32.191 18 AA_C45C46:G60G61_AA A 45 ? A 61 ? A 46 ? A 60 ? 1 A C 46 1_555 A G 60 1_555 A U 47 1_555 A G 59 1_555 0.180 -2.568 3.520 5.190 -2.769 34.933 -3.769 0.552 3.694 -4.572 -8.569 35.410 19 AA_C46U47:G59G60_AA A 46 ? A 60 ? A 47 ? A 59 ? 1 A U 47 1_555 A G 59 1_555 A C 48 1_555 A G 57 1_555 0.033 -3.669 4.239 -17.338 12.059 19.794 -10.121 -4.037 1.386 27.022 38.850 28.868 20 AA_U47C48:G57G59_AA A 47 ? A 59 ? A 48 ? A 57 ? 1 A C 48 1_555 A G 57 1_555 A C 49 1_555 A G 56 1_555 0.081 -1.901 3.276 0.941 7.086 32.331 -4.463 0.007 2.809 12.535 -1.665 33.091 21 AA_C48C49:G56G57_AA A 48 ? A 57 ? A 49 ? A 56 ? 1 A C 49 1_555 A G 56 1_555 A G 113 1_555 A C 55 1_555 -3.133 -0.827 3.349 -13.966 -12.215 33.921 0.644 2.578 4.318 -19.255 22.014 38.532 22 AA_C49G113:C55G56_AA A 49 ? A 56 ? A 113 ? A 55 ? 1 A G 113 1_555 A C 55 1_555 A C 114 1_555 A G 54 1_555 -0.290 -1.629 3.148 0.113 4.582 33.256 -3.520 0.519 2.903 7.959 -0.197 33.561 23 AA_G113C114:G54C55_AA A 113 ? A 55 ? A 114 ? A 54 ? 1 A C 114 1_555 A G 54 1_555 A G 115 1_555 A C 53 1_555 -0.086 -1.778 3.447 -1.371 7.786 30.253 -4.760 -0.097 2.912 14.607 2.573 31.245 24 AA_C114G115:C53G54_AA A 114 ? A 54 ? A 115 ? A 53 ? 1 A G 115 1_555 A C 53 1_555 A G 116 1_555 A C 52 1_555 -0.063 -1.875 3.302 -1.102 7.583 32.255 -4.496 -0.064 2.801 13.413 1.949 33.130 25 AA_G115G116:C52C53_AA A 115 ? A 53 ? A 116 ? A 52 ? 1 A G 116 1_555 A C 52 1_555 A G 117 1_555 A A 51 1_555 -0.287 -2.088 3.645 10.860 14.493 40.665 -4.121 1.395 2.634 19.717 -14.775 44.359 26 AA_G116G117:A51C52_AA A 116 ? A 52 ? A 117 ? A 51 ? 1 A G 117 1_555 A A 51 1_555 A C 119 1_555 A A 50 1_555 1.093 -4.405 5.204 34.361 -1.006 34.265 -5.256 3.487 4.602 -1.358 -46.378 48.167 27 AA_G117C119:A50A51_AA A 117 ? A 51 ? A 119 ? A 50 ? 1 A A 21 1_555 A U 30 1_555 A G 22 1_555 A C 29 1_555 -0.041 -1.846 3.376 -0.462 7.850 32.222 -4.513 -0.004 2.860 13.886 0.818 33.143 28 AA_A21G22:C29U30_AA A 21 ? A 30 ? A 22 ? A 29 ? 1 A G 22 1_555 A C 29 1_555 A C 67 1_555 A G 28 1_555 -4.150 -0.674 2.817 -12.205 -13.586 51.266 0.118 3.784 3.703 -15.163 13.621 54.214 29 AA_G22C67:G28C29_AA A 22 ? A 29 ? A 67 ? A 28 ? 1 A C 67 1_555 A G 28 1_555 A C 68 1_555 A G 27 1_555 -0.237 -1.649 3.287 0.126 6.992 32.160 -4.051 0.440 2.873 12.438 -0.224 32.892 30 AA_C67C68:G27G28_AA A 67 ? A 28 ? A 68 ? A 27 ? 1 A C 68 1_555 A G 27 1_555 A G 69 1_555 A C 26 1_555 -0.140 -1.739 3.423 -1.319 8.873 30.745 -4.718 0.022 2.827 16.304 2.423 31.996 31 AA_C68G69:C26G27_AA A 68 ? A 27 ? A 69 ? A 26 ? 1 A G 69 1_555 A C 26 1_555 A G 70 1_555 A C 25 1_555 -0.175 -1.808 3.261 -1.323 6.396 31.667 -4.318 0.093 2.855 11.568 2.392 32.317 32 AA_G69G70:C25C26_AA A 69 ? A 26 ? A 70 ? A 25 ? 1 A G 70 1_555 A C 25 1_555 A G 71 1_555 A C 24 1_555 -0.082 -1.900 3.277 -0.951 7.058 32.330 -4.459 -0.008 2.812 12.486 1.683 33.084 33 AA_G70G71:C24C25_AA A 70 ? A 25 ? A 71 ? A 24 ? 1 A A 80 1_555 A A 110 1_555 A G 81 1_555 A A 109 1_555 1.264 -1.773 3.253 -8.620 -6.482 32.454 -1.993 -3.516 3.113 -11.218 14.918 34.153 34 AA_A80G81:A109A110_AA A 80 ? A 110 ? A 81 ? A 109 ? 1 A G 81 1_555 A A 109 1_555 A G 82 1_555 A C 108 1_555 0.392 -2.269 3.877 6.337 20.347 35.340 -5.503 0.148 2.324 30.355 -9.455 41.092 35 AA_G81G82:C108A109_AA A 81 ? A 109 ? A 82 ? A 108 ? 1 A G 82 1_555 A C 108 1_555 A U 83 1_555 A G 107 1_555 0.131 -1.587 3.288 0.743 5.064 40.786 -2.798 -0.107 3.080 7.232 -1.061 41.092 36 AA_G82U83:G107C108_AA A 82 ? A 108 ? A 83 ? A 107 ? 1 A U 83 1_555 A G 107 1_555 A U 84 1_555 A G 106 1_555 0.362 -1.891 3.296 5.520 3.504 31.877 -3.981 0.306 3.094 6.297 -9.921 32.523 37 AA_U83U84:G106G107_AA A 83 ? A 107 ? A 84 ? A 106 ? 1 A U 84 1_555 A G 106 1_555 A G 85 1_555 A C 105 1_555 0.247 -2.048 3.341 6.070 8.493 24.429 -6.545 0.951 2.490 19.000 -13.580 26.535 38 AA_U84G85:C105G106_AA A 84 ? A 106 ? A 85 ? A 105 ? 1 A G 85 1_555 A C 105 1_555 A A 86 1_555 A G 104 1_555 0.429 -1.626 3.487 9.546 19.838 28.033 -5.407 0.616 1.993 34.936 -16.810 35.507 39 AA_G85A86:G104C105_AA A 85 ? A 105 ? A 86 ? A 104 ? 1 A A 86 1_555 A G 104 1_555 A G 87 1_555 A C 103 1_555 0.173 -1.445 3.382 -6.303 6.797 31.124 -3.762 -1.399 2.920 12.329 11.433 32.442 40 AA_A86G87:C103G104_AA A 86 ? A 104 ? A 87 ? A 103 ? 1 A G 87 1_555 A C 103 1_555 A U 88 1_555 A A 102 1_555 0.641 -1.273 3.391 0.792 8.842 30.294 -3.965 -1.034 2.927 16.480 -1.476 31.539 41 AA_G87U88:A102C103_AA A 87 ? A 103 ? A 88 ? A 102 ? 1 A U 88 1_555 A A 102 1_555 A A 89 1_555 A U 101 1_555 0.325 -1.571 3.260 0.101 11.384 31.684 -4.424 -0.546 2.560 20.059 -0.179 33.618 42 AA_U88A89:U101A102_AA A 88 ? A 102 ? A 89 ? A 101 ? 1 A A 89 1_555 A U 101 1_555 A G 90 1_555 A C 100 1_555 0.137 -1.788 3.536 -0.288 10.354 31.680 -4.845 -0.288 2.826 18.363 0.510 33.289 43 AA_A89G90:C100U101_AA A 89 ? A 101 ? A 90 ? A 100 ? 1 A G 90 1_555 A C 100 1_555 A C 91 1_555 A G 99 1_555 0.173 -1.679 3.157 -0.199 4.493 33.127 -3.611 -0.331 2.909 7.836 0.346 33.422 44 AA_G90C91:G99C100_AA A 90 ? A 100 ? A 91 ? A 99 ? 1 A C 91 1_555 A G 99 1_555 A C 92 1_555 A G 98 1_555 -0.322 -1.358 3.300 2.355 -6.792 29.779 -1.160 1.100 3.482 -12.980 -4.500 30.615 45 AA_C91C92:G98G99_AA A 91 ? A 99 ? A 92 ? A 98 ? 1 A C 92 1_555 A G 98 1_555 A G 93 1_555 A C 97 1_555 -0.301 -0.755 2.899 -2.449 8.099 31.074 -2.610 0.166 2.639 14.778 4.468 32.178 46 AA_C92G93:C97G98_AA A 92 ? A 98 ? A 93 ? A 97 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/Office of the Director' 'United States' 'S10 OD021600' 1 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' 'R21 AI145647' 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'P41GM103832, R01GM079429, U54GM103297, R35 GM112579' 3 # _atom_sites.entry_id 6WLQ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_