data_7KVU # _entry.id 7KVU # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7KVU pdb_00007kvu 10.2210/pdb7kvu/pdb WWPDB D_1000253145 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7KVU _pdbx_database_status.recvd_initial_deposition_date 2020-11-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Truong, L.' 1 ? ;Ferre-D'Amare, A.R. ; 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Chem.Biol. _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1552-4469 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 18 _citation.language ? _citation.page_first 191 _citation.page_last 198 _citation.title 'The fluorescent aptamer Squash extensively repurposes the adenine riboswitch fold.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41589-021-00931-2 _citation.pdbx_database_id_PubMed 34937911 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Truong, L.' 1 ? primary 'Kooshapur, H.' 2 ? primary 'Dey, S.K.' 3 ? primary 'Li, X.' 4 ? primary 'Tjandra, N.' 5 ? primary 'Jaffrey, S.R.' 6 ? primary ;Ferre-D'Amare, A.R. ; 7 ? # _cell.entry_id 7KVU _cell.length_a 103.731 _cell.length_b 103.731 _cell.length_c 51.959 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? # _symmetry.entry_id 7KVU _symmetry.space_group_name_H-M 'P 42 21 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 94 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'Squash RNA aptamer' 26986.906 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 4 ? ? ? ? 3 non-polymer syn 'POTASSIUM ION' 39.098 3 ? ? ? ? 4 non-polymer syn '(5Z)-5-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-3-(2,2,2-trifluoroethyl)-3,5-dihydro-4H-imidazol-4-one' 320.215 1 ? ? ? ? 5 water nat water 18.015 14 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(GTP)GGAAGAUACAAGGUGAGCCCAAUAAUAUGGUUUGGGUUAGGAUAGGAAGUAGAGCCUUAAACUCUCUAAGCGGUA UCUUCCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGGAAGAUACAAGGUGAGCCCAAUAAUAUGGUUUGGGUUAGGAUAGGAAGUAGAGCCUUAAACUCUCUAAGCGGUAUCUU CCC ; _entity_poly.pdbx_strand_id G _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 A n 1 5 A n 1 6 G n 1 7 A n 1 8 U n 1 9 A n 1 10 C n 1 11 A n 1 12 A n 1 13 G n 1 14 G n 1 15 U n 1 16 G n 1 17 A n 1 18 G n 1 19 C n 1 20 C n 1 21 C n 1 22 A n 1 23 A n 1 24 U n 1 25 A n 1 26 A n 1 27 U n 1 28 A n 1 29 U n 1 30 G n 1 31 G n 1 32 U n 1 33 U n 1 34 U n 1 35 G n 1 36 G n 1 37 G n 1 38 U n 1 39 U n 1 40 A n 1 41 G n 1 42 G n 1 43 A n 1 44 U n 1 45 A n 1 46 G n 1 47 G n 1 48 A n 1 49 A n 1 50 G n 1 51 U n 1 52 A n 1 53 G n 1 54 A n 1 55 G n 1 56 C n 1 57 C n 1 58 U n 1 59 U n 1 60 A n 1 61 A n 1 62 A n 1 63 C n 1 64 U n 1 65 C n 1 66 U n 1 67 C n 1 68 U n 1 69 A n 1 70 A n 1 71 G n 1 72 C n 1 73 G n 1 74 G n 1 75 U n 1 76 A n 1 77 U n 1 78 C n 1 79 U n 1 80 U n 1 81 C n 1 82 C n 1 83 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 83 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7KVU _struct_ref.pdbx_db_accession 7KVU _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7KVU _struct_ref_seq.pdbx_strand_id G _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 83 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7KVU _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 83 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 83 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 2ZY non-polymer . '(5Z)-5-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-3-(2,2,2-trifluoroethyl)-3,5-dihydro-4H-imidazol-4-one' ? 'C13 H9 F5 N2 O2' 320.215 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7KVU _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.59 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 52.50 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 294 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '40 mM Na cacodylate pH 7.0, 80 mM NaCl, 12 mM spermine hydrochloride, 36% (v/v) MPD, and 40 mM NaI' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-08-28 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.979 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 5.0.1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.979 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 5.0.1 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate 81.37 _reflns.entry_id 7KVU _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.68 _reflns.d_resolution_low 46.46 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 8369 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 24.7 _reflns.pdbx_Rmerge_I_obs 0.046 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 71.7 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.68 _reflns_shell.d_res_low 2.85 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 1463 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 4.494 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 7KVU _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 8369 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.360 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 46.46 _refine.ls_d_res_high 2.68 _refine.ls_percent_reflns_obs 99.7 _refine.ls_R_factor_obs 0.212 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.209 _refine.ls_R_factor_R_free 0.247 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 9.990 _refine.ls_number_reflns_R_free 836 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean 75.71 _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.details ? _refine.pdbx_starting_model 7KVT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values 'GEOSTD + MONOMER LIBRARY + CDL V1.2' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML 0.432 _refine.pdbx_overall_phase_error 28.989 _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1788 _refine_hist.pdbx_number_atoms_ligand 29 _refine_hist.number_atoms_solvent 14 _refine_hist.number_atoms_total 1831 _refine_hist.d_res_high 2.68 _refine_hist.d_res_low 46.46 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function f_bond_d 0.005 ? ? 2029 'X-RAY DIFFRACTION' ? f_angle_d 1.053 ? ? 3167 'X-RAY DIFFRACTION' ? f_dihedral_angle_d 15.274 ? ? 999 'X-RAY DIFFRACTION' ? f_chiral_restr 0.049 ? ? 414 'X-RAY DIFFRACTION' ? f_plane_restr 0.007 ? ? 85 'X-RAY DIFFRACTION' ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_R_work _refine_ls_shell.R_factor_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_all _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.number_reflns_obs 'X-RAY DIFFRACTION' . 2.6800 2.8500 1197 0.3564 98.00 0.4523 . . 133 . . . . 'X-RAY DIFFRACTION' . 2.8500 3.0700 1243 0.3353 100.00 0.4009 . . 137 . . . . 'X-RAY DIFFRACTION' . 3.0700 3.3800 1225 0.2306 100.00 0.2745 . . 139 . . . . 'X-RAY DIFFRACTION' . 3.3800 3.8600 1251 0.2306 100.00 0.2351 . . 137 . . . . 'X-RAY DIFFRACTION' . 3.8700 4.8700 1262 0.2114 100.00 0.2784 . . 141 . . . . 'X-RAY DIFFRACTION' . 4.8700 46.4600 1355 0.1660 100.00 0.1915 . . 149 . . . . # _struct.entry_id 7KVU _struct.title 'Crystal structure of Squash RNA aptamer in complex with DFHBI-1T' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7KVU _struct_keywords.text 'fluorogenic aptamer, adenine riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 4 ? H N N 2 ? I N N 2 ? J N N 5 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? G GTP 1 G G 2 1_555 ? ? ? ? ? ? ? 1.562 ? ? metalc1 metalc ? ? A G 41 O6 ? ? ? 1_555 C MG . MG ? ? G G 41 G MG 102 1_555 ? ? ? ? ? ? ? 2.463 ? ? metalc2 metalc ? ? A A 45 OP2 ? ? ? 1_555 H MG . MG ? ? G A 45 G MG 107 1_555 ? ? ? ? ? ? ? 1.744 ? ? metalc3 metalc ? ? A G 46 "O2'" ? ? ? 1_555 C MG . MG ? ? G G 46 G MG 102 1_555 ? ? ? ? ? ? ? 2.732 ? ? metalc4 metalc ? ? A G 46 O6 ? ? ? 1_555 H MG . MG ? ? G G 46 G MG 107 1_555 ? ? ? ? ? ? ? 2.203 ? ? metalc5 metalc ? ? A G 47 OP2 ? ? ? 1_555 C MG . MG ? ? G G 47 G MG 102 1_555 ? ? ? ? ? ? ? 2.848 ? ? metalc6 metalc ? ? H MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 107 G HOH 202 1_555 ? ? ? ? ? ? ? 2.288 ? ? metalc7 metalc ? ? H MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 107 G HOH 205 1_555 ? ? ? ? ? ? ? 2.117 ? ? metalc8 metalc ? ? H MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 107 G HOH 206 1_555 ? ? ? ? ? ? ? 2.724 ? ? metalc9 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 108 G HOH 209 1_555 ? ? ? ? ? ? ? 1.762 ? ? metalc10 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 108 G HOH 210 1_555 ? ? ? ? ? ? ? 1.769 ? ? metalc11 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 108 G HOH 211 1_555 ? ? ? ? ? ? ? 1.781 ? ? metalc12 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 108 G HOH 212 1_555 ? ? ? ? ? ? ? 1.765 ? ? metalc13 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 108 G HOH 213 1_555 ? ? ? ? ? ? ? 1.774 ? ? metalc14 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? G MG 108 G HOH 214 1_555 ? ? ? ? ? ? ? 1.774 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 83 N3 ? ? G GTP 1 G C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 83 O2 ? ? G GTP 1 G C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 83 N4 ? ? G GTP 1 G C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 82 N3 ? ? G G 2 G C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 82 O2 ? ? G G 2 G C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 82 N4 ? ? G G 2 G C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 81 N3 ? ? G G 3 G C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 81 O2 ? ? G G 3 G C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 81 N4 ? ? G G 3 G C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 80 N3 ? ? G A 4 G U 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 80 O4 ? ? G A 4 G U 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 79 N3 ? ? G A 5 G U 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 79 O4 ? ? G A 5 G U 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 78 N3 ? ? G G 6 G C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 78 O2 ? ? G G 6 G C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 78 N4 ? ? G G 6 G C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 77 N3 ? ? G A 7 G U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 77 O4 ? ? G A 7 G U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 76 N1 ? ? G U 8 G A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 76 N6 ? ? G U 8 G A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 75 N3 ? ? G A 9 G U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 75 O4 ? ? G A 9 G U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 74 N1 ? ? G C 10 G G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 74 O6 ? ? G C 10 G G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 74 N2 ? ? G C 10 G G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 12 N1 ? ? ? 1_555 A G 41 N2 ? ? G A 12 G G 41 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog27 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 40 N1 ? ? G G 13 G A 40 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog28 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 70 N3 ? ? G G 13 G A 70 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog29 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 69 N7 ? ? G U 15 G A 69 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog30 hydrog ? ? A U 15 O2 ? ? ? 1_555 A A 69 N6 ? ? G U 15 G A 69 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog31 hydrog ? ? A G 16 N2 ? ? ? 1_555 A A 49 N1 ? ? G G 16 G A 49 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog32 hydrog ? ? A G 16 N3 ? ? ? 1_555 A A 49 N6 ? ? G G 16 G A 49 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog33 hydrog ? ? A A 17 N1 ? ? ? 1_555 A U 68 N3 ? ? G A 17 G U 68 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog34 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 38 O2 ? ? G G 18 G U 38 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 38 N3 ? ? G G 18 G U 38 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 37 N1 ? ? G C 19 G G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 37 O6 ? ? G C 19 G G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 37 N2 ? ? G C 19 G G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 36 N1 ? ? G C 20 G G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 36 O6 ? ? G C 20 G G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 36 N2 ? ? G C 20 G G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 35 N1 ? ? G C 21 G G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 35 O6 ? ? G C 21 G G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 35 N2 ? ? G C 21 G G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A A 22 N1 ? ? ? 1_555 A U 34 N3 ? ? G A 22 G U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A A 22 N6 ? ? ? 1_555 A U 34 O4 ? ? G A 22 G U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A A 23 N1 ? ? ? 1_555 A U 33 N3 ? ? G A 23 G U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A A 23 N6 ? ? ? 1_555 A U 33 O4 ? ? G A 23 G U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 24 N3 ? ? ? 1_555 A U 32 O4 ? ? G U 24 G U 32 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog50 hydrog ? ? A U 24 O2 ? ? ? 1_555 A U 32 N3 ? ? G U 24 G U 32 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog51 hydrog ? ? A A 26 N1 ? ? ? 1_555 A A 62 N6 ? ? G A 26 G A 62 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog52 hydrog ? ? A A 26 N6 ? ? ? 1_555 A A 62 N7 ? ? G A 26 G A 62 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog53 hydrog ? ? A U 27 O2 ? ? ? 1_555 A G 30 N2 ? ? G U 27 G G 30 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog54 hydrog ? ? A U 27 N3 ? ? ? 1_555 A A 61 N7 ? ? G U 27 G A 61 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog55 hydrog ? ? A U 27 O2 ? ? ? 1_555 A A 61 N6 ? ? G U 27 G A 61 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog56 hydrog ? ? A A 28 N6 ? ? ? 1_555 A A 60 N1 ? ? G A 28 G A 60 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog57 hydrog ? ? A A 28 N7 ? ? ? 1_555 A A 60 N6 ? ? G A 28 G A 60 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog58 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 57 N3 ? ? G G 30 G C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 57 O2 ? ? G G 30 G C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 57 N4 ? ? G G 30 G C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 56 N3 ? ? G G 31 G C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 56 O2 ? ? G G 31 G C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 56 N4 ? ? G G 31 G C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 31 N2 ? ? ? 1_555 A A 62 N1 ? ? G G 31 G A 62 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog65 hydrog ? ? A G 31 N3 ? ? ? 1_555 A A 62 N6 ? ? G G 31 G A 62 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog66 hydrog ? ? A U 39 N3 ? ? ? 1_555 A A 48 N7 ? ? G U 39 G A 48 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog67 hydrog ? ? A U 39 O2 ? ? ? 1_555 A A 48 N6 ? ? G U 39 G A 48 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog68 hydrog ? ? A G 41 N1 ? ? ? 1_555 A G 47 N7 ? ? G G 41 G G 47 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog69 hydrog ? ? A G 41 N2 ? ? ? 1_555 A G 47 O6 ? ? G G 41 G G 47 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog70 hydrog ? ? A G 42 N7 ? ? ? 1_555 A G 46 N1 ? ? G G 42 G G 46 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog71 hydrog ? ? A G 42 O6 ? ? ? 1_555 A G 46 N2 ? ? G G 42 G G 46 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog72 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 72 N4 ? ? G G 42 G C 72 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog73 hydrog ? ? A A 43 N6 ? ? ? 1_555 A U 75 O2 ? ? G A 43 G U 75 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog74 hydrog ? ? A U 44 O4 ? ? ? 1_555 A G 74 N2 ? ? G U 44 G G 74 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog75 hydrog ? ? A A 45 N1 ? ? ? 1_555 A G 71 N1 ? ? G A 45 G G 71 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog76 hydrog ? ? A A 45 N6 ? ? ? 1_555 A G 71 O6 ? ? G A 45 G G 71 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog77 hydrog ? ? A G 46 N2 ? ? ? 1_555 A G 73 O6 ? ? G G 46 G G 73 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog78 hydrog ? ? A G 47 N1 ? ? ? 1_555 A C 72 N3 ? ? G G 47 G C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 47 N2 ? ? ? 1_555 A C 72 O2 ? ? G G 47 G C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 47 O6 ? ? ? 1_555 A C 72 N4 ? ? G G 47 G C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A A 48 N3 ? ? ? 1_555 A A 69 N6 ? ? G A 48 G A 69 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog82 hydrog ? ? A G 50 N1 ? ? ? 1_555 A C 67 N3 ? ? G G 50 G C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 50 N2 ? ? ? 1_555 A C 67 O2 ? ? G G 50 G C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 50 O6 ? ? ? 1_555 A C 67 N4 ? ? G G 50 G C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A A 52 N1 ? ? ? 1_555 A U 66 N3 ? ? G A 52 G U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A A 52 N6 ? ? ? 1_555 A U 66 O4 ? ? G A 52 G U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 53 N1 ? ? ? 1_555 A C 65 N3 ? ? G G 53 G C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 53 N2 ? ? ? 1_555 A C 65 O2 ? ? G G 53 G C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A G 53 O6 ? ? ? 1_555 A C 65 N4 ? ? G G 53 G C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 64 N3 ? ? G A 54 G U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 64 O4 ? ? G A 54 G U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 55 N1 ? ? ? 1_555 A C 63 N3 ? ? G G 55 G C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 55 N2 ? ? ? 1_555 A C 63 O2 ? ? G G 55 G C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 55 O6 ? ? ? 1_555 A C 63 N4 ? ? G G 55 G C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 57 O2 ? ? ? 1_555 A A 61 N6 ? ? G C 57 G A 61 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog96 hydrog ? ? A G 71 N2 ? ? ? 1_555 A G 73 O6 ? ? G G 71 G G 73 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _atom_sites.entry_id 7KVU _atom_sites.fract_transf_matrix[1][1] 0.009640 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.009640 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019246 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? F ? ? 8.95735 ? ? ? 7.27484 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? K ? ? 16.37977 2.54835 ? ? 4.54127 84.28225 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? MG ? ? 9.41153 2.53737 ? ? 2.59044 63.03566 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP G . n A 1 2 G 2 2 2 G G G . n A 1 3 G 3 3 3 G G G . n A 1 4 A 4 4 4 A A G . n A 1 5 A 5 5 5 A A G . n A 1 6 G 6 6 6 G G G . n A 1 7 A 7 7 7 A A G . n A 1 8 U 8 8 8 U U G . n A 1 9 A 9 9 9 A A G . n A 1 10 C 10 10 10 C C G . n A 1 11 A 11 11 11 A A G . n A 1 12 A 12 12 12 A A G . n A 1 13 G 13 13 13 G G G . n A 1 14 G 14 14 14 G G G . n A 1 15 U 15 15 15 U U G . n A 1 16 G 16 16 16 G G G . n A 1 17 A 17 17 17 A A G . n A 1 18 G 18 18 18 G G G . n A 1 19 C 19 19 19 C C G . n A 1 20 C 20 20 20 C C G . n A 1 21 C 21 21 21 C C G . n A 1 22 A 22 22 22 A A G . n A 1 23 A 23 23 23 A A G . n A 1 24 U 24 24 24 U U G . n A 1 25 A 25 25 25 A A G . n A 1 26 A 26 26 26 A A G . n A 1 27 U 27 27 27 U U G . n A 1 28 A 28 28 28 A A G . n A 1 29 U 29 29 29 U U G . n A 1 30 G 30 30 30 G G G . n A 1 31 G 31 31 31 G G G . n A 1 32 U 32 32 32 U U G . n A 1 33 U 33 33 33 U U G . n A 1 34 U 34 34 34 U U G . n A 1 35 G 35 35 35 G G G . n A 1 36 G 36 36 36 G G G . n A 1 37 G 37 37 37 G G G . n A 1 38 U 38 38 38 U U G . n A 1 39 U 39 39 39 U U G . n A 1 40 A 40 40 40 A A G . n A 1 41 G 41 41 41 G G G . n A 1 42 G 42 42 42 G G G . n A 1 43 A 43 43 43 A A G . n A 1 44 U 44 44 44 U U G . n A 1 45 A 45 45 45 A A G . n A 1 46 G 46 46 46 G G G . n A 1 47 G 47 47 47 G G G . n A 1 48 A 48 48 48 A A G . n A 1 49 A 49 49 49 A A G . n A 1 50 G 50 50 50 G G G . n A 1 51 U 51 51 51 U U G . n A 1 52 A 52 52 52 A A G . n A 1 53 G 53 53 53 G G G . n A 1 54 A 54 54 54 A A G . n A 1 55 G 55 55 55 G G G . n A 1 56 C 56 56 56 C C G . n A 1 57 C 57 57 57 C C G . n A 1 58 U 58 58 58 U U G . n A 1 59 U 59 59 59 U U G . n A 1 60 A 60 60 60 A A G . n A 1 61 A 61 61 61 A A G . n A 1 62 A 62 62 62 A A G . n A 1 63 C 63 63 63 C C G . n A 1 64 U 64 64 64 U U G . n A 1 65 C 65 65 65 C C G . n A 1 66 U 66 66 66 U U G . n A 1 67 C 67 67 67 C C G . n A 1 68 U 68 68 68 U U G . n A 1 69 A 69 69 69 A A G . n A 1 70 A 70 70 70 A A G . n A 1 71 G 71 71 71 G G G . n A 1 72 C 72 72 72 C C G . n A 1 73 G 73 73 73 G G G . n A 1 74 G 74 74 74 G G G . n A 1 75 U 75 75 75 U U G . n A 1 76 A 76 76 76 A A G . n A 1 77 U 77 77 77 U U G . n A 1 78 C 78 78 78 C C G . n A 1 79 U 79 79 79 U U G . n A 1 80 U 80 80 80 U U G . n A 1 81 C 81 81 81 C C G . n A 1 82 C 82 82 82 C C G . n A 1 83 C 83 83 83 C C G . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG G . C 2 MG 1 102 2 MG MG G . D 3 K 1 103 1 K K G . E 3 K 1 104 2 K K G . F 3 K 1 105 3 K K G . G 4 2ZY 1 106 1 2ZY DFH G . H 2 MG 1 107 301 MG MG G . I 2 MG 1 108 302 MG MG G . J 5 HOH 1 201 310 HOH HOH G . J 5 HOH 2 202 309 HOH HOH G . J 5 HOH 3 203 3 HOH HOH G . J 5 HOH 4 204 4 HOH HOH G . J 5 HOH 5 205 2 HOH HOH G . J 5 HOH 6 206 1 HOH HOH G . J 5 HOH 7 207 5 HOH HOH G . J 5 HOH 8 208 6 HOH HOH G . J 5 HOH 9 209 307 HOH HOH G . J 5 HOH 10 210 308 HOH HOH G . J 5 HOH 11 211 306 HOH HOH G . J 5 HOH 12 212 303 HOH HOH G . J 5 HOH 13 213 305 HOH HOH G . J 5 HOH 14 214 304 HOH HOH G . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O6 ? A G 41 ? G G 41 ? 1_555 MG ? C MG . ? G MG 102 ? 1_555 "O2'" ? A G 46 ? G G 46 ? 1_555 77.1 ? 2 O6 ? A G 41 ? G G 41 ? 1_555 MG ? C MG . ? G MG 102 ? 1_555 OP2 ? A G 47 ? G G 47 ? 1_555 99.9 ? 3 "O2'" ? A G 46 ? G G 46 ? 1_555 MG ? C MG . ? G MG 102 ? 1_555 OP2 ? A G 47 ? G G 47 ? 1_555 66.4 ? 4 OP2 ? A A 45 ? G A 45 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O6 ? A G 46 ? G G 46 ? 1_555 127.9 ? 5 OP2 ? A A 45 ? G A 45 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 202 ? 1_555 78.0 ? 6 O6 ? A G 46 ? G G 46 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 202 ? 1_555 65.1 ? 7 OP2 ? A A 45 ? G A 45 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 205 ? 1_555 142.3 ? 8 O6 ? A G 46 ? G G 46 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 205 ? 1_555 82.0 ? 9 O ? J HOH . ? G HOH 202 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 205 ? 1_555 100.1 ? 10 OP2 ? A A 45 ? G A 45 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 206 ? 1_555 70.2 ? 11 O6 ? A G 46 ? G G 46 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 206 ? 1_555 115.9 ? 12 O ? J HOH . ? G HOH 202 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 206 ? 1_555 61.0 ? 13 O ? J HOH . ? G HOH 205 ? 1_555 MG ? H MG . ? G MG 107 ? 1_555 O ? J HOH . ? G HOH 206 ? 1_555 76.1 ? 14 O ? J HOH . ? G HOH 209 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 210 ? 1_555 91.2 ? 15 O ? J HOH . ? G HOH 209 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 211 ? 1_555 130.8 ? 16 O ? J HOH . ? G HOH 210 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 211 ? 1_555 70.5 ? 17 O ? J HOH . ? G HOH 209 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 212 ? 1_555 92.2 ? 18 O ? J HOH . ? G HOH 210 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 212 ? 1_555 90.1 ? 19 O ? J HOH . ? G HOH 211 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 212 ? 1_555 131.5 ? 20 O ? J HOH . ? G HOH 209 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 213 ? 1_555 65.6 ? 21 O ? J HOH . ? G HOH 210 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 213 ? 1_555 131.4 ? 22 O ? J HOH . ? G HOH 211 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 213 ? 1_555 92.4 ? 23 O ? J HOH . ? G HOH 212 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 213 ? 1_555 130.5 ? 24 O ? J HOH . ? G HOH 209 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 214 ? 1_555 132.8 ? 25 O ? J HOH . ? G HOH 210 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 214 ? 1_555 130.4 ? 26 O ? J HOH . ? G HOH 211 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 214 ? 1_555 89.0 ? 27 O ? J HOH . ? G HOH 212 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 214 ? 1_555 70.1 ? 28 O ? J HOH . ? G HOH 213 ? 1_555 MG ? I MG . ? G MG 108 ? 1_555 O ? J HOH . ? G HOH 214 ? 1_555 92.7 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-01-19 2 'Structure model' 1 1 2022-02-16 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.year' 5 2 'Structure model' '_citation_author.identifier_ORCID' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y+1/2,x+1/2,z+1/2 3 y+1/2,-x+1/2,z+1/2 4 x+1/2,-y+1/2,-z+1/2 5 -x+1/2,y+1/2,-z+1/2 6 -x,-y,z 7 y,x,-z 8 -y,-x,-z # _software.citation_id ? _software.classification refinement _software.compiler_name ? _software.compiler_version ? _software.contact_author ? _software.contact_author_email ? _software.date ? _software.description ? _software.dependencies ? _software.hardware ? _software.language ? _software.location ? _software.mods ? _software.name PHENIX _software.os ? _software.os_version ? _software.type ? _software.version 1.17.1_3660 _software.pdbx_ordinal 1 # _pdbx_entry_details.entry_id 7KVU _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O G HOH 209 ? ? O G HOH 213 ? ? 1.92 2 1 "O2'" G G 50 ? ? OP2 G A 52 ? ? 1.93 3 1 O G HOH 212 ? ? O G HOH 214 ? ? 2.03 4 1 O G HOH 210 ? ? O G HOH 211 ? ? 2.05 # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 "O2'" _pdbx_validate_symm_contact.auth_asym_id_1 G _pdbx_validate_symm_contact.auth_comp_id_1 G _pdbx_validate_symm_contact.auth_seq_id_1 3 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 "O2'" _pdbx_validate_symm_contact.auth_asym_id_2 G _pdbx_validate_symm_contact.auth_comp_id_2 G _pdbx_validate_symm_contact.auth_seq_id_2 3 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 7_643 _pdbx_validate_symm_contact.dist 2.11 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" G GTP 1 ? ? "O3'" G GTP 1 ? ? P G G 2 ? ? 102.22 119.70 -17.48 1.20 Y 2 1 "O3'" G GTP 1 ? ? P G G 2 ? ? OP2 G G 2 ? ? 128.75 110.50 18.25 1.10 Y 3 1 "O3'" G GTP 1 ? ? P G G 2 ? ? OP1 G G 2 ? ? 90.91 105.20 -14.29 2.20 Y 4 1 C2 G A 17 ? ? N3 G A 17 ? ? C4 G A 17 ? ? 106.51 110.60 -4.09 0.50 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 2ZY O18 O N N 1 2ZY C15 C N N 2 2ZY N14 N N N 3 2ZY C16 C N N 4 2ZY C19 C N N 5 2ZY C13 C N N 6 2ZY C17 C N N 7 2ZY C11 C N N 8 2ZY N12 N N N 9 2ZY C10 C N N 10 2ZY C2 C Y N 11 2ZY C1 C Y N 12 2ZY C6 C Y N 13 2ZY F8 F N N 14 2ZY C5 C Y N 15 2ZY O9 O N N 16 2ZY C4 C Y N 17 2ZY F7 F N N 18 2ZY C3 C Y N 19 2ZY F20 F N N 20 2ZY F21 F N N 21 2ZY F22 F N N 22 2ZY H1 H N N 23 2ZY H2 H N N 24 2ZY H4 H N N 25 2ZY H5 H N N 26 2ZY H6 H N N 27 2ZY H7 H N N 28 2ZY H9 H N N 29 2ZY H10 H N N 30 2ZY H11 H N N 31 A OP3 O N N 32 A P P N N 33 A OP1 O N N 34 A OP2 O N N 35 A "O5'" O N N 36 A "C5'" C N N 37 A "C4'" C N R 38 A "O4'" O N N 39 A "C3'" C N S 40 A "O3'" O N N 41 A "C2'" C N R 42 A "O2'" O N N 43 A "C1'" C N R 44 A N9 N Y N 45 A C8 C Y N 46 A N7 N Y N 47 A C5 C Y N 48 A C6 C Y N 49 A N6 N N N 50 A N1 N Y N 51 A C2 C Y N 52 A N3 N Y N 53 A C4 C Y N 54 A HOP3 H N N 55 A HOP2 H N N 56 A "H5'" H N N 57 A "H5''" H N N 58 A "H4'" H N N 59 A "H3'" H N N 60 A "HO3'" H N N 61 A "H2'" H N N 62 A "HO2'" H N N 63 A "H1'" H N N 64 A H8 H N N 65 A H61 H N N 66 A H62 H N N 67 A H2 H N N 68 C OP3 O N N 69 C P P N N 70 C OP1 O N N 71 C OP2 O N N 72 C "O5'" O N N 73 C "C5'" C N N 74 C "C4'" C N R 75 C "O4'" O N N 76 C "C3'" C N S 77 C "O3'" O N N 78 C "C2'" C N R 79 C "O2'" O N N 80 C "C1'" C N R 81 C N1 N N N 82 C C2 C N N 83 C O2 O N N 84 C N3 N N N 85 C C4 C N N 86 C N4 N N N 87 C C5 C N N 88 C C6 C N N 89 C HOP3 H N N 90 C HOP2 H N N 91 C "H5'" H N N 92 C "H5''" H N N 93 C "H4'" H N N 94 C "H3'" H N N 95 C "HO3'" H N N 96 C "H2'" H N N 97 C "HO2'" H N N 98 C "H1'" H N N 99 C H41 H N N 100 C H42 H N N 101 C H5 H N N 102 C H6 H N N 103 G OP3 O N N 104 G P P N N 105 G OP1 O N N 106 G OP2 O N N 107 G "O5'" O N N 108 G "C5'" C N N 109 G "C4'" C N R 110 G "O4'" O N N 111 G "C3'" C N S 112 G "O3'" O N N 113 G "C2'" C N R 114 G "O2'" O N N 115 G "C1'" C N R 116 G N9 N Y N 117 G C8 C Y N 118 G N7 N Y N 119 G C5 C Y N 120 G C6 C N N 121 G O6 O N N 122 G N1 N N N 123 G C2 C N N 124 G N2 N N N 125 G N3 N N N 126 G C4 C Y N 127 G HOP3 H N N 128 G HOP2 H N N 129 G "H5'" H N N 130 G "H5''" H N N 131 G "H4'" H N N 132 G "H3'" H N N 133 G "HO3'" H N N 134 G "H2'" H N N 135 G "HO2'" H N N 136 G "H1'" H N N 137 G H8 H N N 138 G H1 H N N 139 G H21 H N N 140 G H22 H N N 141 GTP PG P N N 142 GTP O1G O N N 143 GTP O2G O N N 144 GTP O3G O N N 145 GTP O3B O N N 146 GTP PB P N N 147 GTP O1B O N N 148 GTP O2B O N N 149 GTP O3A O N N 150 GTP PA P N N 151 GTP O1A O N N 152 GTP O2A O N N 153 GTP "O5'" O N N 154 GTP "C5'" C N N 155 GTP "C4'" C N R 156 GTP "O4'" O N N 157 GTP "C3'" C N S 158 GTP "O3'" O N N 159 GTP "C2'" C N R 160 GTP "O2'" O N N 161 GTP "C1'" C N R 162 GTP N9 N Y N 163 GTP C8 C Y N 164 GTP N7 N Y N 165 GTP C5 C Y N 166 GTP C6 C N N 167 GTP O6 O N N 168 GTP N1 N N N 169 GTP C2 C N N 170 GTP N2 N N N 171 GTP N3 N N N 172 GTP C4 C Y N 173 GTP HOG2 H N N 174 GTP HOG3 H N N 175 GTP HOB2 H N N 176 GTP HOA2 H N N 177 GTP "H5'" H N N 178 GTP "H5''" H N N 179 GTP "H4'" H N N 180 GTP "H3'" H N N 181 GTP "HO3'" H N N 182 GTP "H2'" H N N 183 GTP "HO2'" H N N 184 GTP "H1'" H N N 185 GTP H8 H N N 186 GTP HN1 H N N 187 GTP HN21 H N N 188 GTP HN22 H N N 189 HOH O O N N 190 HOH H1 H N N 191 HOH H2 H N N 192 K K K N N 193 MG MG MG N N 194 U OP3 O N N 195 U P P N N 196 U OP1 O N N 197 U OP2 O N N 198 U "O5'" O N N 199 U "C5'" C N N 200 U "C4'" C N R 201 U "O4'" O N N 202 U "C3'" C N S 203 U "O3'" O N N 204 U "C2'" C N R 205 U "O2'" O N N 206 U "C1'" C N R 207 U N1 N N N 208 U C2 C N N 209 U O2 O N N 210 U N3 N N N 211 U C4 C N N 212 U O4 O N N 213 U C5 C N N 214 U C6 C N N 215 U HOP3 H N N 216 U HOP2 H N N 217 U "H5'" H N N 218 U "H5''" H N N 219 U "H4'" H N N 220 U "H3'" H N N 221 U "HO3'" H N N 222 U "H2'" H N N 223 U "HO2'" H N N 224 U "H1'" H N N 225 U H3 H N N 226 U H5 H N N 227 U H6 H N N 228 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 2ZY F20 C19 sing N N 1 2ZY F22 C19 sing N N 2 2ZY C19 F21 sing N N 3 2ZY C19 C16 sing N N 4 2ZY C16 N14 sing N N 5 2ZY O18 C15 doub N N 6 2ZY C15 N14 sing N N 7 2ZY C15 C11 sing N N 8 2ZY N14 C13 sing N N 9 2ZY C10 C11 doub N Z 10 2ZY C10 C2 sing N N 11 2ZY C11 N12 sing N N 12 2ZY C13 C17 sing N N 13 2ZY C13 N12 doub N N 14 2ZY C1 C2 doub Y N 15 2ZY C1 C6 sing Y N 16 2ZY C2 C3 sing Y N 17 2ZY F8 C6 sing N N 18 2ZY C6 C5 doub Y N 19 2ZY C3 C4 doub Y N 20 2ZY C5 C4 sing Y N 21 2ZY C5 O9 sing N N 22 2ZY C4 F7 sing N N 23 2ZY C16 H1 sing N N 24 2ZY C16 H2 sing N N 25 2ZY C17 H4 sing N N 26 2ZY C17 H5 sing N N 27 2ZY C17 H6 sing N N 28 2ZY C10 H7 sing N N 29 2ZY C1 H9 sing N N 30 2ZY O9 H10 sing N N 31 2ZY C3 H11 sing N N 32 A OP3 P sing N N 33 A OP3 HOP3 sing N N 34 A P OP1 doub N N 35 A P OP2 sing N N 36 A P "O5'" sing N N 37 A OP2 HOP2 sing N N 38 A "O5'" "C5'" sing N N 39 A "C5'" "C4'" sing N N 40 A "C5'" "H5'" sing N N 41 A "C5'" "H5''" sing N N 42 A "C4'" "O4'" sing N N 43 A "C4'" "C3'" sing N N 44 A "C4'" "H4'" sing N N 45 A "O4'" "C1'" sing N N 46 A "C3'" "O3'" sing N N 47 A "C3'" "C2'" sing N N 48 A "C3'" "H3'" sing N N 49 A "O3'" "HO3'" sing N N 50 A "C2'" "O2'" sing N N 51 A "C2'" "C1'" sing N N 52 A "C2'" "H2'" sing N N 53 A "O2'" "HO2'" sing N N 54 A "C1'" N9 sing N N 55 A "C1'" "H1'" sing N N 56 A N9 C8 sing Y N 57 A N9 C4 sing Y N 58 A C8 N7 doub Y N 59 A C8 H8 sing N N 60 A N7 C5 sing Y N 61 A C5 C6 sing Y N 62 A C5 C4 doub Y N 63 A C6 N6 sing N N 64 A C6 N1 doub Y N 65 A N6 H61 sing N N 66 A N6 H62 sing N N 67 A N1 C2 sing Y N 68 A C2 N3 doub Y N 69 A C2 H2 sing N N 70 A N3 C4 sing Y N 71 C OP3 P sing N N 72 C OP3 HOP3 sing N N 73 C P OP1 doub N N 74 C P OP2 sing N N 75 C P "O5'" sing N N 76 C OP2 HOP2 sing N N 77 C "O5'" "C5'" sing N N 78 C "C5'" "C4'" sing N N 79 C "C5'" "H5'" sing N N 80 C "C5'" "H5''" sing N N 81 C "C4'" "O4'" sing N N 82 C "C4'" "C3'" sing N N 83 C "C4'" "H4'" sing N N 84 C "O4'" "C1'" sing N N 85 C "C3'" "O3'" sing N N 86 C "C3'" "C2'" sing N N 87 C "C3'" "H3'" sing N N 88 C "O3'" "HO3'" sing N N 89 C "C2'" "O2'" sing N N 90 C "C2'" "C1'" sing N N 91 C "C2'" "H2'" sing N N 92 C "O2'" "HO2'" sing N N 93 C "C1'" N1 sing N N 94 C "C1'" "H1'" sing N N 95 C N1 C2 sing N N 96 C N1 C6 sing N N 97 C C2 O2 doub N N 98 C C2 N3 sing N N 99 C N3 C4 doub N N 100 C C4 N4 sing N N 101 C C4 C5 sing N N 102 C N4 H41 sing N N 103 C N4 H42 sing N N 104 C C5 C6 doub N N 105 C C5 H5 sing N N 106 C C6 H6 sing N N 107 G OP3 P sing N N 108 G OP3 HOP3 sing N N 109 G P OP1 doub N N 110 G P OP2 sing N N 111 G P "O5'" sing N N 112 G OP2 HOP2 sing N N 113 G "O5'" "C5'" sing N N 114 G "C5'" "C4'" sing N N 115 G "C5'" "H5'" sing N N 116 G "C5'" "H5''" sing N N 117 G "C4'" "O4'" sing N N 118 G "C4'" "C3'" sing N N 119 G "C4'" "H4'" sing N N 120 G "O4'" "C1'" sing N N 121 G "C3'" "O3'" sing N N 122 G "C3'" "C2'" sing N N 123 G "C3'" "H3'" sing N N 124 G "O3'" "HO3'" sing N N 125 G "C2'" "O2'" sing N N 126 G "C2'" "C1'" sing N N 127 G "C2'" "H2'" sing N N 128 G "O2'" "HO2'" sing N N 129 G "C1'" N9 sing N N 130 G "C1'" "H1'" sing N N 131 G N9 C8 sing Y N 132 G N9 C4 sing Y N 133 G C8 N7 doub Y N 134 G C8 H8 sing N N 135 G N7 C5 sing Y N 136 G C5 C6 sing N N 137 G C5 C4 doub Y N 138 G C6 O6 doub N N 139 G C6 N1 sing N N 140 G N1 C2 sing N N 141 G N1 H1 sing N N 142 G C2 N2 sing N N 143 G C2 N3 doub N N 144 G N2 H21 sing N N 145 G N2 H22 sing N N 146 G N3 C4 sing N N 147 GTP PG O1G doub N N 148 GTP PG O2G sing N N 149 GTP PG O3G sing N N 150 GTP PG O3B sing N N 151 GTP O2G HOG2 sing N N 152 GTP O3G HOG3 sing N N 153 GTP O3B PB sing N N 154 GTP PB O1B doub N N 155 GTP PB O2B sing N N 156 GTP PB O3A sing N N 157 GTP O2B HOB2 sing N N 158 GTP O3A PA sing N N 159 GTP PA O1A doub N N 160 GTP PA O2A sing N N 161 GTP PA "O5'" sing N N 162 GTP O2A HOA2 sing N N 163 GTP "O5'" "C5'" sing N N 164 GTP "C5'" "C4'" sing N N 165 GTP "C5'" "H5'" sing N N 166 GTP "C5'" "H5''" sing N N 167 GTP "C4'" "O4'" sing N N 168 GTP "C4'" "C3'" sing N N 169 GTP "C4'" "H4'" sing N N 170 GTP "O4'" "C1'" sing N N 171 GTP "C3'" "O3'" sing N N 172 GTP "C3'" "C2'" sing N N 173 GTP "C3'" "H3'" sing N N 174 GTP "O3'" "HO3'" sing N N 175 GTP "C2'" "O2'" sing N N 176 GTP "C2'" "C1'" sing N N 177 GTP "C2'" "H2'" sing N N 178 GTP "O2'" "HO2'" sing N N 179 GTP "C1'" N9 sing N N 180 GTP "C1'" "H1'" sing N N 181 GTP N9 C8 sing Y N 182 GTP N9 C4 sing Y N 183 GTP C8 N7 doub Y N 184 GTP C8 H8 sing N N 185 GTP N7 C5 sing Y N 186 GTP C5 C6 sing N N 187 GTP C5 C4 doub Y N 188 GTP C6 O6 doub N N 189 GTP C6 N1 sing N N 190 GTP N1 C2 sing N N 191 GTP N1 HN1 sing N N 192 GTP C2 N2 sing N N 193 GTP C2 N3 doub N N 194 GTP N2 HN21 sing N N 195 GTP N2 HN22 sing N N 196 GTP N3 C4 sing N N 197 HOH O H1 sing N N 198 HOH O H2 sing N N 199 U OP3 P sing N N 200 U OP3 HOP3 sing N N 201 U P OP1 doub N N 202 U P OP2 sing N N 203 U P "O5'" sing N N 204 U OP2 HOP2 sing N N 205 U "O5'" "C5'" sing N N 206 U "C5'" "C4'" sing N N 207 U "C5'" "H5'" sing N N 208 U "C5'" "H5''" sing N N 209 U "C4'" "O4'" sing N N 210 U "C4'" "C3'" sing N N 211 U "C4'" "H4'" sing N N 212 U "O4'" "C1'" sing N N 213 U "C3'" "O3'" sing N N 214 U "C3'" "C2'" sing N N 215 U "C3'" "H3'" sing N N 216 U "O3'" "HO3'" sing N N 217 U "C2'" "O2'" sing N N 218 U "C2'" "C1'" sing N N 219 U "C2'" "H2'" sing N N 220 U "O2'" "HO2'" sing N N 221 U "C1'" N1 sing N N 222 U "C1'" "H1'" sing N N 223 U N1 C2 sing N N 224 U N1 C6 sing N N 225 U C2 O2 doub N N 226 U C2 N3 sing N N 227 U N3 C4 sing N N 228 U N3 H3 sing N N 229 U C4 O4 doub N N 230 U C4 C5 sing N N 231 U C5 C6 doub N N 232 U C5 H5 sing N N 233 U C6 H6 sing N N 234 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7KVU 'double helix' 7KVU 'a-form double helix' 7KVU 'mismatched base pair' 7KVU 'internal loop' 7KVU 'triple helix' 7KVU 'quadruple helix' 7KVU 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 83 1_555 -0.412 -0.085 0.015 0.694 -3.718 -4.961 1 G_GTP1:C83_G G 1 ? G 83 ? 19 1 1 A G 2 1_555 A C 82 1_555 -0.147 -0.115 0.021 -3.281 -5.262 0.947 2 G_G2:C82_G G 2 ? G 82 ? 19 1 1 A G 3 1_555 A C 81 1_555 -0.222 -0.110 -0.011 -5.203 -4.663 2.135 3 G_G3:C81_G G 3 ? G 81 ? 19 1 1 A A 4 1_555 A U 80 1_555 0.062 -0.106 0.178 -4.154 -8.246 1.162 4 G_A4:U80_G G 4 ? G 80 ? 20 1 1 A A 5 1_555 A U 79 1_555 0.085 0.016 0.214 -4.858 -8.730 2.128 5 G_A5:U79_G G 5 ? G 79 ? 20 1 1 A G 6 1_555 A C 78 1_555 -0.210 -0.146 0.219 -1.813 -8.147 0.728 6 G_G6:C78_G G 6 ? G 78 ? 19 1 1 A A 7 1_555 A U 77 1_555 0.103 -0.054 0.357 -2.657 -5.345 -0.302 7 G_A7:U77_G G 7 ? G 77 ? 20 1 1 A U 8 1_555 A A 76 1_555 0.069 -0.156 0.548 -5.687 -4.820 -1.425 8 G_U8:A76_G G 8 ? G 76 ? 20 1 1 A A 9 1_555 A U 75 1_555 -0.061 -0.141 0.416 0.687 -2.897 5.366 9 G_A9:U75_G G 9 ? G 75 ? 20 1 1 A C 10 1_555 A G 74 1_555 0.217 -0.155 0.365 9.985 -2.001 -2.456 10 G_C10:G74_G G 10 ? G 74 ? 19 1 1 A A 45 1_555 A G 71 1_555 0.327 1.408 -0.527 15.763 -24.789 -6.933 11 G_A45:G71_G G 45 ? G 71 ? 8 1 1 A G 46 1_555 A G 42 1_555 5.507 -0.325 -0.100 2.552 -1.614 -114.500 12 G_G46:G42_G G 46 ? G 42 ? 7 4 1 A G 47 1_555 A C 72 1_555 -0.251 -0.287 -0.028 6.264 -9.750 1.858 13 G_G47:C72_G G 47 ? G 72 ? 19 1 1 A A 40 1_555 A G 13 1_555 -2.996 5.731 -0.471 1.492 -10.685 144.450 14 G_A40:G13_G G 40 ? G 13 ? ? 11 1 A A 28 1_555 A A 60 1_555 -4.013 1.416 0.364 -8.895 10.685 -111.259 15 G_A28:A60_G G 28 ? G 60 ? 5 4 1 A G 30 1_555 A C 57 1_555 -0.167 -0.230 0.623 5.844 -11.503 -2.777 16 G_G30:C57_G G 30 ? G 57 ? 19 1 1 A G 31 1_555 A C 56 1_555 -0.070 -0.082 0.600 18.633 -9.525 -0.885 17 G_G31:C56_G G 31 ? G 56 ? 19 1 1 A C 63 1_555 A G 55 1_555 0.108 -0.151 0.043 4.106 -9.500 1.656 18 G_C63:G55_G G 63 ? G 55 ? 19 1 1 A U 64 1_555 A A 54 1_555 0.073 -0.168 0.106 -1.717 -3.818 4.500 19 G_U64:A54_G G 64 ? G 54 ? 20 1 1 A C 65 1_555 A G 53 1_555 0.199 -0.211 0.067 2.111 -2.226 1.888 20 G_C65:G53_G G 65 ? G 53 ? 19 1 1 A U 66 1_555 A A 52 1_555 -0.087 -0.196 0.002 4.649 -3.909 2.225 21 G_U66:A52_G G 66 ? G 52 ? 20 1 1 A C 67 1_555 A G 50 1_555 0.117 -0.140 0.211 3.646 -11.919 0.047 22 G_C67:G50_G G 67 ? G 50 ? 19 1 1 A U 68 1_555 A A 17 1_555 0.741 2.790 0.056 17.767 1.571 168.381 23 G_U68:A17_G G 68 ? G 17 ? ? 2 1 A A 49 1_555 A G 16 1_555 -3.135 3.980 0.836 -3.143 -13.002 71.734 24 G_A49:G16_G G 49 ? G 16 ? 10 6 1 A A 69 1_555 A U 15 1_555 -4.146 -1.967 -0.068 14.311 10.576 -96.986 25 G_A69:U15_G G 69 ? G 15 ? 24 4 1 A A 48 1_555 A U 39 1_555 -4.685 -2.057 0.036 -18.294 -10.427 -89.360 26 G_A48:U39_G G 48 ? G 39 ? 24 4 1 A G 18 1_555 A U 38 1_555 -2.813 -0.559 0.688 15.663 4.154 -2.158 27 G_G18:U38_G G 18 ? G 38 ? 28 1 1 A C 19 1_555 A G 37 1_555 0.143 -0.190 0.515 4.410 -7.172 -0.549 28 G_C19:G37_G G 19 ? G 37 ? 19 1 1 A C 20 1_555 A G 36 1_555 0.159 -0.212 0.347 -0.096 -1.170 2.252 29 G_C20:G36_G G 20 ? G 36 ? 19 1 1 A C 21 1_555 A G 35 1_555 0.166 -0.195 0.420 -4.169 -6.069 -0.275 30 G_C21:G35_G G 21 ? G 35 ? 19 1 1 A A 22 1_555 A U 34 1_555 0.166 -0.014 0.005 -4.355 -3.152 -1.842 31 G_A22:U34_G G 22 ? G 34 ? 20 1 1 A A 23 1_555 A U 33 1_555 0.019 -0.188 -0.329 -0.784 -4.594 4.680 32 G_A23:U33_G G 23 ? G 33 ? 20 1 1 A U 24 1_555 A U 32 1_555 2.922 -1.959 -0.445 6.203 -8.781 7.401 33 G_U24:U32_G G 24 ? G 32 ? 16 1 1 A A 26 1_555 A A 62 1_555 4.094 1.735 0.469 -1.043 2.416 -113.954 34 G_A26:A62_G G 26 ? G 62 ? 5 4 1 A U 27 1_555 A A 61 1_555 4.053 -1.693 -0.505 2.632 -4.401 -98.287 35 G_U27:A61_G G 27 ? G 61 ? 24 4 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 83 1_555 A G 2 1_555 A C 82 1_555 0.140 -1.904 3.199 0.091 6.045 36.751 -3.731 -0.208 2.862 9.509 -0.143 37.228 1 GG_GTP1G2:C82C83_GG G 1 ? G 83 ? G 2 ? G 82 ? 1 A G 2 1_555 A C 82 1_555 A G 3 1_555 A C 81 1_555 0.344 -2.131 3.253 2.913 5.069 29.014 -5.187 -0.091 2.867 9.990 -5.741 29.585 2 GG_G2G3:C81C82_GG G 2 ? G 82 ? G 3 ? G 81 ? 1 A G 3 1_555 A C 81 1_555 A A 4 1_555 A U 80 1_555 -0.101 -1.685 3.216 1.172 3.194 32.371 -3.540 0.376 3.035 5.709 -2.095 32.544 3 GG_G3A4:U80C81_GG G 3 ? G 81 ? G 4 ? G 80 ? 1 A A 4 1_555 A U 80 1_555 A A 5 1_555 A U 79 1_555 -0.031 -1.315 3.266 0.364 3.373 32.849 -2.873 0.115 3.119 5.944 -0.642 33.019 4 GG_A4A5:U79U80_GG G 4 ? G 80 ? G 5 ? G 79 ? 1 A A 5 1_555 A U 79 1_555 A G 6 1_555 A C 78 1_555 0.347 -1.586 3.042 -0.115 6.047 29.996 -4.063 -0.678 2.677 11.536 0.219 30.586 5 GG_A5G6:C78U79_GG G 5 ? G 79 ? G 6 ? G 78 ? 1 A G 6 1_555 A C 78 1_555 A A 7 1_555 A U 77 1_555 -0.313 -1.465 3.073 -2.010 7.854 35.207 -3.359 0.251 2.708 12.777 3.270 36.100 6 GG_G6A7:U77C78_GG G 6 ? G 78 ? G 7 ? G 77 ? 1 A A 7 1_555 A U 77 1_555 A U 8 1_555 A A 76 1_555 -0.036 -1.477 3.381 -0.767 6.895 31.148 -3.925 -0.072 2.993 12.645 1.407 31.892 7 GG_A7U8:A76U77_GG G 7 ? G 77 ? G 8 ? G 76 ? 1 A U 8 1_555 A A 76 1_555 A A 9 1_555 A U 75 1_555 0.456 -1.580 2.816 2.956 11.614 32.215 -4.111 -0.407 2.166 20.083 -5.112 34.317 8 GG_U8A9:U75A76_GG G 8 ? G 76 ? G 9 ? G 75 ? 1 A A 9 1_555 A U 75 1_555 A C 10 1_555 A G 74 1_555 0.623 -1.130 3.067 4.237 4.710 35.566 -2.441 -0.450 2.951 7.636 -6.869 36.108 9 GG_A9C10:G74U75_GG G 9 ? G 75 ? G 10 ? G 74 ? 1 A C 10 1_555 A G 74 1_555 A A 45 1_555 A G 71 1_555 -2.651 3.501 2.587 3.506 -6.544 119.924 2.068 1.555 2.423 -3.778 -2.024 120.063 10 GG_C10A45:G71G74_GG G 10 ? G 74 ? G 45 ? G 71 ? 1 A A 45 1_555 A G 71 1_555 A G 46 1_555 A G 42 1_555 0.975 1.426 3.881 11.026 6.495 83.471 0.876 -0.410 4.045 4.853 -8.239 84.268 11 GG_A45G46:G42G71_GG G 45 ? G 71 ? G 46 ? G 42 ? 1 A G 46 1_555 A G 42 1_555 A G 47 1_555 A C 72 1_555 -4.234 4.380 0.667 11.877 -16.150 -74.642 -3.328 -3.262 1.994 13.094 9.629 -76.907 12 GG_G46G47:C72G42_GG G 46 ? G 42 ? G 47 ? G 72 ? 1 A G 47 1_555 A C 72 1_555 A A 40 1_555 A G 13 1_555 -4.979 0.872 2.857 -51.184 143.707 -115.136 -0.976 -2.701 1.122 -73.810 -26.289 -165.379 13 GG_G47A40:G13C72_GG G 47 ? G 72 ? G 40 ? G 13 ? 1 A A 28 1_555 A A 60 1_555 A G 30 1_555 A C 57 1_555 4.246 0.648 3.437 69.575 164.881 122.737 -0.561 -1.749 4.094 82.499 -34.812 179.501 14 GG_A28G30:C57A60_GG G 28 ? G 60 ? G 30 ? G 57 ? 1 A G 30 1_555 A C 57 1_555 A G 31 1_555 A C 56 1_555 0.642 -0.864 3.045 1.213 6.638 28.060 -3.075 -1.044 2.795 13.446 -2.457 28.844 15 GG_G30G31:C56C57_GG G 30 ? G 57 ? G 31 ? G 56 ? 1 A G 31 1_555 A C 56 1_555 A C 63 1_555 A G 55 1_555 -2.099 -0.840 3.312 -2.881 6.761 56.472 -1.261 2.042 3.294 7.111 3.030 56.910 16 GG_G31C63:G55C56_GG G 31 ? G 56 ? G 63 ? G 55 ? 1 A C 63 1_555 A G 55 1_555 A U 64 1_555 A A 54 1_555 -0.797 -2.344 3.235 -3.013 6.593 28.515 -5.922 0.974 2.704 13.118 5.995 29.403 17 GG_C63U64:A54G55_GG G 63 ? G 55 ? G 64 ? G 54 ? 1 A U 64 1_555 A A 54 1_555 A C 65 1_555 A G 53 1_555 -0.400 -1.755 3.081 -1.778 4.089 30.158 -4.081 0.437 2.842 7.804 3.393 30.478 18 GG_U64C65:G53A54_GG G 64 ? G 54 ? G 65 ? G 53 ? 1 A C 65 1_555 A G 53 1_555 A U 66 1_555 A A 52 1_555 -0.180 -2.037 3.132 -1.026 3.783 29.918 -4.622 0.154 2.863 7.288 1.977 30.168 19 GG_C65U66:A52G53_GG G 65 ? G 53 ? G 66 ? G 52 ? 1 A U 66 1_555 A A 52 1_555 A C 67 1_555 A G 50 1_555 0.870 -1.591 3.107 0.807 6.733 41.235 -2.878 -1.143 2.840 9.482 -1.137 41.765 20 GG_U66C67:G50A52_GG G 66 ? G 52 ? G 67 ? G 50 ? 1 A C 67 1_555 A G 50 1_555 A U 68 1_555 A A 17 1_555 -0.001 -1.544 3.478 -1.200 4.923 -50.602 1.425 -0.092 3.602 -5.743 -1.400 -50.838 21 GG_C67U68:A17G50_GG G 67 ? G 50 ? G 68 ? G 17 ? 1 A U 68 1_555 A A 17 1_555 A A 49 1_555 A G 16 1_555 2.371 -2.785 2.799 -112.916 -139.519 9.104 -0.067 -2.258 0.893 -69.943 56.607 179.489 22 GG_U68A49:G16A17_GG G 68 ? G 17 ? G 49 ? G 16 ? 1 A A 49 1_555 A G 16 1_555 A A 69 1_555 A U 15 1_555 -4.356 -1.898 -0.308 162.927 -53.561 -89.123 1.081 -1.784 2.306 27.176 82.665 -173.950 23 GG_A49A69:U15G16_GG G 49 ? G 16 ? G 69 ? G 15 ? 1 A A 69 1_555 A U 15 1_555 A A 48 1_555 A U 39 1_555 -1.598 -1.138 6.775 55.389 -122.273 110.255 1.154 1.607 5.905 -64.583 -29.256 154.308 24 GG_A69A48:U39U15_GG G 69 ? G 15 ? G 48 ? G 39 ? 1 A A 48 1_555 A U 39 1_555 A G 18 1_555 A U 38 1_555 3.243 -1.773 2.351 -10.235 3.523 57.247 -1.939 -3.673 1.697 3.641 10.578 58.176 25 GG_A48G18:U38U39_GG G 48 ? G 39 ? G 18 ? G 38 ? 1 A G 18 1_555 A U 38 1_555 A C 19 1_555 A G 37 1_555 -0.304 -1.681 3.503 -4.189 4.675 47.926 -2.436 0.029 3.348 5.726 5.131 48.311 26 GG_G18C19:G37U38_GG G 18 ? G 38 ? G 19 ? G 37 ? 1 A C 19 1_555 A G 37 1_555 A C 20 1_555 A G 36 1_555 -0.550 -2.137 3.066 -1.110 7.116 30.518 -5.120 0.837 2.533 13.288 2.073 31.336 27 GG_C19C20:G36G37_GG G 19 ? G 37 ? G 20 ? G 36 ? 1 A C 20 1_555 A G 36 1_555 A C 21 1_555 A G 35 1_555 0.264 -2.024 3.100 2.107 7.126 29.742 -5.068 -0.134 2.569 13.617 -4.026 30.636 28 GG_C20C21:G35G36_GG G 20 ? G 36 ? G 21 ? G 35 ? 1 A C 21 1_555 A G 35 1_555 A A 22 1_555 A U 34 1_555 0.395 -1.717 3.067 4.229 9.367 31.036 -4.471 -0.064 2.488 16.934 -7.645 32.654 29 GG_C21A22:U34G35_GG G 21 ? G 35 ? G 22 ? G 34 ? 1 A A 22 1_555 A U 34 1_555 A A 23 1_555 A U 33 1_555 0.853 -2.359 3.325 2.488 4.014 24.642 -6.585 -1.250 2.979 9.296 -5.761 25.084 30 GG_A22A23:U33U34_GG G 22 ? G 34 ? G 23 ? G 33 ? 1 A A 23 1_555 A U 33 1_555 A U 24 1_555 A U 32 1_555 0.130 -1.075 3.240 0.442 0.945 46.214 -1.449 -0.129 3.220 1.204 -0.564 46.225 31 GG_A23U24:U32U33_GG G 23 ? G 33 ? G 24 ? G 32 ? 1 A A 26 1_555 A A 62 1_555 A U 27 1_555 A A 61 1_555 0.045 -1.465 3.207 8.983 -0.317 35.151 -2.311 1.170 3.136 -0.515 -14.581 36.247 32 GG_A26U27:A61A62_GG G 26 ? G 62 ? G 27 ? G 61 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 'POTASSIUM ION' K 4 '(5Z)-5-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-3-(2,2,2-trifluoroethyl)-3,5-dihydro-4H-imidazol-4-one' 2ZY 5 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 7KVT _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'P 42 21 2' _space_group.name_Hall 'P 4n 2n' _space_group.IT_number 94 _space_group.crystal_system tetragonal _space_group.id 1 #