data_7KVV # _entry.id 7KVV # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7KVV pdb_00007kvv 10.2210/pdb7kvv/pdb WWPDB D_1000253154 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7KVV _pdbx_database_status.recvd_initial_deposition_date 2020-11-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Truong, L.' 1 ? ;Ferre-D'Amare, A.R. ; 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Chem.Biol. _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1552-4469 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 18 _citation.language ? _citation.page_first 191 _citation.page_last 198 _citation.title 'The fluorescent aptamer Squash extensively repurposes the adenine riboswitch fold.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41589-021-00931-2 _citation.pdbx_database_id_PubMed 34937911 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Truong, L.' 1 ? primary 'Kooshapur, H.' 2 ? primary 'Dey, S.K.' 3 ? primary 'Li, X.' 4 ? primary 'Tjandra, N.' 5 ? primary 'Jaffrey, S.R.' 6 ? primary ;Ferre-D'Amare, A.R. ; 7 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7KVV _cell.details ? _cell.formula_units_Z ? _cell.length_a 104.271 _cell.length_a_esd ? _cell.length_b 104.271 _cell.length_b_esd ? _cell.length_c 52.107 _cell.length_c_esd ? _cell.volume 566530.306 _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7KVV _symmetry.cell_setting ? _symmetry.Int_Tables_number 94 _symmetry.space_group_name_Hall 'P 4n 2n' _symmetry.space_group_name_H-M 'P 42 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'Squash RNA aptamer bound to DFHO' 26986.906 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 3 non-polymer syn '(5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylidene]-2-[(E)-(hydroxyimino)methyl]-3-methyl-3,5-dihydro-4H-imidazol-4-one' 281.215 1 ? ? ? ? 4 water nat water 18.015 2 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(GTP)GGAAGAUACAAGGUGAGCCCAAUAAUAUGGUUUGGGUUAGGAUAGGAAGUAGAGCCUUAAACUCUCUAAGCGGUA UCUUCCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGGAAGAUACAAGGUGAGCCCAAUAAUAUGGUUUGGGUUAGGAUAGGAAGUAGAGCCUUAAACUCUCUAAGCGGUAUCUU CCC ; _entity_poly.pdbx_strand_id D _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 A n 1 5 A n 1 6 G n 1 7 A n 1 8 U n 1 9 A n 1 10 C n 1 11 A n 1 12 A n 1 13 G n 1 14 G n 1 15 U n 1 16 G n 1 17 A n 1 18 G n 1 19 C n 1 20 C n 1 21 C n 1 22 A n 1 23 A n 1 24 U n 1 25 A n 1 26 A n 1 27 U n 1 28 A n 1 29 U n 1 30 G n 1 31 G n 1 32 U n 1 33 U n 1 34 U n 1 35 G n 1 36 G n 1 37 G n 1 38 U n 1 39 U n 1 40 A n 1 41 G n 1 42 G n 1 43 A n 1 44 U n 1 45 A n 1 46 G n 1 47 G n 1 48 A n 1 49 A n 1 50 G n 1 51 U n 1 52 A n 1 53 G n 1 54 A n 1 55 G n 1 56 C n 1 57 C n 1 58 U n 1 59 U n 1 60 A n 1 61 A n 1 62 A n 1 63 C n 1 64 U n 1 65 C n 1 66 U n 1 67 C n 1 68 U n 1 69 A n 1 70 A n 1 71 G n 1 72 C n 1 73 G n 1 74 G n 1 75 U n 1 76 A n 1 77 U n 1 78 C n 1 79 U n 1 80 U n 1 81 C n 1 82 C n 1 83 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 83 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7KVV _struct_ref.pdbx_db_accession 7KVV _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7KVV _struct_ref_seq.pdbx_strand_id D _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 83 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7KVV _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 83 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 83 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 747 non-polymer . '(5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylidene]-2-[(E)-(hydroxyimino)methyl]-3-methyl-3,5-dihydro-4H-imidazol-4-one' ? 'C12 H9 F2 N3 O3' 281.215 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7KVV _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.62 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 53.13 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 294 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '40 mM Na cacodylate pH 7.0, 80 mM NaCl, 12 mM spermine hydrochloride, 36% (v/v) MPD, and 40 mM NaI' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'ADSC QUANTUM 315' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-02-12 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.979 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 24-ID-E' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.979 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 24-ID-E _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 109.76 _reflns.entry_id 7KVV _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.85 _reflns.d_resolution_low 52.14 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 7090 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 31.4 _reflns.pdbx_Rmerge_I_obs 0.033 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 93.1 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.85 _reflns_shell.d_res_low 2.95 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 611 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 3.458 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 95.80 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7KVV _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.85 _refine.ls_d_res_low 52.14 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 7090 _refine.ls_number_reflns_R_free 710 _refine.ls_number_reflns_R_work 6380 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.65 _refine.ls_percent_reflns_R_free 10.01 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2226 _refine.ls_R_factor_R_free 0.2450 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2210 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 7KVT _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 31.5695 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.5774 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.85 _refine_hist.d_res_low 52.14 _refine_hist.number_atoms_solvent 2 _refine_hist.number_atoms_total 1811 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1788 _refine_hist.pdbx_number_atoms_ligand 21 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0011 ? 2020 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.3982 ? 3146 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0184 ? 414 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0015 ? 85 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 14.2584 ? 998 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.85 3.07 . . 139 1248 98.51 . . . 0.5428 . 0.4476 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.07 3.38 . . 135 1223 99.93 . . . 0.2936 . 0.2632 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.38 3.87 . . 140 1257 99.86 . . . 0.2788 . 0.2547 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.87 4.87 . . 143 1287 100.00 . . . 0.2774 . 0.2388 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.88 52.14 . . 153 1365 99.93 . . . 0.2042 . 0.1848 . . . . . . . . . . . # _struct.entry_id 7KVV _struct.title 'Crystal structure of Squash RNA aptamer in complex with DFHBI-1T' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7KVV _struct_keywords.text 'fluorogenic aptamer, adenine riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 2 ? E N N 4 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale none ? A GTP 1 "C3'" ? ? ? 1_555 A G 2 OP1 ? ? D GTP 1 D G 2 1_555 ? ? ? ? ? ? ? 1.372 ? ? metalc1 metalc ? ? A G 41 O6 ? ? ? 1_555 D MG . MG ? ? D G 41 D MG 303 1_555 ? ? ? ? ? ? ? 2.510 ? ? metalc2 metalc ? ? A G 42 OP2 ? ? ? 1_555 B MG . MG ? ? D G 42 D MG 301 1_555 ? ? ? ? ? ? ? 2.386 ? ? metalc3 metalc ? ? A A 45 OP2 ? ? ? 1_555 B MG . MG ? ? D A 45 D MG 301 1_555 ? ? ? ? ? ? ? 2.080 ? ? metalc4 metalc ? ? A G 46 O6 ? ? ? 1_555 B MG . MG ? ? D G 46 D MG 301 1_555 ? ? ? ? ? ? ? 2.251 ? ? metalc5 metalc ? ? A G 46 "O2'" ? ? ? 1_555 D MG . MG ? ? D G 46 D MG 303 1_555 ? ? ? ? ? ? ? 2.393 ? ? metalc6 metalc ? ? B MG . MG ? ? ? 1_555 E HOH . O ? ? D MG 301 D HOH 2301 1_555 ? ? ? ? ? ? ? 2.741 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 83 N3 ? ? D GTP 1 D C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 83 O2 ? ? D GTP 1 D C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 83 N4 ? ? D GTP 1 D C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 82 N3 ? ? D G 2 D C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 82 O2 ? ? D G 2 D C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 82 N4 ? ? D G 2 D C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 81 N3 ? ? D G 3 D C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 81 O2 ? ? D G 3 D C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 81 N4 ? ? D G 3 D C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 80 N3 ? ? D A 4 D U 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 80 O4 ? ? D A 4 D U 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 79 N3 ? ? D A 5 D U 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 79 O4 ? ? D A 5 D U 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 78 N3 ? ? D G 6 D C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 78 O2 ? ? D G 6 D C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 78 N4 ? ? D G 6 D C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 77 N3 ? ? D A 7 D U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 77 O4 ? ? D A 7 D U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 76 N1 ? ? D U 8 D A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 76 N6 ? ? D U 8 D A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 75 N3 ? ? D A 9 D U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 75 O4 ? ? D A 9 D U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 74 N1 ? ? D C 10 D G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 74 O6 ? ? D C 10 D G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 74 N2 ? ? D C 10 D G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 12 N1 ? ? ? 1_555 A G 41 N2 ? ? D A 12 D G 41 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog27 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 70 N3 ? ? D G 13 D A 70 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog28 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 69 N7 ? ? D U 15 D A 69 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog29 hydrog ? ? A U 15 O2 ? ? ? 1_555 A A 69 N6 ? ? D U 15 D A 69 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog30 hydrog ? ? A G 16 N2 ? ? ? 1_555 A A 49 N1 ? ? D G 16 D A 49 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog31 hydrog ? ? A G 16 N3 ? ? ? 1_555 A A 49 N6 ? ? D G 16 D A 49 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog32 hydrog ? ? A A 17 N1 ? ? ? 1_555 A U 68 N3 ? ? D A 17 D U 68 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog33 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 38 O2 ? ? D G 18 D U 38 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog34 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 38 N3 ? ? D G 18 D U 38 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 37 N1 ? ? D C 19 D G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 37 O6 ? ? D C 19 D G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 37 N2 ? ? D C 19 D G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 36 N1 ? ? D C 20 D G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 36 O6 ? ? D C 20 D G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 36 N2 ? ? D C 20 D G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 35 N1 ? ? D C 21 D G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 35 O6 ? ? D C 21 D G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 35 N2 ? ? D C 21 D G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 22 N1 ? ? ? 1_555 A U 34 N3 ? ? D A 22 D U 34 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog45 hydrog ? ? A A 23 N1 ? ? ? 1_555 A U 33 N3 ? ? D A 23 D U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A A 23 N6 ? ? ? 1_555 A U 33 O4 ? ? D A 23 D U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 24 N3 ? ? ? 1_555 A U 32 O4 ? ? D U 24 D U 32 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog48 hydrog ? ? A U 24 O2 ? ? ? 1_555 A U 32 N3 ? ? D U 24 D U 32 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog49 hydrog ? ? A A 26 N1 ? ? ? 1_555 A A 62 N6 ? ? D A 26 D A 62 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog50 hydrog ? ? A A 26 N6 ? ? ? 1_555 A A 62 N7 ? ? D A 26 D A 62 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog51 hydrog ? ? A U 27 O2 ? ? ? 1_555 A G 30 N2 ? ? D U 27 D G 30 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog52 hydrog ? ? A U 27 N3 ? ? ? 1_555 A A 61 N7 ? ? D U 27 D A 61 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog53 hydrog ? ? A U 27 O2 ? ? ? 1_555 A A 61 N6 ? ? D U 27 D A 61 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog54 hydrog ? ? A A 28 N6 ? ? ? 1_555 A A 60 N1 ? ? D A 28 D A 60 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog55 hydrog ? ? A A 28 N7 ? ? ? 1_555 A A 60 N6 ? ? D A 28 D A 60 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog56 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 57 N3 ? ? D G 30 D C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 57 O2 ? ? D G 30 D C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 57 N4 ? ? D G 30 D C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 56 N3 ? ? D G 31 D C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 56 O2 ? ? D G 31 D C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 56 N4 ? ? D G 31 D C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 31 N2 ? ? ? 1_555 A A 62 N1 ? ? D G 31 D A 62 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog63 hydrog ? ? A G 31 N3 ? ? ? 1_555 A A 62 N6 ? ? D G 31 D A 62 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog64 hydrog ? ? A U 39 N3 ? ? ? 1_555 A A 48 N7 ? ? D U 39 D A 48 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog65 hydrog ? ? A U 39 O2 ? ? ? 1_555 A A 48 N6 ? ? D U 39 D A 48 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog66 hydrog ? ? A G 41 N1 ? ? ? 1_555 A G 47 N7 ? ? D G 41 D G 47 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog67 hydrog ? ? A G 41 N2 ? ? ? 1_555 A G 47 O6 ? ? D G 41 D G 47 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog68 hydrog ? ? A G 42 N7 ? ? ? 1_555 A G 46 N1 ? ? D G 42 D G 46 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog69 hydrog ? ? A G 42 O6 ? ? ? 1_555 A G 46 N2 ? ? D G 42 D G 46 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog70 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 72 N4 ? ? D G 42 D C 72 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog71 hydrog ? ? A A 43 N6 ? ? ? 1_555 A U 75 O2 ? ? D A 43 D U 75 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog72 hydrog ? ? A U 44 O4 ? ? ? 1_555 A G 74 N2 ? ? D U 44 D G 74 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog73 hydrog ? ? A A 45 N1 ? ? ? 1_555 A G 71 N1 ? ? D A 45 D G 71 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog74 hydrog ? ? A A 45 N6 ? ? ? 1_555 A G 71 O6 ? ? D A 45 D G 71 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog75 hydrog ? ? A G 46 N2 ? ? ? 1_555 A G 73 O6 ? ? D G 46 D G 73 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog76 hydrog ? ? A G 47 N1 ? ? ? 1_555 A C 72 N3 ? ? D G 47 D C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 47 N2 ? ? ? 1_555 A C 72 O2 ? ? D G 47 D C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 47 O6 ? ? ? 1_555 A C 72 N4 ? ? D G 47 D C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A A 48 N3 ? ? ? 1_555 A A 69 N6 ? ? D A 48 D A 69 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog80 hydrog ? ? A G 50 N1 ? ? ? 1_555 A C 67 N3 ? ? D G 50 D C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A G 50 N2 ? ? ? 1_555 A C 67 O2 ? ? D G 50 D C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 50 O6 ? ? ? 1_555 A C 67 N4 ? ? D G 50 D C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A A 52 N1 ? ? ? 1_555 A U 66 N3 ? ? D A 52 D U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A A 52 N6 ? ? ? 1_555 A U 66 O4 ? ? D A 52 D U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A G 53 N1 ? ? ? 1_555 A C 65 N3 ? ? D G 53 D C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A G 53 N2 ? ? ? 1_555 A C 65 O2 ? ? D G 53 D C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 53 O6 ? ? ? 1_555 A C 65 N4 ? ? D G 53 D C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 64 N3 ? ? D A 54 D U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 64 O4 ? ? D A 54 D U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A G 55 N1 ? ? ? 1_555 A C 63 N3 ? ? D G 55 D C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A G 55 N2 ? ? ? 1_555 A C 63 O2 ? ? D G 55 D C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 55 O6 ? ? ? 1_555 A C 63 N4 ? ? D G 55 D C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A C 57 O2 ? ? ? 1_555 A A 61 N6 ? ? D C 57 D A 61 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog94 hydrog ? ? A G 71 N2 ? ? ? 1_555 A G 73 O6 ? ? D G 71 D G 73 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _atom_sites.entry_id 7KVV _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.009590 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.009590 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019191 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? F ? ? 8.95735 ? ? ? 7.27484 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? MG ? ? 9.41153 2.53737 ? ? 2.59044 63.03566 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP D . n A 1 2 G 2 2 2 G G D . n A 1 3 G 3 3 3 G G D . n A 1 4 A 4 4 4 A A D . n A 1 5 A 5 5 5 A A D . n A 1 6 G 6 6 6 G G D . n A 1 7 A 7 7 7 A A D . n A 1 8 U 8 8 8 U U D . n A 1 9 A 9 9 9 A A D . n A 1 10 C 10 10 10 C C D . n A 1 11 A 11 11 11 A A D . n A 1 12 A 12 12 12 A A D . n A 1 13 G 13 13 13 G G D . n A 1 14 G 14 14 14 G G D . n A 1 15 U 15 15 15 U U D . n A 1 16 G 16 16 16 G G D . n A 1 17 A 17 17 17 A A D . n A 1 18 G 18 18 18 G G D . n A 1 19 C 19 19 19 C C D . n A 1 20 C 20 20 20 C C D . n A 1 21 C 21 21 21 C C D . n A 1 22 A 22 22 22 A A D . n A 1 23 A 23 23 23 A A D . n A 1 24 U 24 24 24 U U D . n A 1 25 A 25 25 25 A A D . n A 1 26 A 26 26 26 A A D . n A 1 27 U 27 27 27 U U D . n A 1 28 A 28 28 28 A A D . n A 1 29 U 29 29 29 U U D . n A 1 30 G 30 30 30 G G D . n A 1 31 G 31 31 31 G G D . n A 1 32 U 32 32 32 U U D . n A 1 33 U 33 33 33 U U D . n A 1 34 U 34 34 34 U U D . n A 1 35 G 35 35 35 G G D . n A 1 36 G 36 36 36 G G D . n A 1 37 G 37 37 37 G G D . n A 1 38 U 38 38 38 U U D . n A 1 39 U 39 39 39 U U D . n A 1 40 A 40 40 40 A A D . n A 1 41 G 41 41 41 G G D . n A 1 42 G 42 42 42 G G D . n A 1 43 A 43 43 43 A A D . n A 1 44 U 44 44 44 U U D . n A 1 45 A 45 45 45 A A D . n A 1 46 G 46 46 46 G G D . n A 1 47 G 47 47 47 G G D . n A 1 48 A 48 48 48 A A D . n A 1 49 A 49 49 49 A A D . n A 1 50 G 50 50 50 G G D . n A 1 51 U 51 51 51 U U D . n A 1 52 A 52 52 52 A A D . n A 1 53 G 53 53 53 G G D . n A 1 54 A 54 54 54 A A D . n A 1 55 G 55 55 55 G G D . n A 1 56 C 56 56 56 C C D . n A 1 57 C 57 57 57 C C D . n A 1 58 U 58 58 58 U U D . n A 1 59 U 59 59 59 U U D . n A 1 60 A 60 60 60 A A D . n A 1 61 A 61 61 61 A A D . n A 1 62 A 62 62 62 A A D . n A 1 63 C 63 63 63 C C D . n A 1 64 U 64 64 64 U U D . n A 1 65 C 65 65 65 C C D . n A 1 66 U 66 66 66 U U D . n A 1 67 C 67 67 67 C C D . n A 1 68 U 68 68 68 U U D . n A 1 69 A 69 69 69 A A D . n A 1 70 A 70 70 70 A A D . n A 1 71 G 71 71 71 G G D . n A 1 72 C 72 72 72 C C D . n A 1 73 G 73 73 73 G G D . n A 1 74 G 74 74 74 G G D . n A 1 75 U 75 75 75 U U D . n A 1 76 A 76 76 76 A A D . n A 1 77 U 77 77 77 U U D . n A 1 78 C 78 78 78 C C D . n A 1 79 U 79 79 79 U U D . n A 1 80 U 80 80 80 U U D . n A 1 81 C 81 81 81 C C D . n A 1 82 C 82 82 82 C C D . n A 1 83 C 83 83 83 C C D . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 301 301 MG MG D . C 3 747 1 302 2601 747 747 D . D 2 MG 1 303 2701 MG MG D . E 4 HOH 1 2301 2301 HOH HOH D . E 4 HOH 2 2302 2801 HOH HOH D . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O6 ? A G 41 ? D G 41 ? 1_555 MG ? D MG . ? D MG 303 ? 1_555 "O2'" ? A G 46 ? D G 46 ? 1_555 85.9 ? 2 OP2 ? A G 42 ? D G 42 ? 1_555 MG ? B MG . ? D MG 301 ? 1_555 OP2 ? A A 45 ? D A 45 ? 1_555 116.9 ? 3 OP2 ? A G 42 ? D G 42 ? 1_555 MG ? B MG . ? D MG 301 ? 1_555 O6 ? A G 46 ? D G 46 ? 1_555 75.0 ? 4 OP2 ? A A 45 ? D A 45 ? 1_555 MG ? B MG . ? D MG 301 ? 1_555 O6 ? A G 46 ? D G 46 ? 1_555 82.6 ? 5 OP2 ? A G 42 ? D G 42 ? 1_555 MG ? B MG . ? D MG 301 ? 1_555 O ? E HOH . ? D HOH 2301 ? 1_555 54.1 ? 6 OP2 ? A A 45 ? D A 45 ? 1_555 MG ? B MG . ? D MG 301 ? 1_555 O ? E HOH . ? D HOH 2301 ? 1_555 64.2 ? 7 O6 ? A G 46 ? D G 46 ? 1_555 MG ? B MG . ? D MG 301 ? 1_555 O ? E HOH . ? D HOH 2301 ? 1_555 56.6 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-01-19 2 'Structure model' 1 1 2022-02-16 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.year' 5 2 'Structure model' '_citation_author.identifier_ORCID' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y+1/2,x+1/2,z+1/2 3 y+1/2,-x+1/2,z+1/2 4 x+1/2,-y+1/2,-z+1/2 5 -x+1/2,y+1/2,-z+1/2 6 -x,-y,z 7 y,x,-z 8 -y,-x,-z # _software.citation_id ? _software.classification refinement _software.compiler_name ? _software.compiler_version ? _software.contact_author ? _software.contact_author_email ? _software.date ? _software.description ? _software.dependencies ? _software.hardware ? _software.language ? _software.location ? _software.mods ? _software.name PHENIX _software.os ? _software.os_version ? _software.type ? _software.version 1.17.1_3660 _software.pdbx_ordinal 1 # _pdbx_entry_details.entry_id 7KVV _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N # _pdbx_unobs_or_zero_occ_atoms.id 1 _pdbx_unobs_or_zero_occ_atoms.PDB_model_num 1 _pdbx_unobs_or_zero_occ_atoms.polymer_flag N _pdbx_unobs_or_zero_occ_atoms.occupancy_flag 1 _pdbx_unobs_or_zero_occ_atoms.auth_asym_id D _pdbx_unobs_or_zero_occ_atoms.auth_comp_id 747 _pdbx_unobs_or_zero_occ_atoms.auth_seq_id 302 _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code ? _pdbx_unobs_or_zero_occ_atoms.auth_atom_id O19 _pdbx_unobs_or_zero_occ_atoms.label_alt_id ? _pdbx_unobs_or_zero_occ_atoms.label_asym_id C _pdbx_unobs_or_zero_occ_atoms.label_comp_id 747 _pdbx_unobs_or_zero_occ_atoms.label_seq_id 1 _pdbx_unobs_or_zero_occ_atoms.label_atom_id O19 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 747 F1 F N N 1 747 C2 C Y N 2 747 C1 C Y N 3 747 O1 O N N 4 747 C3 C Y N 5 747 C4 C Y N 6 747 C5 C Y N 7 747 C C Y N 8 747 F F N N 9 747 C6 C N N 10 747 C7 C N N 11 747 C10 C N N 12 747 C12 C N N 13 747 N13 N N N 14 747 O14 O N N 15 747 N15 N N N 16 747 C16 C N N 17 747 C17 C N N 18 747 N18 N N N 19 747 O19 O N N 20 747 H1 H N N 21 747 H2 H N N 22 747 H3 H N N 23 747 H4 H N N 24 747 H5 H N N 25 747 H6 H N N 26 747 H7 H N N 27 747 H8 H N N 28 747 H9 H N N 29 A OP3 O N N 30 A P P N N 31 A OP1 O N N 32 A OP2 O N N 33 A "O5'" O N N 34 A "C5'" C N N 35 A "C4'" C N R 36 A "O4'" O N N 37 A "C3'" C N S 38 A "O3'" O N N 39 A "C2'" C N R 40 A "O2'" O N N 41 A "C1'" C N R 42 A N9 N Y N 43 A C8 C Y N 44 A N7 N Y N 45 A C5 C Y N 46 A C6 C Y N 47 A N6 N N N 48 A N1 N Y N 49 A C2 C Y N 50 A N3 N Y N 51 A C4 C Y N 52 A HOP3 H N N 53 A HOP2 H N N 54 A "H5'" H N N 55 A "H5''" H N N 56 A "H4'" H N N 57 A "H3'" H N N 58 A "HO3'" H N N 59 A "H2'" H N N 60 A "HO2'" H N N 61 A "H1'" H N N 62 A H8 H N N 63 A H61 H N N 64 A H62 H N N 65 A H2 H N N 66 C OP3 O N N 67 C P P N N 68 C OP1 O N N 69 C OP2 O N N 70 C "O5'" O N N 71 C "C5'" C N N 72 C "C4'" C N R 73 C "O4'" O N N 74 C "C3'" C N S 75 C "O3'" O N N 76 C "C2'" C N R 77 C "O2'" O N N 78 C "C1'" C N R 79 C N1 N N N 80 C C2 C N N 81 C O2 O N N 82 C N3 N N N 83 C C4 C N N 84 C N4 N N N 85 C C5 C N N 86 C C6 C N N 87 C HOP3 H N N 88 C HOP2 H N N 89 C "H5'" H N N 90 C "H5''" H N N 91 C "H4'" H N N 92 C "H3'" H N N 93 C "HO3'" H N N 94 C "H2'" H N N 95 C "HO2'" H N N 96 C "H1'" H N N 97 C H41 H N N 98 C H42 H N N 99 C H5 H N N 100 C H6 H N N 101 G OP3 O N N 102 G P P N N 103 G OP1 O N N 104 G OP2 O N N 105 G "O5'" O N N 106 G "C5'" C N N 107 G "C4'" C N R 108 G "O4'" O N N 109 G "C3'" C N S 110 G "O3'" O N N 111 G "C2'" C N R 112 G "O2'" O N N 113 G "C1'" C N R 114 G N9 N Y N 115 G C8 C Y N 116 G N7 N Y N 117 G C5 C Y N 118 G C6 C N N 119 G O6 O N N 120 G N1 N N N 121 G C2 C N N 122 G N2 N N N 123 G N3 N N N 124 G C4 C Y N 125 G HOP3 H N N 126 G HOP2 H N N 127 G "H5'" H N N 128 G "H5''" H N N 129 G "H4'" H N N 130 G "H3'" H N N 131 G "HO3'" H N N 132 G "H2'" H N N 133 G "HO2'" H N N 134 G "H1'" H N N 135 G H8 H N N 136 G H1 H N N 137 G H21 H N N 138 G H22 H N N 139 GTP PG P N N 140 GTP O1G O N N 141 GTP O2G O N N 142 GTP O3G O N N 143 GTP O3B O N N 144 GTP PB P N N 145 GTP O1B O N N 146 GTP O2B O N N 147 GTP O3A O N N 148 GTP PA P N N 149 GTP O1A O N N 150 GTP O2A O N N 151 GTP "O5'" O N N 152 GTP "C5'" C N N 153 GTP "C4'" C N R 154 GTP "O4'" O N N 155 GTP "C3'" C N S 156 GTP "O3'" O N N 157 GTP "C2'" C N R 158 GTP "O2'" O N N 159 GTP "C1'" C N R 160 GTP N9 N Y N 161 GTP C8 C Y N 162 GTP N7 N Y N 163 GTP C5 C Y N 164 GTP C6 C N N 165 GTP O6 O N N 166 GTP N1 N N N 167 GTP C2 C N N 168 GTP N2 N N N 169 GTP N3 N N N 170 GTP C4 C Y N 171 GTP HOG2 H N N 172 GTP HOG3 H N N 173 GTP HOB2 H N N 174 GTP HOA2 H N N 175 GTP "H5'" H N N 176 GTP "H5''" H N N 177 GTP "H4'" H N N 178 GTP "H3'" H N N 179 GTP "HO3'" H N N 180 GTP "H2'" H N N 181 GTP "HO2'" H N N 182 GTP "H1'" H N N 183 GTP H8 H N N 184 GTP HN1 H N N 185 GTP HN21 H N N 186 GTP HN22 H N N 187 HOH O O N N 188 HOH H1 H N N 189 HOH H2 H N N 190 MG MG MG N N 191 U OP3 O N N 192 U P P N N 193 U OP1 O N N 194 U OP2 O N N 195 U "O5'" O N N 196 U "C5'" C N N 197 U "C4'" C N R 198 U "O4'" O N N 199 U "C3'" C N S 200 U "O3'" O N N 201 U "C2'" C N R 202 U "O2'" O N N 203 U "C1'" C N R 204 U N1 N N N 205 U C2 C N N 206 U O2 O N N 207 U N3 N N N 208 U C4 C N N 209 U O4 O N N 210 U C5 C N N 211 U C6 C N N 212 U HOP3 H N N 213 U HOP2 H N N 214 U "H5'" H N N 215 U "H5''" H N N 216 U "H4'" H N N 217 U "H3'" H N N 218 U "HO3'" H N N 219 U "H2'" H N N 220 U "HO2'" H N N 221 U "H1'" H N N 222 U H3 H N N 223 U H5 H N N 224 U H6 H N N 225 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 747 F C sing N N 1 747 O19 N18 sing N N 2 747 O1 C1 sing N N 3 747 C C1 doub Y N 4 747 C C5 sing Y N 5 747 C17 N18 doub N E 6 747 C17 C12 sing N N 7 747 C1 C2 sing Y N 8 747 C5 C4 doub Y N 9 747 N13 C12 doub N N 10 747 N13 C7 sing N N 11 747 C12 N15 sing N N 12 747 C2 F1 sing N N 13 747 C2 C3 doub Y N 14 747 C4 C3 sing Y N 15 747 C4 C6 sing N N 16 747 N15 C16 sing N N 17 747 N15 C10 sing N N 18 747 C7 C6 doub N Z 19 747 C7 C10 sing N N 20 747 C10 O14 doub N N 21 747 O1 H1 sing N N 22 747 C3 H2 sing N N 23 747 C5 H3 sing N N 24 747 C6 H4 sing N N 25 747 C16 H5 sing N N 26 747 C16 H6 sing N N 27 747 C16 H7 sing N N 28 747 C17 H8 sing N N 29 747 O19 H9 sing N N 30 A OP3 P sing N N 31 A OP3 HOP3 sing N N 32 A P OP1 doub N N 33 A P OP2 sing N N 34 A P "O5'" sing N N 35 A OP2 HOP2 sing N N 36 A "O5'" "C5'" sing N N 37 A "C5'" "C4'" sing N N 38 A "C5'" "H5'" sing N N 39 A "C5'" "H5''" sing N N 40 A "C4'" "O4'" sing N N 41 A "C4'" "C3'" sing N N 42 A "C4'" "H4'" sing N N 43 A "O4'" "C1'" sing N N 44 A "C3'" "O3'" sing N N 45 A "C3'" "C2'" sing N N 46 A "C3'" "H3'" sing N N 47 A "O3'" "HO3'" sing N N 48 A "C2'" "O2'" sing N N 49 A "C2'" "C1'" sing N N 50 A "C2'" "H2'" sing N N 51 A "O2'" "HO2'" sing N N 52 A "C1'" N9 sing N N 53 A "C1'" "H1'" sing N N 54 A N9 C8 sing Y N 55 A N9 C4 sing Y N 56 A C8 N7 doub Y N 57 A C8 H8 sing N N 58 A N7 C5 sing Y N 59 A C5 C6 sing Y N 60 A C5 C4 doub Y N 61 A C6 N6 sing N N 62 A C6 N1 doub Y N 63 A N6 H61 sing N N 64 A N6 H62 sing N N 65 A N1 C2 sing Y N 66 A C2 N3 doub Y N 67 A C2 H2 sing N N 68 A N3 C4 sing Y N 69 C OP3 P sing N N 70 C OP3 HOP3 sing N N 71 C P OP1 doub N N 72 C P OP2 sing N N 73 C P "O5'" sing N N 74 C OP2 HOP2 sing N N 75 C "O5'" "C5'" sing N N 76 C "C5'" "C4'" sing N N 77 C "C5'" "H5'" sing N N 78 C "C5'" "H5''" sing N N 79 C "C4'" "O4'" sing N N 80 C "C4'" "C3'" sing N N 81 C "C4'" "H4'" sing N N 82 C "O4'" "C1'" sing N N 83 C "C3'" "O3'" sing N N 84 C "C3'" "C2'" sing N N 85 C "C3'" "H3'" sing N N 86 C "O3'" "HO3'" sing N N 87 C "C2'" "O2'" sing N N 88 C "C2'" "C1'" sing N N 89 C "C2'" "H2'" sing N N 90 C "O2'" "HO2'" sing N N 91 C "C1'" N1 sing N N 92 C "C1'" "H1'" sing N N 93 C N1 C2 sing N N 94 C N1 C6 sing N N 95 C C2 O2 doub N N 96 C C2 N3 sing N N 97 C N3 C4 doub N N 98 C C4 N4 sing N N 99 C C4 C5 sing N N 100 C N4 H41 sing N N 101 C N4 H42 sing N N 102 C C5 C6 doub N N 103 C C5 H5 sing N N 104 C C6 H6 sing N N 105 G OP3 P sing N N 106 G OP3 HOP3 sing N N 107 G P OP1 doub N N 108 G P OP2 sing N N 109 G P "O5'" sing N N 110 G OP2 HOP2 sing N N 111 G "O5'" "C5'" sing N N 112 G "C5'" "C4'" sing N N 113 G "C5'" "H5'" sing N N 114 G "C5'" "H5''" sing N N 115 G "C4'" "O4'" sing N N 116 G "C4'" "C3'" sing N N 117 G "C4'" "H4'" sing N N 118 G "O4'" "C1'" sing N N 119 G "C3'" "O3'" sing N N 120 G "C3'" "C2'" sing N N 121 G "C3'" "H3'" sing N N 122 G "O3'" "HO3'" sing N N 123 G "C2'" "O2'" sing N N 124 G "C2'" "C1'" sing N N 125 G "C2'" "H2'" sing N N 126 G "O2'" "HO2'" sing N N 127 G "C1'" N9 sing N N 128 G "C1'" "H1'" sing N N 129 G N9 C8 sing Y N 130 G N9 C4 sing Y N 131 G C8 N7 doub Y N 132 G C8 H8 sing N N 133 G N7 C5 sing Y N 134 G C5 C6 sing N N 135 G C5 C4 doub Y N 136 G C6 O6 doub N N 137 G C6 N1 sing N N 138 G N1 C2 sing N N 139 G N1 H1 sing N N 140 G C2 N2 sing N N 141 G C2 N3 doub N N 142 G N2 H21 sing N N 143 G N2 H22 sing N N 144 G N3 C4 sing N N 145 GTP PG O1G doub N N 146 GTP PG O2G sing N N 147 GTP PG O3G sing N N 148 GTP PG O3B sing N N 149 GTP O2G HOG2 sing N N 150 GTP O3G HOG3 sing N N 151 GTP O3B PB sing N N 152 GTP PB O1B doub N N 153 GTP PB O2B sing N N 154 GTP PB O3A sing N N 155 GTP O2B HOB2 sing N N 156 GTP O3A PA sing N N 157 GTP PA O1A doub N N 158 GTP PA O2A sing N N 159 GTP PA "O5'" sing N N 160 GTP O2A HOA2 sing N N 161 GTP "O5'" "C5'" sing N N 162 GTP "C5'" "C4'" sing N N 163 GTP "C5'" "H5'" sing N N 164 GTP "C5'" "H5''" sing N N 165 GTP "C4'" "O4'" sing N N 166 GTP "C4'" "C3'" sing N N 167 GTP "C4'" "H4'" sing N N 168 GTP "O4'" "C1'" sing N N 169 GTP "C3'" "O3'" sing N N 170 GTP "C3'" "C2'" sing N N 171 GTP "C3'" "H3'" sing N N 172 GTP "O3'" "HO3'" sing N N 173 GTP "C2'" "O2'" sing N N 174 GTP "C2'" "C1'" sing N N 175 GTP "C2'" "H2'" sing N N 176 GTP "O2'" "HO2'" sing N N 177 GTP "C1'" N9 sing N N 178 GTP "C1'" "H1'" sing N N 179 GTP N9 C8 sing Y N 180 GTP N9 C4 sing Y N 181 GTP C8 N7 doub Y N 182 GTP C8 H8 sing N N 183 GTP N7 C5 sing Y N 184 GTP C5 C6 sing N N 185 GTP C5 C4 doub Y N 186 GTP C6 O6 doub N N 187 GTP C6 N1 sing N N 188 GTP N1 C2 sing N N 189 GTP N1 HN1 sing N N 190 GTP C2 N2 sing N N 191 GTP C2 N3 doub N N 192 GTP N2 HN21 sing N N 193 GTP N2 HN22 sing N N 194 GTP N3 C4 sing N N 195 HOH O H1 sing N N 196 HOH O H2 sing N N 197 U OP3 P sing N N 198 U OP3 HOP3 sing N N 199 U P OP1 doub N N 200 U P OP2 sing N N 201 U P "O5'" sing N N 202 U OP2 HOP2 sing N N 203 U "O5'" "C5'" sing N N 204 U "C5'" "C4'" sing N N 205 U "C5'" "H5'" sing N N 206 U "C5'" "H5''" sing N N 207 U "C4'" "O4'" sing N N 208 U "C4'" "C3'" sing N N 209 U "C4'" "H4'" sing N N 210 U "O4'" "C1'" sing N N 211 U "C3'" "O3'" sing N N 212 U "C3'" "C2'" sing N N 213 U "C3'" "H3'" sing N N 214 U "O3'" "HO3'" sing N N 215 U "C2'" "O2'" sing N N 216 U "C2'" "C1'" sing N N 217 U "C2'" "H2'" sing N N 218 U "O2'" "HO2'" sing N N 219 U "C1'" N1 sing N N 220 U "C1'" "H1'" sing N N 221 U N1 C2 sing N N 222 U N1 C6 sing N N 223 U C2 O2 doub N N 224 U C2 N3 sing N N 225 U N3 C4 sing N N 226 U N3 H3 sing N N 227 U C4 O4 doub N N 228 U C4 C5 sing N N 229 U C5 C6 doub N N 230 U C5 H5 sing N N 231 U C6 H6 sing N N 232 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7KVV 'double helix' 7KVV 'a-form double helix' 7KVV 'bulge loop' 7KVV 'mismatched base pair' 7KVV 'triple helix' 7KVV 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 83 1_555 -0.110 0.419 0.479 2.439 -10.496 -1.919 1 D_GTP1:C83_D D 1 ? D 83 ? 19 1 1 A G 2 1_555 A C 82 1_555 -0.464 -0.130 -0.119 -3.542 -17.046 -3.290 2 D_G2:C82_D D 2 ? D 82 ? 19 1 1 A G 3 1_555 A C 81 1_555 -0.208 0.243 -0.131 -11.692 -9.397 12.275 3 D_G3:C81_D D 3 ? D 81 ? 19 1 1 A A 4 1_555 A U 80 1_555 0.211 0.055 -0.012 -7.989 -14.408 1.346 4 D_A4:U80_D D 4 ? D 80 ? 20 1 1 A A 5 1_555 A U 79 1_555 0.367 0.037 -0.023 -7.252 -14.537 -0.037 5 D_A5:U79_D D 5 ? D 79 ? 20 1 1 A G 6 1_555 A C 78 1_555 0.150 -0.025 0.161 -5.485 -14.310 2.187 6 D_G6:C78_D D 6 ? D 78 ? 19 1 1 A A 7 1_555 A U 77 1_555 0.002 0.191 0.122 -4.885 -11.957 -0.543 7 D_A7:U77_D D 7 ? D 77 ? 20 1 1 A U 8 1_555 A A 76 1_555 0.171 0.072 0.311 -5.933 -8.532 -0.567 8 D_U8:A76_D D 8 ? D 76 ? 20 1 1 A A 9 1_555 A U 75 1_555 0.246 0.146 0.316 -1.164 -10.443 -0.848 9 D_A9:U75_D D 9 ? D 75 ? 20 1 1 A C 10 1_555 A G 74 1_555 0.303 0.483 0.215 11.392 -7.095 2.345 10 D_C10:G74_D D 10 ? D 74 ? 19 1 1 A A 45 1_555 A G 71 1_555 -0.213 1.492 -0.762 20.244 -31.741 -5.217 11 D_A45:G71_D D 45 ? D 71 ? 8 1 1 A G 46 1_555 A G 42 1_555 6.096 -0.741 -0.031 5.175 -1.063 -112.722 12 D_G46:G42_D D 46 ? D 42 ? 7 4 1 A G 47 1_555 A C 72 1_555 -0.183 -0.061 0.012 7.523 -8.216 3.621 13 D_G47:C72_D D 47 ? D 72 ? 19 1 1 A G 13 1_555 A A 70 1_555 0.921 7.812 0.778 23.307 -4.987 126.123 14 D_G13:A70_D D 13 ? D 70 ? ? 6 1 A U 15 1_555 A A 69 1_555 4.249 -1.663 0.380 -20.373 19.329 -95.538 15 D_U15:A69_D D 15 ? D 69 ? 24 4 1 A G 16 1_555 A A 49 1_555 3.620 -3.586 -0.916 1.308 18.579 -63.744 16 D_G16:A49_D D 16 ? D 49 ? 10 6 1 A A 17 1_555 A U 68 1_555 -0.482 -3.364 -0.061 -14.985 -3.190 -169.221 17 D_A17:U68_D D 17 ? D 68 ? ? 2 1 A G 50 1_555 A C 67 1_555 0.216 0.051 0.538 -2.772 -16.287 4.893 18 D_G50:C67_D D 50 ? D 67 ? 19 1 1 A A 52 1_555 A U 66 1_555 0.006 -0.223 0.030 -1.297 -10.727 4.377 19 D_A52:U66_D D 52 ? D 66 ? 20 1 1 A G 53 1_555 A C 65 1_555 -0.119 0.199 -0.104 -6.735 -8.661 13.288 20 D_G53:C65_D D 53 ? D 65 ? 19 1 1 A A 54 1_555 A U 64 1_555 0.227 0.311 -0.017 -1.072 -5.628 7.815 21 D_A54:U64_D D 54 ? D 64 ? 20 1 1 A G 55 1_555 A C 63 1_555 -0.340 0.029 -0.565 -17.172 -21.365 3.052 22 D_G55:C63_D D 55 ? D 63 ? 19 1 1 A C 56 1_555 A G 31 1_555 -0.015 0.150 0.758 -20.564 -14.870 2.793 23 D_C56:G31_D D 56 ? D 31 ? 19 1 1 A C 57 1_555 A G 30 1_555 0.206 -0.295 0.667 -4.603 -15.915 -3.119 24 D_C57:G30_D D 57 ? D 30 ? 19 1 1 A A 60 1_555 A A 28 1_555 3.887 1.637 0.258 6.019 1.913 -114.039 25 D_A60:A28_D D 60 ? D 28 ? 5 4 1 A U 32 1_555 A U 24 1_555 -2.888 -1.856 -0.161 -5.863 -7.395 13.857 26 D_U32:U24_D D 32 ? D 24 ? 16 1 1 A U 33 1_555 A A 23 1_555 0.069 -0.073 -0.241 -0.272 -7.011 6.023 27 D_U33:A23_D D 33 ? D 23 ? 20 1 1 A U 34 1_555 A A 22 1_555 0.474 0.576 0.197 2.889 -5.785 8.501 28 D_U34:A22_D D 34 ? D 22 ? ? ? 1 A G 35 1_555 A C 21 1_555 -0.166 -0.062 0.163 4.116 -7.675 4.652 29 D_G35:C21_D D 35 ? D 21 ? 19 1 1 A G 36 1_555 A C 20 1_555 -0.135 -0.255 -0.040 0.297 -5.331 3.204 30 D_G36:C20_D D 36 ? D 20 ? 19 1 1 A G 37 1_555 A C 19 1_555 0.565 0.194 -0.440 -14.604 -14.592 2.623 31 D_G37:C19_D D 37 ? D 19 ? 19 1 1 A U 38 1_555 A G 18 1_555 2.886 -0.578 0.214 -11.054 -1.858 -6.153 32 D_U38:G18_D D 38 ? D 18 ? 28 1 1 A U 39 1_555 A A 48 1_555 4.587 -2.483 0.155 2.055 6.858 -74.823 33 D_U39:A48_D D 39 ? D 48 ? 24 4 1 A U 27 1_555 A A 61 1_555 3.733 -1.457 -0.975 -0.522 -3.017 -94.875 34 D_U27:A61_D D 27 ? D 61 ? 24 4 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 83 1_555 A G 2 1_555 A C 82 1_555 0.167 -1.889 3.302 3.540 8.801 32.428 -4.594 0.252 2.714 15.354 -6.176 33.751 1 DD_GTP1G2:C82C83_DD D 1 ? D 83 ? D 2 ? D 82 ? 1 A G 2 1_555 A C 82 1_555 A G 3 1_555 A C 81 1_555 0.769 -1.709 3.388 0.700 8.210 35.439 -3.863 -1.137 2.946 13.267 -1.131 36.354 2 DD_G2G3:C81C82_DD D 2 ? D 82 ? D 3 ? D 81 ? 1 A G 3 1_555 A C 81 1_555 A A 4 1_555 A U 80 1_555 -0.788 -1.240 3.251 -0.319 2.755 32.187 -2.707 1.361 3.144 4.957 0.574 32.304 3 DD_G3A4:U80C81_DD D 3 ? D 81 ? D 4 ? D 80 ? 1 A A 4 1_555 A U 80 1_555 A A 5 1_555 A U 79 1_555 -0.227 -1.095 3.247 -0.435 5.671 33.346 -2.767 0.322 3.028 9.794 0.751 33.814 4 DD_A4A5:U79U80_DD D 4 ? D 80 ? D 5 ? D 79 ? 1 A A 5 1_555 A U 79 1_555 A G 6 1_555 A C 78 1_555 0.174 -1.287 3.157 -1.549 5.989 31.377 -3.343 -0.576 2.857 10.941 2.830 31.965 5 DD_A5G6:C78U79_DD D 5 ? D 79 ? D 6 ? D 78 ? 1 A G 6 1_555 A C 78 1_555 A A 7 1_555 A U 77 1_555 -0.238 -1.457 3.037 -0.662 7.868 32.124 -3.730 0.321 2.621 13.957 1.173 33.056 6 DD_G6A7:U77C78_DD D 6 ? D 78 ? D 7 ? D 77 ? 1 A A 7 1_555 A U 77 1_555 A U 8 1_555 A A 76 1_555 -0.100 -1.398 3.326 -0.932 10.587 32.816 -3.932 0.030 2.758 18.155 1.598 34.449 7 DD_A7U8:A76U77_DD D 7 ? D 77 ? D 8 ? D 76 ? 1 A U 8 1_555 A A 76 1_555 A A 9 1_555 A U 75 1_555 0.169 -1.278 3.071 1.917 10.218 32.436 -3.625 -0.018 2.568 17.732 -3.326 34.019 8 DD_U8A9:U75A76_DD D 8 ? D 76 ? D 9 ? D 75 ? 1 A A 9 1_555 A U 75 1_555 A C 10 1_555 A G 74 1_555 0.903 -1.257 2.951 4.035 9.014 33.033 -3.343 -0.978 2.617 15.428 -6.907 34.439 9 DD_A9C10:G74U75_DD D 9 ? D 75 ? D 10 ? D 74 ? 1 A C 10 1_555 A G 74 1_555 A A 45 1_555 A G 71 1_555 -2.736 4.014 2.373 4.981 -4.727 119.119 2.359 1.620 2.204 -2.740 -2.888 119.240 10 DD_C10A45:G71G74_DD D 10 ? D 74 ? D 45 ? D 71 ? 1 A A 45 1_555 A G 71 1_555 A G 46 1_555 A G 42 1_555 1.015 1.500 3.805 11.586 13.506 88.383 0.729 -0.433 4.041 9.607 -8.242 89.793 11 DD_A45G46:G42G71_DD D 45 ? D 71 ? D 46 ? D 42 ? 1 A G 46 1_555 A G 42 1_555 A G 47 1_555 A C 72 1_555 -4.343 4.492 0.555 10.556 -17.140 -77.671 -3.329 -3.279 1.837 13.457 8.287 -79.837 12 DD_G46G47:C72G42_DD D 46 ? D 42 ? D 47 ? D 72 ? 1 A G 47 1_555 A C 72 1_555 A G 13 1_555 A A 70 1_555 0.490 1.480 4.722 4.439 -13.949 -132.805 -0.669 0.311 4.785 7.603 2.420 -133.213 13 DD_G47G13:A70C72_DD D 47 ? D 72 ? D 13 ? D 70 ? 1 A G 13 1_555 A A 70 1_555 A U 15 1_555 A A 69 1_555 -3.382 -1.946 5.641 32.762 -6.092 108.149 -1.057 2.690 4.919 -3.708 -19.942 111.598 14 DD_G13U15:A69A70_DD D 13 ? D 70 ? D 15 ? D 69 ? 1 A U 15 1_555 A A 69 1_555 A G 16 1_555 A A 49 1_555 2.365 -2.933 3.078 6.999 -6.313 38.370 -3.543 -2.615 3.851 -9.433 -10.457 39.468 15 DD_U15G16:A49A69_DD D 15 ? D 69 ? D 16 ? D 49 ? 1 A G 16 1_555 A A 49 1_555 A A 17 1_555 A U 68 1_555 4.523 -0.190 1.593 -118.322 -134.632 95.664 0.030 -2.371 -0.728 -67.390 59.226 179.487 16 DD_G16A17:U68A49_DD D 16 ? D 49 ? D 17 ? D 68 ? 1 A A 17 1_555 A U 68 1_555 A G 50 1_555 A C 67 1_555 2.783 -2.428 -0.343 162.223 69.134 153.681 -1.207 -1.408 0.032 34.586 -81.156 179.167 17 DD_A17G50:C67U68_DD D 17 ? D 68 ? D 50 ? D 67 ? 1 A G 50 1_555 A C 67 1_555 A A 52 1_555 A U 66 1_555 -0.897 -1.375 3.083 2.413 6.455 38.593 -2.747 1.599 2.767 9.673 -3.616 39.180 18 DD_G50A52:U66C67_DD D 50 ? D 67 ? D 52 ? D 66 ? 1 A A 52 1_555 A U 66 1_555 A G 53 1_555 A C 65 1_555 0.479 -1.710 3.355 1.300 8.777 30.585 -4.657 -0.646 2.787 16.215 -2.402 31.816 19 DD_A52G53:C65U66_DD D 52 ? D 66 ? D 53 ? D 65 ? 1 A G 53 1_555 A C 65 1_555 A A 54 1_555 A U 64 1_555 -0.136 -1.496 3.132 -0.227 3.402 30.063 -3.509 0.217 2.950 6.532 0.437 30.251 20 DD_G53A54:U64C65_DD D 53 ? D 65 ? D 54 ? D 64 ? 1 A A 54 1_555 A U 64 1_555 A G 55 1_555 A C 63 1_555 0.693 -2.189 3.661 6.690 12.261 27.835 -6.461 0.002 2.586 23.692 -12.926 31.081 21 DD_A54G55:C63U64_DD D 54 ? D 64 ? D 55 ? D 63 ? 1 A G 55 1_555 A C 63 1_555 A C 56 1_555 A G 31 1_555 2.051 -0.406 3.013 -4.013 5.178 54.876 -0.711 -2.424 2.823 5.597 4.337 55.236 22 DD_G55C56:G31C63_DD D 55 ? D 63 ? D 56 ? D 31 ? 1 A C 56 1_555 A G 31 1_555 A C 57 1_555 A G 30 1_555 -0.825 -0.867 2.956 -2.780 8.340 29.947 -3.012 1.068 2.687 15.718 5.240 31.182 23 DD_C56C57:G30G31_DD D 56 ? D 31 ? D 57 ? D 30 ? 1 A C 57 1_555 A G 30 1_555 A A 60 1_555 A A 28 1_555 -3.872 -0.269 3.988 -69.787 162.209 149.243 -0.641 1.718 4.185 81.161 34.918 179.094 24 DD_C57A60:A28G30_DD D 57 ? D 30 ? D 60 ? D 28 ? 1 A U 32 1_555 A U 24 1_555 A U 33 1_555 A A 23 1_555 -0.254 -1.157 3.300 1.611 2.638 43.443 -1.813 0.498 3.216 3.558 -2.173 43.548 25 DD_U32U33:A23U24_DD D 32 ? D 24 ? D 33 ? D 23 ? 1 A U 33 1_555 A A 23 1_555 A U 34 1_555 A A 22 1_555 -0.403 -2.177 3.285 -2.105 4.529 25.896 -5.927 0.347 2.891 9.987 4.642 26.365 26 DD_U33U34:A22A23_DD D 33 ? D 23 ? D 34 ? D 22 ? 1 A U 34 1_555 A A 22 1_555 A G 35 1_555 A C 21 1_555 -0.491 -1.431 3.095 -0.914 8.235 27.998 -4.434 0.798 2.592 16.566 1.838 29.175 27 DD_U34G35:C21A22_DD D 34 ? D 22 ? D 35 ? D 21 ? 1 A G 35 1_555 A C 21 1_555 A G 36 1_555 A C 20 1_555 -0.286 -1.449 3.161 -1.342 11.545 32.566 -4.044 0.296 2.526 19.817 2.304 34.525 28 DD_G35G36:C20C21_DD D 35 ? D 21 ? D 36 ? D 20 ? 1 A G 36 1_555 A C 20 1_555 A G 37 1_555 A C 19 1_555 0.148 -1.750 3.524 3.458 15.692 35.746 -4.460 0.185 2.566 24.120 -5.315 39.084 29 DD_G36G37:C19C20_DD D 36 ? D 20 ? D 37 ? D 19 ? 1 A G 37 1_555 A C 19 1_555 A U 38 1_555 A G 18 1_555 -0.269 -1.240 3.172 -1.596 4.421 42.510 -2.122 0.216 3.042 6.075 2.194 42.758 30 DD_G37U38:G18C19_DD D 37 ? D 19 ? D 38 ? D 18 ? 1 A U 38 1_555 A G 18 1_555 A U 39 1_555 A A 48 1_555 -2.881 -2.019 3.083 7.887 3.015 55.381 -2.302 3.463 2.579 3.223 -8.432 55.970 31 DD_U38U39:A48G18_DD D 38 ? D 18 ? D 39 ? D 48 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 '(5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylidene]-2-[(E)-(hydroxyimino)methyl]-3-methyl-3,5-dihydro-4H-imidazol-4-one' 747 4 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 7KVT _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'P 42 21 2' _space_group.name_Hall 'P 4n 2n' _space_group.IT_number 94 _space_group.crystal_system tetragonal _space_group.id 1 #