data_8FI7 # _entry.id 8FI7 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8FI7 pdb_00008fi7 10.2210/pdb8fi7/pdb WWPDB D_1000270813 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8FI7 _pdbx_database_status.recvd_initial_deposition_date 2022-12-15 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Passalacqua, L.F.M.' 1 0000-0002-5490-2427 ;Ferre-D'Amare, A.R. ; 2 0000-0003-4549-1619 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nature _citation.journal_id_ASTM NATUAS _citation.journal_id_CSD 0006 _citation.journal_id_ISSN 1476-4687 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 618 _citation.language ? _citation.page_first 1078 _citation.page_last 1084 _citation.title 'Intricate 3D architecture of a DNA mimic of GFP.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41586-023-06229-8 _citation.pdbx_database_id_PubMed 37344591 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Passalacqua, L.F.M.' 1 0000-0002-5490-2427 primary 'Banco, M.T.' 2 ? primary 'Moon, J.D.' 3 ? primary 'Li, X.' 4 0000-0003-3149-9783 primary 'Jaffrey, S.R.' 5 0000-0003-3615-6958 primary ;Ferre-D'Amare, A.R. ; 6 0000-0003-4549-1619 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 8FI7 _cell.details ? _cell.formula_units_Z ? _cell.length_a 24.571 _cell.length_a_esd ? _cell.length_b 43.104 _cell.length_b_esd ? _cell.length_c 117.641 _cell.length_c_esd ? _cell.volume 124596.309 _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8FI7 _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall 'P 2ac 2ab' _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'Lettuce DNA aptamer' 16557.574 1 ? C20T ? ? 2 non-polymer syn 'POTASSIUM ION' 39.098 2 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 3 ? ? ? ? 4 non-polymer syn '(5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylidene]-2-[(E)-(hydroxyimino)methyl]-3-methyl-3,5-dihydro-4H-imidazol-4-one' 281.215 1 ? ? ? ? 5 water nat water 18.015 16 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DC)(DT)(DT)(DA)(DG)(DT)(DA)(DG)(DG)(DG)(DA)(DT)(DG)(DA)(DT)(DG)(DC)(DG)(DG)(DT) (DA)(DG)(DT)(DG)(DG)(DG)(DC)(DT)(DT)(DC)(DG)(DC)(DA)(DG)(DT)(DT)(DC)(DC)(DT)(DG) (DC)(DG)(DA)(DG)(DG)(DG)(DG)(DA)(DC)(DT)(DA)(DA)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can CTTAGTAGGGATGATGCGGTAGTGGGCTTCGCAGTTCCTGCGAGGGGACTAAG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DC n 1 2 DT n 1 3 DT n 1 4 DA n 1 5 DG n 1 6 DT n 1 7 DA n 1 8 DG n 1 9 DG n 1 10 DG n 1 11 DA n 1 12 DT n 1 13 DG n 1 14 DA n 1 15 DT n 1 16 DG n 1 17 DC n 1 18 DG n 1 19 DG n 1 20 DT n 1 21 DA n 1 22 DG n 1 23 DT n 1 24 DG n 1 25 DG n 1 26 DG n 1 27 DC n 1 28 DT n 1 29 DT n 1 30 DC n 1 31 DG n 1 32 DC n 1 33 DA n 1 34 DG n 1 35 DT n 1 36 DT n 1 37 DC n 1 38 DC n 1 39 DT n 1 40 DG n 1 41 DC n 1 42 DG n 1 43 DA n 1 44 DG n 1 45 DG n 1 46 DG n 1 47 DG n 1 48 DA n 1 49 DC n 1 50 DT n 1 51 DA n 1 52 DA n 1 53 DG n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 53 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8FI7 _struct_ref.pdbx_db_accession 8FI7 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8FI7 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 53 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8FI7 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 53 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 53 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 747 non-polymer . '(5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylidene]-2-[(E)-(hydroxyimino)methyl]-3-methyl-3,5-dihydro-4H-imidazol-4-one' ? 'C12 H9 F2 N3 O3' 281.215 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8FI7 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 1.88 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 34.62 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.05 M Magnesium chloride hexahydrate, 0.1 M HEPES pH 7.5, 30% (v/v) polyethylene glycol monoethyl ether 550' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 294 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2022-06-24 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.105 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 24-ID-C' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.105 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 24-ID-C _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 52.33 _reflns.entry_id 8FI7 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.8 _reflns.d_resolution_low 40.47 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 3374 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98.63 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 9.15 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 22.8 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.996 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.164 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.8 _reflns_shell.d_res_low 2.9 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.5 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 325 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.958 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.442 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 44.99 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8FI7 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.90 _refine.ls_d_res_low 34.77 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3048 _refine.ls_number_reflns_R_free 282 _refine.ls_number_reflns_R_work 2727 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 97.73 _refine.ls_percent_reflns_R_free 9.37 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2471 _refine.ls_R_factor_R_free 0.289 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.244 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.43 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 8FHV _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 19.9776 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.3780 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.90 _refine_hist.d_res_low 34.77 _refine_hist.number_atoms_solvent 16 _refine_hist.number_atoms_total 1141 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1100 _refine_hist.pdbx_number_atoms_ligand 25 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0046 ? 1282 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.6787 ? 1982 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0313 ? 215 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0044 ? 57 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 35.3843 ? 542 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.90 3.65 . . 136 1300 96.38 . . . . 0.2431 . . . . . . . . . . . 0.3222 'X-RAY DIFFRACTION' 3.65 34.77 . . 146 1427 98.99 . . . . 0.2428 . . . . . . . . . . . 0.2695 # _struct.entry_id 8FI7 _struct.title 'Structure of Lettuce C20T bound to DFHO' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8FI7 _struct_keywords.text 'DNA, aptamer, fluorescence, turn-on, fluorogenic, fluorophore, G-quartet, G-quadruplex' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 4 ? H N N 5 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A DG 9 O6 ? ? ? 1_555 C K . K ? ? A DG 9 A K 102 1_555 ? ? ? ? ? ? ? 2.626 ? ? metalc2 metalc ? ? A DG 10 O6 ? ? ? 1_555 B K . K ? ? A DG 10 A K 101 1_555 ? ? ? ? ? ? ? 3.054 ? ? metalc3 metalc ? ? A DG 10 O6 ? ? ? 1_555 C K . K ? ? A DG 10 A K 102 1_555 ? ? ? ? ? ? ? 2.734 ? ? metalc4 metalc ? ? A DT 15 OP2 ? ? ? 1_555 D MG . MG ? ? A DT 15 A MG 103 1_555 ? ? ? ? ? ? ? 2.068 ? ? metalc5 metalc ? ? A DG 18 O6 ? ? ? 1_555 B K . K ? ? A DG 18 A K 101 1_555 ? ? ? ? ? ? ? 2.810 ? ? metalc6 metalc ? ? A DG 18 O6 ? ? ? 1_555 C K . K ? ? A DG 18 A K 102 1_555 ? ? ? ? ? ? ? 3.028 ? ? metalc7 metalc ? ? A DG 19 O6 ? ? ? 1_555 C K . K ? ? A DG 19 A K 102 1_555 ? ? ? ? ? ? ? 2.665 ? ? metalc8 metalc ? ? A DT 20 OP2 ? ? ? 1_555 F MG . MG ? ? A DT 20 A MG 105 1_555 ? ? ? ? ? ? ? 2.007 ? ? metalc9 metalc ? ? A DG 24 O6 ? ? ? 1_555 C K . K ? ? A DG 24 A K 102 1_555 ? ? ? ? ? ? ? 2.712 ? ? metalc10 metalc ? ? A DG 25 O6 ? ? ? 1_555 B K . K ? ? A DG 25 A K 101 1_555 ? ? ? ? ? ? ? 2.675 ? ? metalc11 metalc ? ? A DG 25 O6 ? ? ? 1_555 C K . K ? ? A DG 25 A K 102 1_555 ? ? ? ? ? ? ? 2.767 ? ? metalc12 metalc ? ? A DG 45 O6 ? ? ? 1_555 B K . K ? ? A DG 45 A K 101 1_555 ? ? ? ? ? ? ? 2.706 ? ? metalc13 metalc ? ? A DG 45 O6 ? ? ? 1_555 C K . K ? ? A DG 45 A K 102 1_555 ? ? ? ? ? ? ? 2.658 ? ? metalc14 metalc ? ? A DG 46 O6 ? ? ? 1_555 C K . K ? ? A DG 46 A K 102 1_555 ? ? ? ? ? ? ? 3.181 ? ? metalc15 metalc ? ? A DA 52 OP2 ? ? ? 1_555 E MG . MG ? ? A DA 52 A MG 104 1_555 ? ? ? ? ? ? ? 2.584 ? ? metalc16 metalc ? ? B K . K ? ? ? 1_555 G 747 . O1 ? ? A K 101 A 747 106 1_555 ? ? ? ? ? ? ? 2.660 ? ? metalc17 metalc ? ? D MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 103 A HOH 203 1_555 ? ? ? ? ? ? ? 2.373 ? ? metalc18 metalc ? ? D MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 103 A HOH 207 1_555 ? ? ? ? ? ? ? 2.024 ? ? metalc19 metalc ? ? D MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 103 A HOH 208 1_555 ? ? ? ? ? ? ? 2.363 ? ? metalc20 metalc ? ? E MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 104 A HOH 201 1_555 ? ? ? ? ? ? ? 2.290 ? ? metalc21 metalc ? ? E MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 104 A HOH 209 1_555 ? ? ? ? ? ? ? 2.042 ? ? metalc22 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 105 A HOH 202 1_555 ? ? ? ? ? ? ? 2.259 ? ? metalc23 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 105 A HOH 204 1_555 ? ? ? ? ? ? ? 2.639 ? ? metalc24 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 105 A HOH 205 1_555 ? ? ? ? ? ? ? 2.805 ? ? metalc25 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 105 A HOH 206 1_555 ? ? ? ? ? ? ? 2.029 ? ? hydrog1 hydrog ? ? A DC 1 N3 ? ? ? 1_555 A DG 53 N1 ? ? A DC 1 A DG 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DC 1 N4 ? ? ? 1_555 A DG 53 O6 ? ? A DC 1 A DG 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DC 1 O2 ? ? ? 1_555 A DG 53 N2 ? ? A DC 1 A DG 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DT 2 N3 ? ? ? 1_555 A DA 52 N1 ? ? A DT 2 A DA 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DT 2 O4 ? ? ? 1_555 A DA 52 N6 ? ? A DT 2 A DA 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DT 3 N3 ? ? ? 1_555 A DA 51 N1 ? ? A DT 3 A DA 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DT 3 O4 ? ? ? 1_555 A DA 51 N6 ? ? A DT 3 A DA 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 4 N1 ? ? ? 1_555 A DT 50 N3 ? ? A DA 4 A DT 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DA 4 N6 ? ? ? 1_555 A DT 50 O4 ? ? A DA 4 A DT 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DC 49 N3 ? ? A DG 5 A DC 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DC 49 O2 ? ? A DG 5 A DC 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DC 49 N4 ? ? A DG 5 A DC 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DT 6 N3 ? ? ? 1_555 A DA 48 N1 ? ? A DT 6 A DA 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DT 6 O4 ? ? ? 1_555 A DA 48 N6 ? ? A DT 6 A DA 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DA 7 N6 A ? ? 1_555 A DT 23 O2 ? ? A DA 7 A DT 23 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A DA 7 N7 A ? ? 1_555 A DT 23 N3 ? ? A DA 7 A DT 23 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A DA 7 N1 A ? ? 1_555 A DG 47 N1 ? ? A DA 7 A DG 47 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog18 hydrog ? ? A DA 7 N6 A ? ? 1_555 A DG 47 O6 ? ? A DA 7 A DG 47 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog19 hydrog ? ? A DA 7 N6 B ? ? 1_555 A DG 47 O6 ? ? A DA 7 A DG 47 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog20 hydrog ? ? A DG 8 O6 ? ? ? 1_555 A DG 22 N2 ? ? A DG 8 A DG 22 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog21 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DG 24 O6 ? ? A DG 8 A DG 24 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog22 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DG 46 O6 ? ? A DG 8 A DG 46 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog23 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 9 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 9 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 9 N7 ? ? ? 1_555 A DG 46 N2 ? ? A DG 9 A DG 46 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 9 O6 ? ? ? 1_555 A DG 46 N1 ? ? A DG 9 A DG 46 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 10 N7 ? ? ? 1_555 A DG 18 N2 ? ? A DG 10 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 10 O6 ? ? ? 1_555 A DG 18 N1 ? ? A DG 10 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog29 hydrog ? ? A DG 10 N1 ? ? ? 1_555 A DG 45 O6 ? ? A DG 10 A DG 45 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog30 hydrog ? ? A DG 10 N2 ? ? ? 1_555 A DG 45 N7 ? ? A DG 10 A DG 45 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog31 hydrog ? ? A DT 12 O4 ? ? ? 1_555 A DC 17 N4 ? ? A DT 12 A DC 17 1_555 ? ? ? ? ? ? 'DT-DC MISPAIR' ? ? ? hydrog32 hydrog ? ? A DG 13 N1 ? ? ? 1_555 A DG 16 N7 ? ? A DG 13 A DG 16 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog33 hydrog ? ? A DG 13 N2 ? ? ? 1_555 A DG 16 O6 ? ? A DG 13 A DG 16 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog34 hydrog ? ? A DA 14 N6 ? ? ? 1_555 A DT 29 O4 ? ? A DA 14 A DT 29 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog35 hydrog ? ? A DA 14 N7 ? ? ? 1_555 A DT 29 N3 ? ? A DA 14 A DT 29 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog36 hydrog ? ? A DT 15 N3 ? ? ? 1_555 A DT 28 O2 ? ? A DT 15 A DT 28 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog37 hydrog ? ? A DT 15 O4 ? ? ? 1_555 A DT 28 N3 ? ? A DT 15 A DT 28 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog38 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DC 27 N3 ? ? A DG 16 A DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DG 16 N2 ? ? ? 1_555 A DC 27 O2 ? ? A DG 16 A DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DG 16 O6 ? ? ? 1_555 A DC 27 N4 ? ? A DG 16 A DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DC 17 N3 ? ? ? 1_555 A DG 26 N1 ? ? A DC 17 A DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 17 N4 ? ? ? 1_555 A DG 26 O6 ? ? A DC 17 A DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 17 O2 ? ? ? 1_555 A DG 26 N2 ? ? A DC 17 A DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DG 18 N7 ? ? ? 1_555 A DG 25 N2 ? ? A DG 18 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog45 hydrog ? ? A DG 18 O6 ? ? ? 1_555 A DG 25 N1 ? ? A DG 18 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog46 hydrog ? ? A DG 19 N2 ? ? ? 1_555 A DA 21 N1 ? ? A DG 19 A DA 21 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog47 hydrog ? ? A DG 19 N3 ? ? ? 1_555 A DA 21 N6 ? ? A DG 19 A DA 21 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog48 hydrog ? ? A DG 19 N1 ? ? ? 1_555 A DG 24 O6 ? ? A DG 19 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog49 hydrog ? ? A DG 19 N2 ? ? ? 1_555 A DG 24 N7 ? ? A DG 19 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog50 hydrog ? ? A DT 20 O4 ? ? ? 1_555 A DG 25 N2 ? ? A DT 20 A DG 25 1_555 ? ? ? ? ? ? 'DT-DG MISPAIR' ? ? ? hydrog51 hydrog ? ? A DG 22 N2 ? ? ? 1_555 A DG 24 N7 ? ? A DG 22 A DG 24 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog52 hydrog ? ? A DG 24 N1 ? ? ? 1_555 A DG 46 O6 ? ? A DG 24 A DG 46 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog53 hydrog ? ? A DG 24 N2 ? ? ? 1_555 A DG 46 N7 ? ? A DG 24 A DG 46 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog54 hydrog ? ? A DG 25 N7 ? ? ? 1_555 A DG 45 N2 ? ? A DG 25 A DG 45 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog55 hydrog ? ? A DG 25 O6 ? ? ? 1_555 A DG 45 N1 ? ? A DG 25 A DG 45 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog56 hydrog ? ? A DG 26 N7 ? ? ? 1_555 A DG 44 N1 ? ? A DG 26 A DG 44 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog57 hydrog ? ? A DG 26 O6 ? ? ? 1_555 A DG 44 N2 ? ? A DG 26 A DG 44 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog58 hydrog ? ? A DC 30 N3 ? ? ? 1_555 A DG 42 N1 ? ? A DC 30 A DG 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A DC 30 N4 ? ? ? 1_555 A DG 42 O6 ? ? A DC 30 A DG 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A DC 30 O2 ? ? ? 1_555 A DG 42 N2 ? ? A DC 30 A DG 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A DG 31 N1 ? ? ? 1_555 A DC 41 N3 ? ? A DG 31 A DC 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A DG 31 N2 ? ? ? 1_555 A DC 41 O2 ? ? A DG 31 A DC 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A DG 31 O6 ? ? ? 1_555 A DC 41 N4 ? ? A DG 31 A DC 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A DC 32 N3 ? ? ? 1_555 A DG 40 N1 ? ? A DC 32 A DG 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A DC 32 N4 ? ? ? 1_555 A DG 40 O6 ? ? A DC 32 A DG 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A DC 32 O2 ? ? ? 1_555 A DG 40 N2 ? ? A DC 32 A DG 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A DA 33 N1 ? ? ? 1_555 A DT 39 N3 ? ? A DA 33 A DT 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A DA 33 N6 ? ? ? 1_555 A DT 39 O4 ? ? A DA 33 A DT 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 8FI7 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.040698 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.023200 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.008500 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? F ? ? 8.95735 ? ? ? 7.27484 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? K ? ? 16.37977 2.54835 ? ? 4.54127 84.28225 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? MG ? ? 9.41153 2.53737 ? ? 2.59044 63.03566 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DC 1 1 1 DC DC A . n A 1 2 DT 2 2 2 DT DT A . n A 1 3 DT 3 3 3 DT DT A . n A 1 4 DA 4 4 4 DA DA A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DT 6 6 6 DT DT A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DA 11 11 11 DA DA A . n A 1 12 DT 12 12 12 DT DT A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DA 14 14 14 DA DA A . n A 1 15 DT 15 15 15 DT DT A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DC 17 17 17 DC DC A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DT 20 20 20 DT DT A . n A 1 21 DA 21 21 21 DA DA A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DT 23 23 23 DT DT A . n A 1 24 DG 24 24 24 DG DG A . n A 1 25 DG 25 25 25 DG DG A . n A 1 26 DG 26 26 26 DG DG A . n A 1 27 DC 27 27 27 DC DC A . n A 1 28 DT 28 28 28 DT DT A . n A 1 29 DT 29 29 29 DT DT A . n A 1 30 DC 30 30 30 DC DC A . n A 1 31 DG 31 31 31 DG DG A . n A 1 32 DC 32 32 32 DC DC A . n A 1 33 DA 33 33 33 DA DA A . n A 1 34 DG 34 34 34 DG DG A . n A 1 35 DT 35 35 35 DT DT A . n A 1 36 DT 36 36 36 DT DT A . n A 1 37 DC 37 37 37 DC DC A . n A 1 38 DC 38 38 38 DC DC A . n A 1 39 DT 39 39 39 DT DT A . n A 1 40 DG 40 40 40 DG DG A . n A 1 41 DC 41 41 41 DC DC A . n A 1 42 DG 42 42 42 DG DG A . n A 1 43 DA 43 43 43 DA DA A . n A 1 44 DG 44 44 44 DG DG A . n A 1 45 DG 45 45 45 DG DG A . n A 1 46 DG 46 46 46 DG DG A . n A 1 47 DG 47 47 47 DG DG A . n A 1 48 DA 48 48 48 DA DA A . n A 1 49 DC 49 49 49 DC DC A . n A 1 50 DT 50 50 50 DT DT A . n A 1 51 DA 51 51 51 DA DA A . n A 1 52 DA 52 52 52 DA DA A . n A 1 53 DG 53 53 53 DG DG A . n # _pdbx_contact_author.id 2 _pdbx_contact_author.email adrian.ferre@nih.gov _pdbx_contact_author.name_first 'Adrian R.' _pdbx_contact_author.name_last "Ferre-D'Amare" _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-4549-1619 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 K 1 101 1 K K A . C 2 K 1 102 2 K K A . D 3 MG 1 103 1 MG MG A . E 3 MG 1 104 2 MG MG A . F 3 MG 1 105 3 MG MG A . G 4 747 1 106 1 747 LIG A . H 5 HOH 1 201 6 HOH HOH A . H 5 HOH 2 202 12 HOH HOH A . H 5 HOH 3 203 4 HOH HOH A . H 5 HOH 4 204 11 HOH HOH A . H 5 HOH 5 205 5 HOH HOH A . H 5 HOH 6 206 8 HOH HOH A . H 5 HOH 7 207 15 HOH HOH A . H 5 HOH 8 208 3 HOH HOH A . H 5 HOH 9 209 7 HOH HOH A . H 5 HOH 10 210 13 HOH HOH A . H 5 HOH 11 211 9 HOH HOH A . H 5 HOH 12 212 10 HOH HOH A . H 5 HOH 13 213 16 HOH HOH A . H 5 HOH 14 214 2 HOH HOH A . H 5 HOH 15 215 1 HOH HOH A . H 5 HOH 16 216 14 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 10 ? A DG 10 ? 1_555 72.3 ? 2 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 18 ? A DG 18 ? 1_555 116.5 ? 3 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 18 ? A DG 18 ? 1_555 61.2 ? 4 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 19 ? A DG 19 ? 1_555 73.0 ? 5 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 19 ? A DG 19 ? 1_555 84.3 ? 6 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 19 ? A DG 19 ? 1_555 62.2 ? 7 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 24 ? A DG 24 ? 1_555 112.2 ? 8 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 24 ? A DG 24 ? 1_555 164.4 ? 9 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 24 ? A DG 24 ? 1_555 104.6 ? 10 O6 ? A DG 19 ? A DG 19 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 24 ? A DG 24 ? 1_555 82.9 ? 11 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 172.5 ? 12 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 104.6 ? 13 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 66.3 ? 14 O6 ? A DG 19 ? A DG 19 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 113.9 ? 15 O6 ? A DG 24 ? A DG 24 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 72.7 ? 16 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 102.6 ? 17 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 69.2 ? 18 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 98.8 ? 19 O6 ? A DG 19 ? A DG 19 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 153.0 ? 20 O6 ? A DG 24 ? A DG 24 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 122.3 ? 21 O6 ? A DG 25 ? A DG 25 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 69.9 ? 22 O6 ? A DG 9 ? A DG 9 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 70.6 ? 23 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 125.6 ? 24 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 172.3 ? 25 O6 ? A DG 19 ? A DG 19 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 119.8 ? 26 O6 ? A DG 24 ? A DG 24 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 69.1 ? 27 O6 ? A DG 25 ? A DG 25 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 107.0 ? 28 O6 ? A DG 45 ? A DG 45 ? 1_555 K ? C K . ? A K 102 ? 1_555 O6 ? A DG 46 ? A DG 46 ? 1_555 81.7 ? 29 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? B K . ? A K 101 ? 1_555 O6 ? A DG 18 ? A DG 18 ? 1_555 60.1 ? 30 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? B K . ? A K 101 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 98.7 ? 31 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? B K . ? A K 101 ? 1_555 O6 ? A DG 25 ? A DG 25 ? 1_555 70.7 ? 32 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? B K . ? A K 101 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 63.9 ? 33 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? B K . ? A K 101 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 103.2 ? 34 O6 ? A DG 25 ? A DG 25 ? 1_555 K ? B K . ? A K 101 ? 1_555 O6 ? A DG 45 ? A DG 45 ? 1_555 70.6 ? 35 O6 ? A DG 10 ? A DG 10 ? 1_555 K ? B K . ? A K 101 ? 1_555 O1 ? G 747 . ? A 747 106 ? 1_555 98.4 ? 36 O6 ? A DG 18 ? A DG 18 ? 1_555 K ? B K . ? A K 101 ? 1_555 O1 ? G 747 . ? A 747 106 ? 1_555 69.3 ? 37 O6 ? A DG 25 ? A DG 25 ? 1_555 K ? B K . ? A K 101 ? 1_555 O1 ? G 747 . ? A 747 106 ? 1_555 119.7 ? 38 O6 ? A DG 45 ? A DG 45 ? 1_555 K ? B K . ? A K 101 ? 1_555 O1 ? G 747 . ? A 747 106 ? 1_555 161.6 ? 39 OP2 ? A DT 15 ? A DT 15 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? H HOH . ? A HOH 203 ? 1_555 60.9 ? 40 OP2 ? A DT 15 ? A DT 15 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? H HOH . ? A HOH 207 ? 1_555 79.8 ? 41 O ? H HOH . ? A HOH 203 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? H HOH . ? A HOH 207 ? 1_555 65.7 ? 42 OP2 ? A DT 15 ? A DT 15 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? H HOH . ? A HOH 208 ? 1_555 73.4 ? 43 O ? H HOH . ? A HOH 203 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? H HOH . ? A HOH 208 ? 1_555 124.5 ? 44 O ? H HOH . ? A HOH 207 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? H HOH . ? A HOH 208 ? 1_555 77.2 ? 45 OP2 ? A DT 20 ? A DT 20 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 202 ? 1_555 61.5 ? 46 OP2 ? A DT 20 ? A DT 20 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 204 ? 1_555 92.8 ? 47 O ? H HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 204 ? 1_555 150.9 ? 48 OP2 ? A DT 20 ? A DT 20 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 205 ? 1_555 84.5 ? 49 O ? H HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 205 ? 1_555 71.7 ? 50 O ? H HOH . ? A HOH 204 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 205 ? 1_555 93.9 ? 51 OP2 ? A DT 20 ? A DT 20 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 206 ? 1_555 160.5 ? 52 O ? H HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 206 ? 1_555 99.8 ? 53 O ? H HOH . ? A HOH 204 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 206 ? 1_555 103.7 ? 54 O ? H HOH . ? A HOH 205 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? H HOH . ? A HOH 206 ? 1_555 84.1 ? 55 OP2 ? A DA 52 ? A DA 52 ? 1_555 MG ? E MG . ? A MG 104 ? 1_555 O ? H HOH . ? A HOH 201 ? 1_555 53.0 ? 56 OP2 ? A DA 52 ? A DA 52 ? 1_555 MG ? E MG . ? A MG 104 ? 1_555 O ? H HOH . ? A HOH 209 ? 1_555 72.4 ? 57 O ? H HOH . ? A HOH 201 ? 1_555 MG ? E MG . ? A MG 104 ? 1_555 O ? H HOH . ? A HOH 209 ? 1_555 93.0 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-05-10 2 'Structure model' 1 1 2023-07-05 3 'Structure model' 1 2 2023-10-25 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.journal_volume' 7 2 'Structure model' '_citation.page_first' 8 2 'Structure model' '_citation.page_last' 9 2 'Structure model' '_citation.pdbx_database_id_DOI' 10 2 'Structure model' '_citation.pdbx_database_id_PubMed' 11 2 'Structure model' '_citation.title' 12 2 'Structure model' '_citation.year' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 x+1/2,-y+1/2,-z 3 -x,y+1/2,-z+1/2 4 -x+1/2,-y,z+1/2 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -18.5317092337 _pdbx_refine_tls.origin_y -39.8640434732 _pdbx_refine_tls.origin_z -101.061750959 _pdbx_refine_tls.T[1][1] 0.494142000184 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.0217403442403 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0556863700079 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.492500914149 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] -0.0361802481194 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.0949260087338 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 0.565769990036 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.00981226619443 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.0692646029429 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.586255106012 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.167141944 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.465151781698 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.075404006507 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.213753645389 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.0995553476789 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] -0.222209740828 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.122102845755 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0842676770388 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.0551658248986 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.0580464935586 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] 0.210381491552 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id A _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id A _pdbx_refine_tls_group.beg_auth_seq_id 1 _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id H _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id L _pdbx_refine_tls_group.end_auth_seq_id 1 _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'model building' ? ? ? ? ? ? ? ? ? ? ? Coot ? ? ? 0.9.5 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19.2_4158 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _pdbx_entry_details.entry_id 8FI7 _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP2 A DA 52 ? ? O A HOH 201 ? ? 2.19 2 1 OP2 A DT 20 ? ? O A HOH 202 ? ? 2.19 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 DG _pdbx_validate_rmsd_angle.auth_seq_id_1 46 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 DG _pdbx_validate_rmsd_angle.auth_seq_id_2 46 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N9 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 DG _pdbx_validate_rmsd_angle.auth_seq_id_3 46 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 110.49 _pdbx_validate_rmsd_angle.angle_target_value 108.30 _pdbx_validate_rmsd_angle.angle_deviation 2.19 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.30 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 747 F1 F N N 1 747 C2 C Y N 2 747 C1 C Y N 3 747 O1 O N N 4 747 C3 C Y N 5 747 C4 C Y N 6 747 C5 C Y N 7 747 C C Y N 8 747 F F N N 9 747 C6 C N N 10 747 C7 C N N 11 747 C10 C N N 12 747 C12 C N N 13 747 N13 N N N 14 747 O14 O N N 15 747 N15 N N N 16 747 C16 C N N 17 747 C17 C N N 18 747 N18 N N N 19 747 O19 O N N 20 747 H1 H N N 21 747 H2 H N N 22 747 H3 H N N 23 747 H4 H N N 24 747 H5 H N N 25 747 H6 H N N 26 747 H7 H N N 27 747 H8 H N N 28 747 H9 H N N 29 DA OP3 O N N 30 DA P P N N 31 DA OP1 O N N 32 DA OP2 O N N 33 DA "O5'" O N N 34 DA "C5'" C N N 35 DA "C4'" C N R 36 DA "O4'" O N N 37 DA "C3'" C N S 38 DA "O3'" O N N 39 DA "C2'" C N N 40 DA "C1'" C N R 41 DA N9 N Y N 42 DA C8 C Y N 43 DA N7 N Y N 44 DA C5 C Y N 45 DA C6 C Y N 46 DA N6 N N N 47 DA N1 N Y N 48 DA C2 C Y N 49 DA N3 N Y N 50 DA C4 C Y N 51 DA HOP3 H N N 52 DA HOP2 H N N 53 DA "H5'" H N N 54 DA "H5''" H N N 55 DA "H4'" H N N 56 DA "H3'" H N N 57 DA "HO3'" H N N 58 DA "H2'" H N N 59 DA "H2''" H N N 60 DA "H1'" H N N 61 DA H8 H N N 62 DA H61 H N N 63 DA H62 H N N 64 DA H2 H N N 65 DC OP3 O N N 66 DC P P N N 67 DC OP1 O N N 68 DC OP2 O N N 69 DC "O5'" O N N 70 DC "C5'" C N N 71 DC "C4'" C N R 72 DC "O4'" O N N 73 DC "C3'" C N S 74 DC "O3'" O N N 75 DC "C2'" C N N 76 DC "C1'" C N R 77 DC N1 N N N 78 DC C2 C N N 79 DC O2 O N N 80 DC N3 N N N 81 DC C4 C N N 82 DC N4 N N N 83 DC C5 C N N 84 DC C6 C N N 85 DC HOP3 H N N 86 DC HOP2 H N N 87 DC "H5'" H N N 88 DC "H5''" H N N 89 DC "H4'" H N N 90 DC "H3'" H N N 91 DC "HO3'" H N N 92 DC "H2'" H N N 93 DC "H2''" H N N 94 DC "H1'" H N N 95 DC H41 H N N 96 DC H42 H N N 97 DC H5 H N N 98 DC H6 H N N 99 DG OP3 O N N 100 DG P P N N 101 DG OP1 O N N 102 DG OP2 O N N 103 DG "O5'" O N N 104 DG "C5'" C N N 105 DG "C4'" C N R 106 DG "O4'" O N N 107 DG "C3'" C N S 108 DG "O3'" O N N 109 DG "C2'" C N N 110 DG "C1'" C N R 111 DG N9 N Y N 112 DG C8 C Y N 113 DG N7 N Y N 114 DG C5 C Y N 115 DG C6 C N N 116 DG O6 O N N 117 DG N1 N N N 118 DG C2 C N N 119 DG N2 N N N 120 DG N3 N N N 121 DG C4 C Y N 122 DG HOP3 H N N 123 DG HOP2 H N N 124 DG "H5'" H N N 125 DG "H5''" H N N 126 DG "H4'" H N N 127 DG "H3'" H N N 128 DG "HO3'" H N N 129 DG "H2'" H N N 130 DG "H2''" H N N 131 DG "H1'" H N N 132 DG H8 H N N 133 DG H1 H N N 134 DG H21 H N N 135 DG H22 H N N 136 DT OP3 O N N 137 DT P P N N 138 DT OP1 O N N 139 DT OP2 O N N 140 DT "O5'" O N N 141 DT "C5'" C N N 142 DT "C4'" C N R 143 DT "O4'" O N N 144 DT "C3'" C N S 145 DT "O3'" O N N 146 DT "C2'" C N N 147 DT "C1'" C N R 148 DT N1 N N N 149 DT C2 C N N 150 DT O2 O N N 151 DT N3 N N N 152 DT C4 C N N 153 DT O4 O N N 154 DT C5 C N N 155 DT C7 C N N 156 DT C6 C N N 157 DT HOP3 H N N 158 DT HOP2 H N N 159 DT "H5'" H N N 160 DT "H5''" H N N 161 DT "H4'" H N N 162 DT "H3'" H N N 163 DT "HO3'" H N N 164 DT "H2'" H N N 165 DT "H2''" H N N 166 DT "H1'" H N N 167 DT H3 H N N 168 DT H71 H N N 169 DT H72 H N N 170 DT H73 H N N 171 DT H6 H N N 172 HOH O O N N 173 HOH H1 H N N 174 HOH H2 H N N 175 K K K N N 176 MG MG MG N N 177 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 747 F C sing N N 1 747 O19 N18 sing N N 2 747 O1 C1 sing N N 3 747 C C1 doub Y N 4 747 C C5 sing Y N 5 747 C17 N18 doub N E 6 747 C17 C12 sing N N 7 747 C1 C2 sing Y N 8 747 C5 C4 doub Y N 9 747 N13 C12 doub N N 10 747 N13 C7 sing N N 11 747 C12 N15 sing N N 12 747 C2 F1 sing N N 13 747 C2 C3 doub Y N 14 747 C4 C3 sing Y N 15 747 C4 C6 sing N N 16 747 N15 C16 sing N N 17 747 N15 C10 sing N N 18 747 C7 C6 doub N Z 19 747 C7 C10 sing N N 20 747 C10 O14 doub N N 21 747 O1 H1 sing N N 22 747 C3 H2 sing N N 23 747 C5 H3 sing N N 24 747 C6 H4 sing N N 25 747 C16 H5 sing N N 26 747 C16 H6 sing N N 27 747 C16 H7 sing N N 28 747 C17 H8 sing N N 29 747 O19 H9 sing N N 30 DA OP3 P sing N N 31 DA OP3 HOP3 sing N N 32 DA P OP1 doub N N 33 DA P OP2 sing N N 34 DA P "O5'" sing N N 35 DA OP2 HOP2 sing N N 36 DA "O5'" "C5'" sing N N 37 DA "C5'" "C4'" sing N N 38 DA "C5'" "H5'" sing N N 39 DA "C5'" "H5''" sing N N 40 DA "C4'" "O4'" sing N N 41 DA "C4'" "C3'" sing N N 42 DA "C4'" "H4'" sing N N 43 DA "O4'" "C1'" sing N N 44 DA "C3'" "O3'" sing N N 45 DA "C3'" "C2'" sing N N 46 DA "C3'" "H3'" sing N N 47 DA "O3'" "HO3'" sing N N 48 DA "C2'" "C1'" sing N N 49 DA "C2'" "H2'" sing N N 50 DA "C2'" "H2''" sing N N 51 DA "C1'" N9 sing N N 52 DA "C1'" "H1'" sing N N 53 DA N9 C8 sing Y N 54 DA N9 C4 sing Y N 55 DA C8 N7 doub Y N 56 DA C8 H8 sing N N 57 DA N7 C5 sing Y N 58 DA C5 C6 sing Y N 59 DA C5 C4 doub Y N 60 DA C6 N6 sing N N 61 DA C6 N1 doub Y N 62 DA N6 H61 sing N N 63 DA N6 H62 sing N N 64 DA N1 C2 sing Y N 65 DA C2 N3 doub Y N 66 DA C2 H2 sing N N 67 DA N3 C4 sing Y N 68 DC OP3 P sing N N 69 DC OP3 HOP3 sing N N 70 DC P OP1 doub N N 71 DC P OP2 sing N N 72 DC P "O5'" sing N N 73 DC OP2 HOP2 sing N N 74 DC "O5'" "C5'" sing N N 75 DC "C5'" "C4'" sing N N 76 DC "C5'" "H5'" sing N N 77 DC "C5'" "H5''" sing N N 78 DC "C4'" "O4'" sing N N 79 DC "C4'" "C3'" sing N N 80 DC "C4'" "H4'" sing N N 81 DC "O4'" "C1'" sing N N 82 DC "C3'" "O3'" sing N N 83 DC "C3'" "C2'" sing N N 84 DC "C3'" "H3'" sing N N 85 DC "O3'" "HO3'" sing N N 86 DC "C2'" "C1'" sing N N 87 DC "C2'" "H2'" sing N N 88 DC "C2'" "H2''" sing N N 89 DC "C1'" N1 sing N N 90 DC "C1'" "H1'" sing N N 91 DC N1 C2 sing N N 92 DC N1 C6 sing N N 93 DC C2 O2 doub N N 94 DC C2 N3 sing N N 95 DC N3 C4 doub N N 96 DC C4 N4 sing N N 97 DC C4 C5 sing N N 98 DC N4 H41 sing N N 99 DC N4 H42 sing N N 100 DC C5 C6 doub N N 101 DC C5 H5 sing N N 102 DC C6 H6 sing N N 103 DG OP3 P sing N N 104 DG OP3 HOP3 sing N N 105 DG P OP1 doub N N 106 DG P OP2 sing N N 107 DG P "O5'" sing N N 108 DG OP2 HOP2 sing N N 109 DG "O5'" "C5'" sing N N 110 DG "C5'" "C4'" sing N N 111 DG "C5'" "H5'" sing N N 112 DG "C5'" "H5''" sing N N 113 DG "C4'" "O4'" sing N N 114 DG "C4'" "C3'" sing N N 115 DG "C4'" "H4'" sing N N 116 DG "O4'" "C1'" sing N N 117 DG "C3'" "O3'" sing N N 118 DG "C3'" "C2'" sing N N 119 DG "C3'" "H3'" sing N N 120 DG "O3'" "HO3'" sing N N 121 DG "C2'" "C1'" sing N N 122 DG "C2'" "H2'" sing N N 123 DG "C2'" "H2''" sing N N 124 DG "C1'" N9 sing N N 125 DG "C1'" "H1'" sing N N 126 DG N9 C8 sing Y N 127 DG N9 C4 sing Y N 128 DG C8 N7 doub Y N 129 DG C8 H8 sing N N 130 DG N7 C5 sing Y N 131 DG C5 C6 sing N N 132 DG C5 C4 doub Y N 133 DG C6 O6 doub N N 134 DG C6 N1 sing N N 135 DG N1 C2 sing N N 136 DG N1 H1 sing N N 137 DG C2 N2 sing N N 138 DG C2 N3 doub N N 139 DG N2 H21 sing N N 140 DG N2 H22 sing N N 141 DG N3 C4 sing N N 142 DT OP3 P sing N N 143 DT OP3 HOP3 sing N N 144 DT P OP1 doub N N 145 DT P OP2 sing N N 146 DT P "O5'" sing N N 147 DT OP2 HOP2 sing N N 148 DT "O5'" "C5'" sing N N 149 DT "C5'" "C4'" sing N N 150 DT "C5'" "H5'" sing N N 151 DT "C5'" "H5''" sing N N 152 DT "C4'" "O4'" sing N N 153 DT "C4'" "C3'" sing N N 154 DT "C4'" "H4'" sing N N 155 DT "O4'" "C1'" sing N N 156 DT "C3'" "O3'" sing N N 157 DT "C3'" "C2'" sing N N 158 DT "C3'" "H3'" sing N N 159 DT "O3'" "HO3'" sing N N 160 DT "C2'" "C1'" sing N N 161 DT "C2'" "H2'" sing N N 162 DT "C2'" "H2''" sing N N 163 DT "C1'" N1 sing N N 164 DT "C1'" "H1'" sing N N 165 DT N1 C2 sing N N 166 DT N1 C6 sing N N 167 DT C2 O2 doub N N 168 DT C2 N3 sing N N 169 DT N3 C4 sing N N 170 DT N3 H3 sing N N 171 DT C4 O4 doub N N 172 DT C4 C5 sing N N 173 DT C5 C7 sing N N 174 DT C5 C6 doub N N 175 DT C7 H71 sing N N 176 DT C7 H72 sing N N 177 DT C7 H73 sing N N 178 DT C6 H6 sing N N 179 HOH O H1 sing N N 180 HOH O H2 sing N N 181 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8FI7 'double helix' 8FI7 'b-form double helix' 8FI7 'hairpin loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DC 1 1_555 A DG 53 1_555 0.188 -0.146 0.266 -0.022 -5.005 -0.152 1 A_DC1:DG53_A A 1 ? A 53 ? 19 1 1 A DT 2 1_555 A DA 52 1_555 -0.052 -0.151 -0.054 -2.663 -6.211 3.375 2 A_DT2:DA52_A A 2 ? A 52 ? 20 1 1 A DT 3 1_555 A DA 51 1_555 -0.149 -0.127 0.086 0.646 -5.996 0.978 3 A_DT3:DA51_A A 3 ? A 51 ? 20 1 1 A DA 4 1_555 A DT 50 1_555 -0.136 -0.147 0.357 3.077 -12.241 8.484 4 A_DA4:DT50_A A 4 ? A 50 ? 20 1 1 A DG 5 1_555 A DC 49 1_555 -0.211 -0.142 -0.048 0.588 -11.856 1.857 5 A_DG5:DC49_A A 5 ? A 49 ? 19 1 1 A DT 6 1_555 A DA 48 1_555 -0.056 -0.139 -0.044 -5.813 -15.055 -0.083 6 A_DT6:DA48_A A 6 ? A 48 ? 20 1 1 A DA 7 1_555 A DG 47 1_555 1.214 1.313 0.068 -19.373 -9.068 -2.289 7 A_DA7:DG47_A A 7 ? A 47 ? 8 1 1 A DG 8 1_555 A DG 22 1_555 -4.058 0.843 -0.324 -5.001 -24.849 -65.567 8 A_DG8:DG22_A A 8 ? A 22 ? ? 2 1 A DG 19 1_555 A DG 24 1_555 1.879 3.181 -1.202 23.112 9.682 -89.109 9 A_DG19:DG24_A A 19 ? A 24 ? 6 3 1 A DG 25 1_555 A DG 45 1_555 -1.394 -3.561 -0.210 9.130 12.490 92.653 10 A_DG25:DG45_A A 25 ? A 45 ? 6 3 1 A DG 26 1_555 A DC 17 1_555 -0.206 -0.151 -0.348 -4.579 3.652 0.802 11 A_DG26:DC17_A A 26 ? A 17 ? 19 1 1 A DC 27 1_555 A DG 16 1_555 0.174 -0.163 -0.244 0.525 4.614 0.061 12 A_DC27:DG16_A A 27 ? A 16 ? 19 1 1 A DT 28 1_555 A DT 15 1_555 1.787 -1.875 0.360 8.019 -8.160 7.803 13 A_DT28:DT15_A A 28 ? A 15 ? 16 1 1 A DT 29 1_555 A DA 14 1_555 -0.460 3.400 0.706 -7.394 -8.919 -67.323 14 A_DT29:DA14_A A 29 ? A 14 ? 23 3 1 A DC 30 1_555 A DG 42 1_555 0.185 -0.175 0.237 -6.753 -6.686 1.189 15 A_DC30:DG42_A A 30 ? A 42 ? 19 1 1 A DG 31 1_555 A DC 41 1_555 -0.172 -0.111 -0.045 -5.007 -5.318 -2.034 16 A_DG31:DC41_A A 31 ? A 41 ? 19 1 1 A DC 32 1_555 A DG 40 1_555 0.169 -0.154 -0.247 1.014 -0.080 1.319 17 A_DC32:DG40_A A 32 ? A 40 ? 19 1 1 A DA 33 1_555 A DT 39 1_555 0.025 -0.160 -0.311 1.801 -5.478 4.715 18 A_DA33:DT39_A A 33 ? A 39 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DC 1 1_555 A DG 53 1_555 A DT 2 1_555 A DA 52 1_555 -0.118 -1.129 3.203 2.644 0.632 30.571 -2.254 0.729 3.159 1.196 -5.002 30.689 1 AA_DC1DT2:DA52DG53_AA A 1 ? A 53 ? A 2 ? A 52 ? 1 A DT 2 1_555 A DA 52 1_555 A DT 3 1_555 A DA 51 1_555 -0.628 -0.861 3.200 -2.265 2.812 30.271 -2.183 0.755 3.147 5.361 4.318 30.481 2 AA_DT2DT3:DA51DA52_AA A 2 ? A 52 ? A 3 ? A 51 ? 1 A DT 3 1_555 A DA 51 1_555 A DA 4 1_555 A DT 50 1_555 0.398 0.773 3.207 -2.153 3.039 37.597 0.807 -0.889 3.230 4.701 3.330 37.775 3 AA_DT3DA4:DT50DA51_AA A 3 ? A 51 ? A 4 ? A 50 ? 1 A DA 4 1_555 A DT 50 1_555 A DG 5 1_555 A DC 49 1_555 -0.287 -0.358 3.263 -0.230 2.018 33.333 -0.956 0.461 3.238 3.515 0.401 33.393 4 AA_DA4DG5:DC49DT50_AA A 4 ? A 50 ? A 5 ? A 49 ? 1 A DG 5 1_555 A DC 49 1_555 A DT 6 1_555 A DA 48 1_555 -0.116 -0.912 3.305 1.583 -0.561 37.473 -1.343 0.391 3.311 -0.873 -2.463 37.509 5 AA_DG5DT6:DA48DC49_AA A 5 ? A 49 ? A 6 ? A 48 ? 1 A DT 6 1_555 A DA 48 1_555 A DA 7 1_555 A DG 47 1_555 0.142 -0.317 3.687 2.471 -0.701 43.378 -0.352 0.078 3.694 -0.947 -3.339 43.450 6 AA_DT6DA7:DG47DA48_AA A 6 ? A 48 ? A 7 ? A 47 ? 1 A DA 7 1_555 A DG 47 1_555 A DG 8 1_555 A DG 22 1_555 4.122 0.462 3.330 -12.933 12.796 78.804 0.041 -3.508 2.778 9.957 10.064 80.542 7 AA_DA7DG8:DG22DG47_AA A 7 ? A 47 ? A 8 ? A 22 ? 1 A DG 8 1_555 A DG 22 1_555 A DG 19 1_555 A DG 24 1_555 -1.720 1.955 -4.243 102.958 105.248 82.459 2.123 -0.218 -2.718 56.496 -55.267 155.505 8 AA_DG8DG19:DG24DG22_AA A 8 ? A 22 ? A 19 ? A 24 ? 1 A DG 25 1_555 A DG 45 1_555 A DG 26 1_555 A DC 17 1_555 -3.095 -2.850 6.056 -13.550 -8.649 67.283 -1.883 1.740 6.778 -7.694 12.054 68.956 9 AA_DG25DG26:DC17DG45_AA A 25 ? A 45 ? A 26 ? A 17 ? 1 A DG 26 1_555 A DC 17 1_555 A DC 27 1_555 A DG 16 1_555 -1.470 -0.531 3.079 -0.847 1.282 29.199 -1.314 2.739 3.094 2.540 1.679 29.238 10 AA_DG26DC27:DG16DC17_AA A 26 ? A 17 ? A 27 ? A 16 ? 1 A DC 27 1_555 A DG 16 1_555 A DT 28 1_555 A DT 15 1_555 0.799 0.823 3.361 -2.844 6.281 38.794 0.448 -1.536 3.384 9.365 4.241 39.378 11 AA_DC27DT28:DT15DG16_AA A 27 ? A 16 ? A 28 ? A 15 ? 1 A DT 28 1_555 A DT 15 1_555 A DT 29 1_555 A DA 14 1_555 0.840 -3.710 3.168 1.501 1.755 71.435 -3.234 -0.670 3.103 1.502 -1.285 71.468 12 AA_DT28DT29:DA14DT15_AA A 28 ? A 15 ? A 29 ? A 14 ? 1 A DT 29 1_555 A DA 14 1_555 A DC 30 1_555 A DG 42 1_555 -0.322 2.022 3.318 2.498 2.143 5.026 6.921 17.497 3.363 21.641 -25.226 6.007 13 AA_DT29DC30:DG42DA14_AA A 29 ? A 14 ? A 30 ? A 42 ? 1 A DC 30 1_555 A DG 42 1_555 A DG 31 1_555 A DC 41 1_555 -0.589 0.438 3.136 -2.817 4.202 37.135 0.146 0.558 3.199 6.561 4.398 37.466 14 AA_DC30DG31:DC41DG42_AA A 30 ? A 42 ? A 31 ? A 41 ? 1 A DG 31 1_555 A DC 41 1_555 A DC 32 1_555 A DG 40 1_555 0.683 0.480 3.223 1.304 -1.171 35.522 0.954 -0.932 3.228 -1.918 -2.136 35.564 15 AA_DG31DC32:DG40DC41_AA A 31 ? A 41 ? A 32 ? A 40 ? 1 A DC 32 1_555 A DG 40 1_555 A DA 33 1_555 A DT 39 1_555 -0.477 1.474 3.176 1.014 3.763 38.644 1.762 0.839 3.287 5.669 -1.527 38.833 16 AA_DC32DA33:DT39DG40_AA A 32 ? A 40 ? A 33 ? A 39 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 747 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 747 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'POTASSIUM ION' K 3 'MAGNESIUM ION' MG 4 '(5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylidene]-2-[(E)-(hydroxyimino)methyl]-3-methyl-3,5-dihydro-4H-imidazol-4-one' 747 5 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8FHV _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'gel filtration' _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'P 21 21 21' _space_group.name_Hall 'P 2ac 2ab' _space_group.IT_number 19 _space_group.crystal_system orthorhombic _space_group.id 1 #