data_8HB3 # _entry.id 8HB3 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8HB3 pdb_00008hb3 10.2210/pdb8hb3/pdb WWPDB D_1300033205 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8HB3 _pdbx_database_status.recvd_initial_deposition_date 2022-10-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Peng, X.' 1 ? 'Lilley, D.M.J.' 2 ? 'Huang, L.' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 51 _citation.language ? _citation.page_first 2904 _citation.page_last 2914 _citation.title 'Crystal structures of the NAD+-II riboswitch reveal two distinct ligand-binding pockets.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkad102 _citation.pdbx_database_id_PubMed 36840714 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Peng, X.' 1 ? primary 'Liao, W.' 2 0000-0001-9823-9949 primary 'Lin, X.' 3 ? primary 'Lilley, D.M.J.' 4 0000-0001-6882-2818 primary 'Huang, L.' 5 0000-0002-2121-365X # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 8HB3 _cell.details ? _cell.formula_units_Z ? _cell.length_a 82.982 _cell.length_a_esd ? _cell.length_b 82.982 _cell.length_b_esd ? _cell.length_c 65.590 _cell.length_c_esd ? _cell.volume 391143.447 _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8HB3 _symmetry.cell_setting ? _symmetry.Int_Tables_number 154 _symmetry.space_group_name_Hall ;P 32 2" ; _symmetry.space_group_name_H-M 'P 32 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*AP*GP*AP*GP*CP*GP*UP*UP*GP*CP*GP*UP*CP*CP*GP*AP*AP*AP*GP*UP*(CBV)P*GP*CP*C)-3') ; 7802.550 1 ? ? ? ? 2 polymer syn 'RNA (31-MER)' 10036.118 1 ? ? ? ? 3 non-polymer syn 'Nicotinamide riboside' 255.247 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polyribonucleotide no yes 'AGAGCGUUGCGUCCGAAAGU(CBV)GCC' AGAGCGUUGCGUCCGAAAGUCGCC A ? 2 polyribonucleotide no no GCGACACGGCUCUUUAAAAACAAAAGGAGAA GCGACACGGCUCUUUAAAAACAAAAGGAGAA B ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 G n 1 3 A n 1 4 G n 1 5 C n 1 6 G n 1 7 U n 1 8 U n 1 9 G n 1 10 C n 1 11 G n 1 12 U n 1 13 C n 1 14 C n 1 15 G n 1 16 A n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 CBV n 1 22 G n 1 23 C n 1 24 C n 2 1 G n 2 2 C n 2 3 G n 2 4 A n 2 5 C n 2 6 A n 2 7 C n 2 8 G n 2 9 G n 2 10 C n 2 11 U n 2 12 C n 2 13 U n 2 14 U n 2 15 U n 2 16 A n 2 17 A n 2 18 A n 2 19 A n 2 20 A n 2 21 C n 2 22 A n 2 23 A n 2 24 A n 2 25 A n 2 26 G n 2 27 G n 2 28 A n 2 29 G n 2 30 A n 2 31 A n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 24 'Streptococcus parasanguinis' ? 1318 ? 2 1 sample 1 31 'Streptococcus parasanguinis' ? 1318 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 8HB3 8HB3 ? 1 ? 1 2 PDB 8HB3 8HB3 ? 2 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8HB3 A 1 ? 24 ? 8HB3 1 ? 24 ? 1 24 2 2 8HB3 B 1 ? 31 ? 8HB3 26 ? 56 ? 26 56 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CBV 'RNA linking' n ;5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) ; ? 'C9 H13 Br N3 O8 P' 402.093 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 NNR non-polymer . 'Nicotinamide riboside' '3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium' 'C11 H15 N2 O5 1' 255.247 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8HB3 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.89 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 68.4 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 291 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '2.0 M Ammonium Sulfate' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 4M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2022-08-29 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97918 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL02U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97918 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL02U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate 86.67 _reflns.entry_id 8HB3 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.87 _reflns.d_resolution_low 65.63 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6227 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I 2.7 _reflns.percent_possible_obs 100 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 19 _reflns.pdbx_Rmerge_I_obs 0.062 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 23.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.015 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.0 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? _reflns.pdbx_CC_split_method ? # _reflns_shell.d_res_high 2.87 _reflns_shell.d_res_low 2.95 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.7 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 448 _reflns_shell.percent_possible_all 100 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.3 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 19.9 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.3 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.848 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 110.45 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8HB3 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.87 _refine.ls_d_res_low 29.84 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6188 _refine.ls_number_reflns_R_free 298 _refine.ls_number_reflns_R_work 5890 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.65 _refine.ls_percent_reflns_R_free 4.82 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2011 _refine.ls_R_factor_R_free 0.2088 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2005 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 8HB1 _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 20.1685 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0000 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.87 _refine_hist.d_res_low 29.84 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1215 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1179 _refine_hist.pdbx_number_atoms_ligand 36 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0050 ? 1359 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.5677 ? 2113 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0504 ? 280 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0069 ? 59 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 18.1272 ? 649 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.87 3.61 . . 141 2894 99.51 . . . 0.3078 . 0.2714 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.62 29.84 . . 157 2996 99.78 . . . 0.1817 . 0.1791 . . . . . . . . . . . # _struct.entry_id 8HB3 _struct.title 'Crystal structure of NAD-II riboswitch (two strands) with NR' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8HB3 _struct_keywords.text 'Riboswitch, NAD, NMN, Aptamer, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A U 20 "O3'" ? ? ? 1_555 A CBV 21 P ? ? A U 20 A CBV 21 1_555 ? ? ? ? ? ? ? 1.615 ? ? covale2 covale one ? A CBV 21 "O3'" ? ? ? 1_555 A G 22 P ? ? A CBV 21 A G 22 1_555 ? ? ? ? ? ? ? 1.607 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 2 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 2 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 2 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 3 N1 ? ? ? 1_555 B U 11 N3 ? ? A A 3 B U 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 3 N6 ? ? ? 1_555 B U 11 O4 ? ? A A 3 B U 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 4 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 4 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 4 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 B A 18 N1 ? ? A G 4 B A 43 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog10 hydrog ? ? A G 4 N3 ? ? ? 1_555 B A 18 N6 ? ? A G 4 B A 43 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 B G 9 N1 ? ? A C 5 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 B G 9 O6 ? ? A C 5 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 B G 9 N2 ? ? A C 5 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 B A 20 N6 ? ? A C 5 B A 45 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A U 8 O4 ? ? A G 6 A U 8 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog16 hydrog ? ? A G 6 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 6 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 6 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 6 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 6 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 7 N3 ? ? ? 1_555 B A 22 N7 ? ? A U 7 B A 47 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog20 hydrog ? ? A U 7 O4 ? ? ? 1_555 B A 22 N6 ? ? A U 7 B A 47 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog21 hydrog ? ? A U 8 O4 ? ? ? 1_555 A G 15 N2 ? ? A U 8 A G 15 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog22 hydrog ? ? A U 8 N3 ? ? ? 1_555 B A 25 N1 ? ? A U 8 B A 50 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog23 hydrog ? ? A U 8 O2 ? ? ? 1_555 B A 25 N6 ? ? A U 8 B A 50 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog24 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 29 N1 ? ? A C 10 B G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 29 O6 ? ? A C 10 B G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 29 N2 ? ? A C 10 B G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 12 N3 ? ? ? 1_555 B A 28 N1 ? ? A U 12 B A 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 12 O4 ? ? ? 1_555 B A 28 N6 ? ? A U 12 B A 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N3 ? ? ? 1_555 B G 27 N1 ? ? A C 13 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N4 ? ? ? 1_555 B G 27 O6 ? ? A C 13 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 O2 ? ? ? 1_555 B G 27 N2 ? ? A C 13 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 14 N3 ? ? ? 1_555 B G 26 N1 ? ? A C 14 B G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 14 N4 ? ? ? 1_555 B G 26 O6 ? ? A C 14 B G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 14 O2 ? ? ? 1_555 B G 26 N2 ? ? A C 14 B G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 15 N2 ? ? ? 1_555 B A 6 N1 ? ? A G 15 B A 31 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog36 hydrog ? ? A G 15 N3 ? ? ? 1_555 B A 6 N6 ? ? A G 15 B A 31 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog37 hydrog ? ? A A 17 N1 ? ? ? 1_555 B G 26 N2 ? ? A A 17 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog38 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 5 N3 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 5 O2 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 5 N4 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 20 N3 ? ? ? 1_555 B A 4 N1 ? ? A U 20 B A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A U 20 O4 ? ? ? 1_555 B A 4 N6 ? ? A U 20 B A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A CBV 21 N3 ? ? ? 1_555 B G 3 N1 ? ? A CBV 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A CBV 21 N4 ? ? ? 1_555 B G 3 O6 ? ? A CBV 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A CBV 21 O2 ? ? ? 1_555 B G 3 N2 ? ? A CBV 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 22 N1 ? ? ? 1_555 B C 2 N3 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 22 N2 ? ? ? 1_555 B C 2 O2 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 22 O6 ? ? ? 1_555 B C 2 N4 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 23 N3 ? ? ? 1_555 B G 1 N1 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 23 N4 ? ? ? 1_555 B G 1 O6 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 23 O2 ? ? ? 1_555 B G 1 N2 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? B C 7 O2 ? ? ? 1_555 B A 22 N6 ? ? B C 32 B A 47 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog53 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 21 O2 ? ? B G 33 B C 46 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog54 hydrog ? ? B G 9 N2 ? ? ? 1_555 B A 20 N1 ? ? B G 34 B A 45 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog55 hydrog ? ? B C 10 O2 ? ? ? 1_555 B A 19 N6 ? ? B C 35 B A 44 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog56 hydrog ? ? B U 11 O2 ? ? ? 1_555 B A 17 N6 ? ? B U 36 B A 42 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog57 hydrog ? ? B C 12 O2 ? ? ? 1_555 B A 16 N6 ? ? B C 37 B A 41 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog58 hydrog ? ? B A 23 N6 ? ? ? 1_555 B G 26 O6 ? ? B A 48 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _atom_sites.entry_id 8HB3 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.012051 _atom_sites.fract_transf_matrix[1][2] 0.006958 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013915 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015246 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source BR ? ? 25.79822 9.11301 ? ? 1.35700 25.34896 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? H ? ? 0.51345 0.48472 ? ? 24.73122 6.32584 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 1 1 A A A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 G 4 4 4 G G A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 U 8 8 8 U U A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 G 11 11 11 G G A . n A 1 12 U 12 12 12 U U A . n A 1 13 C 13 13 13 C C A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 CBV 21 21 21 CBV CBV A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n B 2 1 G 1 26 26 G G B . n B 2 2 C 2 27 27 C C B . n B 2 3 G 3 28 28 G G B . n B 2 4 A 4 29 29 A A B . n B 2 5 C 5 30 30 C C B . n B 2 6 A 6 31 31 A A B . n B 2 7 C 7 32 32 C C B . n B 2 8 G 8 33 33 G G B . n B 2 9 G 9 34 34 G G B . n B 2 10 C 10 35 35 C C B . n B 2 11 U 11 36 36 U U B . n B 2 12 C 12 37 37 C C B . n B 2 13 U 13 38 38 U U B . n B 2 14 U 14 39 39 U U B . n B 2 15 U 15 40 40 U U B . n B 2 16 A 16 41 41 A A B . n B 2 17 A 17 42 42 A A B . n B 2 18 A 18 43 43 A A B . n B 2 19 A 19 44 44 A A B . n B 2 20 A 20 45 45 A A B . n B 2 21 C 21 46 46 C C B . n B 2 22 A 22 47 47 A A B . n B 2 23 A 23 48 48 A A B . n B 2 24 A 24 49 49 A A B . n B 2 25 A 25 50 50 A A B . n B 2 26 G 26 51 51 G G B . n B 2 27 G 27 52 52 G G B . n B 2 28 A 28 53 53 A A B . n B 2 29 G 29 54 54 G G B . n B 2 30 A 30 55 55 A A B . n B 2 31 A 31 56 56 A A B . n # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 huanglin36@mail.sysu.edu.cn Lin Huang ? 'principal investigator/group leader' 0000-0002-2121-365X 3 d.m.j.lilley@dundee.ac.uk David Lilley M.J 'principal investigator/group leader' 0000-0001-6882-2818 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 3 NNR 1 101 101 NNR NNR A . D 3 NNR 1 101 102 NNR NNR B . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 4100 ? 1 MORE -14 ? 1 'SSA (A^2)' 9380 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-03-22 2 'Structure model' 1 1 2023-04-19 3 'Structure model' 1 2 2023-11-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' chem_comp_atom 3 3 'Structure model' chem_comp_bond 4 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y,x-y,z+2/3 3 -x+y,-x,z+1/3 4 x-y,-y,-z+1/3 5 -x,-x+y,-z+2/3 6 y,x,-z # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined -2.52976392306 -33.5024770328 12.9963676333 0.655690344154 ? -0.187024284095 ? -0.160439790604 ? 1.12469177909 ? -0.047807514255 ? 0.78445986323 ? 2.54711805537 ? 0.823087187954 ? 3.43349228652 ? 4.76112666732 ? -0.251948618777 ? 4.37099895389 ? 0.276511491832 ? -0.538896079288 ? -0.366825770765 ? -0.91200888587 ? -0.161268140444 ? 0.609198618644 ? 0.459415296024 ? -0.86176246962 ? -0.31413212712 ? 2 'X-RAY DIFFRACTION' ? refined 9.3936859645 -25.9036476152 4.30518225123 0.798403088075 ? -0.00352908283242 ? 0.101234538635 ? 1.24373412818 ? 0.126764560076 ? 0.726619460541 ? 2.89482282471 ? 3.08397350333 ? 0.412163324251 ? 3.59484035299 ? -0.855023546729 ? 7.87214959417 ? 0.0852499063521 ? 0.993516714899 ? 0.55555140194 ? -0.592951246114 ? 0.137746545083 ? -0.101461281405 ? -0.0227167994886 ? -0.676743147788 ? -0.0713483446484 ? 3 'X-RAY DIFFRACTION' ? refined 3.16663338748 -22.2284610706 -6.28377930949 1.27230920565 ? -0.0160536888083 ? 0.15624611421 ? 1.93162174747 ? 0.38773792564 ? 1.30646342153 ? 8.33410200972 ? 1.74546159911 ? 0.529094781118 ? 7.17822213435 ? 3.7553582721 ? 2.05921105725 ? 2.03237487838 ? -1.70050764446 ? -0.871562528952 ? 0.304715903933 ? -1.75200308529 ? 2.11828591588 ? -1.14694032318 ? -0.691074317671 ? -0.570608247609 ? 4 'X-RAY DIFFRACTION' ? refined -9.5639464389 -36.4327736862 11.8600491585 0.758427033463 ? -0.315892532255 ? 0.0580626767762 ? 2.00199910136 ? -0.136030463823 ? 0.767142806849 ? 7.06981086093 ? -1.92199110483 ? -1.88160907313 ? 2.12416960546 ? -0.481046658472 ? 3.04550430439 ? -0.263197296896 ? -0.467967445737 ? -0.482354105911 ? 0.11262000546 ? 0.018368526677 ? 0.535030784987 ? 0.496393594482 ? -2.62259449945 ? 0.0301244604646 ? 5 'X-RAY DIFFRACTION' ? refined 3.63163699534 -33.9662063822 15.150423481 0.572536185299 ? -0.1970738895 ? 0.0239062475928 ? 1.03677472108 ? -0.131396457748 ? 0.699242775187 ? 5.19972454175 ? -0.481479835206 ? 1.24875584379 ? 4.4882502692 ? 0.417818924356 ? 5.13326089158 ? -0.174467677343 ? -0.626952958475 ? 0.0725075696132 ? -0.0314682578781 ? -0.249130709035 ? 1.12571485374 ? 0.0411521785377 ? -0.506815928816 ? 0.378056487574 ? 6 'X-RAY DIFFRACTION' ? refined 28.1865681049 -26.4772603928 16.629767505 2.28550319131 ? -1.18731676005 ? -0.131667268051 ? 3.14372821868 ? 0.21136426824 ? 1.93888216131 ? 8.99954664215 ? 0.700009476675 ? -1.91844888426 ? 4.29483514705 ? -4.20176554448 ? 4.28786319353 ? 0.673837247419 ? -0.581964673645 ? 0.483476742583 ? 1.22998724442 ? 0.435298993573 ? -0.769214655659 ? -0.181695454608 ? 0.0151425980833 ? -0.0211008172741 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 A ? A 1 ? A ? A 10 ? ? ;chain 'A' and (resid 1 through 10 ) ; 2 'X-RAY DIFFRACTION' 2 A ? A 11 ? A ? A 24 ? ? ;chain 'A' and (resid 11 through 24 ) ; 3 'X-RAY DIFFRACTION' 3 B ? B 26 ? B ? B 30 ? ? ;chain 'B' and (resid 26 through 30 ) ; 4 'X-RAY DIFFRACTION' 4 B ? B 31 ? B ? B 40 ? ? ;chain 'B' and (resid 31 through 40 ) ; 5 'X-RAY DIFFRACTION' 5 B ? B 41 ? B ? B 55 ? ? ;chain 'B' and (resid 41 through 55 ) ; 6 'X-RAY DIFFRACTION' 6 B ? B 56 ? B ? B 56 ? ? ;chain 'B' and (resid 56 through 56 ) ; # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 8HB3 _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 C5 _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 U _pdbx_validate_rmsd_angle.auth_seq_id_1 7 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 C4 _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 U _pdbx_validate_rmsd_angle.auth_seq_id_2 7 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 O4 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 U _pdbx_validate_rmsd_angle.auth_seq_id_3 7 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 122.29 _pdbx_validate_rmsd_angle.angle_target_value 125.90 _pdbx_validate_rmsd_angle.angle_deviation -3.61 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.60 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CBV O3P O N N 73 CBV P P N N 74 CBV O1P O N N 75 CBV O2P O N N 76 CBV "O5'" O N N 77 CBV "C5'" C N N 78 CBV "C4'" C N R 79 CBV "O4'" O N N 80 CBV "C3'" C N S 81 CBV "O3'" O N N 82 CBV "C2'" C N R 83 CBV "O2'" O N N 84 CBV "C1'" C N R 85 CBV N1 N N N 86 CBV C2 C N N 87 CBV O2 O N N 88 CBV N3 N N N 89 CBV C4 C N N 90 CBV N4 N N N 91 CBV C5 C N N 92 CBV C6 C N N 93 CBV BR BR N N 94 CBV HO3P H N N 95 CBV HO1P H N N 96 CBV "H5'1" H N N 97 CBV "H5'2" H N N 98 CBV "H4'" H N N 99 CBV "H3'" H N N 100 CBV "HO3'" H N N 101 CBV "H2'" H N N 102 CBV "HO2'" H N N 103 CBV "H1'" H N N 104 CBV HN41 H N N 105 CBV HN42 H N N 106 CBV H6 H N N 107 G OP3 O N N 108 G P P N N 109 G OP1 O N N 110 G OP2 O N N 111 G "O5'" O N N 112 G "C5'" C N N 113 G "C4'" C N R 114 G "O4'" O N N 115 G "C3'" C N S 116 G "O3'" O N N 117 G "C2'" C N R 118 G "O2'" O N N 119 G "C1'" C N R 120 G N9 N Y N 121 G C8 C Y N 122 G N7 N Y N 123 G C5 C Y N 124 G C6 C N N 125 G O6 O N N 126 G N1 N N N 127 G C2 C N N 128 G N2 N N N 129 G N3 N N N 130 G C4 C Y N 131 G HOP3 H N N 132 G HOP2 H N N 133 G "H5'" H N N 134 G "H5''" H N N 135 G "H4'" H N N 136 G "H3'" H N N 137 G "HO3'" H N N 138 G "H2'" H N N 139 G "HO2'" H N N 140 G "H1'" H N N 141 G H8 H N N 142 G H1 H N N 143 G H21 H N N 144 G H22 H N N 145 NNR O2R O N N 146 NNR C2R C N R 147 NNR C3R C N S 148 NNR O3R O N N 149 NNR C4R C N R 150 NNR C5R C N N 151 NNR O5R O N N 152 NNR O4R O N N 153 NNR C1R C N R 154 NNR N1 N Y N 155 NNR C2 C Y N 156 NNR C6 C Y N 157 NNR C5 C Y N 158 NNR C4 C Y N 159 NNR C3 C Y N 160 NNR C7 C N N 161 NNR O7 O N N 162 NNR N7 N N N 163 NNR HO2R H N N 164 NNR H2R H N N 165 NNR H3R H N N 166 NNR HO3R H N N 167 NNR H4R H N N 168 NNR H5R1 H N N 169 NNR H5R2 H N N 170 NNR HO5R H N N 171 NNR H1R H N N 172 NNR H2 H N N 173 NNR H6 H N N 174 NNR H5 H N N 175 NNR H4 H N N 176 NNR HN71 H N N 177 NNR HN72 H N N 178 U OP3 O N N 179 U P P N N 180 U OP1 O N N 181 U OP2 O N N 182 U "O5'" O N N 183 U "C5'" C N N 184 U "C4'" C N R 185 U "O4'" O N N 186 U "C3'" C N S 187 U "O3'" O N N 188 U "C2'" C N R 189 U "O2'" O N N 190 U "C1'" C N R 191 U N1 N N N 192 U C2 C N N 193 U O2 O N N 194 U N3 N N N 195 U C4 C N N 196 U O4 O N N 197 U C5 C N N 198 U C6 C N N 199 U HOP3 H N N 200 U HOP2 H N N 201 U "H5'" H N N 202 U "H5''" H N N 203 U "H4'" H N N 204 U "H3'" H N N 205 U "HO3'" H N N 206 U "H2'" H N N 207 U "HO2'" H N N 208 U "H1'" H N N 209 U H3 H N N 210 U H5 H N N 211 U H6 H N N 212 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 CBV O3P P sing N N 76 CBV O3P HO3P sing N N 77 CBV P O1P sing N N 78 CBV P O2P doub N N 79 CBV P "O5'" sing N N 80 CBV O1P HO1P sing N N 81 CBV "O5'" "C5'" sing N N 82 CBV "C5'" "C4'" sing N N 83 CBV "C5'" "H5'1" sing N N 84 CBV "C5'" "H5'2" sing N N 85 CBV "C4'" "O4'" sing N N 86 CBV "C4'" "C3'" sing N N 87 CBV "C4'" "H4'" sing N N 88 CBV "O4'" "C1'" sing N N 89 CBV "C3'" "O3'" sing N N 90 CBV "C3'" "C2'" sing N N 91 CBV "C3'" "H3'" sing N N 92 CBV "O3'" "HO3'" sing N N 93 CBV "C2'" "O2'" sing N N 94 CBV "C2'" "C1'" sing N N 95 CBV "C2'" "H2'" sing N N 96 CBV "O2'" "HO2'" sing N N 97 CBV "C1'" N1 sing N N 98 CBV "C1'" "H1'" sing N N 99 CBV N1 C2 sing N N 100 CBV N1 C6 sing N N 101 CBV C2 O2 doub N N 102 CBV C2 N3 sing N N 103 CBV N3 C4 doub N N 104 CBV C4 N4 sing N N 105 CBV C4 C5 sing N N 106 CBV N4 HN41 sing N N 107 CBV N4 HN42 sing N N 108 CBV C5 C6 doub N N 109 CBV C5 BR sing N N 110 CBV C6 H6 sing N N 111 G OP3 P sing N N 112 G OP3 HOP3 sing N N 113 G P OP1 doub N N 114 G P OP2 sing N N 115 G P "O5'" sing N N 116 G OP2 HOP2 sing N N 117 G "O5'" "C5'" sing N N 118 G "C5'" "C4'" sing N N 119 G "C5'" "H5'" sing N N 120 G "C5'" "H5''" sing N N 121 G "C4'" "O4'" sing N N 122 G "C4'" "C3'" sing N N 123 G "C4'" "H4'" sing N N 124 G "O4'" "C1'" sing N N 125 G "C3'" "O3'" sing N N 126 G "C3'" "C2'" sing N N 127 G "C3'" "H3'" sing N N 128 G "O3'" "HO3'" sing N N 129 G "C2'" "O2'" sing N N 130 G "C2'" "C1'" sing N N 131 G "C2'" "H2'" sing N N 132 G "O2'" "HO2'" sing N N 133 G "C1'" N9 sing N N 134 G "C1'" "H1'" sing N N 135 G N9 C8 sing Y N 136 G N9 C4 sing Y N 137 G C8 N7 doub Y N 138 G C8 H8 sing N N 139 G N7 C5 sing Y N 140 G C5 C6 sing N N 141 G C5 C4 doub Y N 142 G C6 O6 doub N N 143 G C6 N1 sing N N 144 G N1 C2 sing N N 145 G N1 H1 sing N N 146 G C2 N2 sing N N 147 G C2 N3 doub N N 148 G N2 H21 sing N N 149 G N2 H22 sing N N 150 G N3 C4 sing N N 151 NNR C5 C6 doub Y N 152 NNR C5 C4 sing Y N 153 NNR C6 N1 sing Y N 154 NNR C4 C3 doub Y N 155 NNR O2R C2R sing N N 156 NNR N1 C1R sing N N 157 NNR N1 C2 doub Y N 158 NNR C3 C2 sing Y N 159 NNR C3 C7 sing N N 160 NNR C1R C2R sing N N 161 NNR C1R O4R sing N N 162 NNR C2R C3R sing N N 163 NNR C7 O7 doub N N 164 NNR C7 N7 sing N N 165 NNR O3R C3R sing N N 166 NNR O4R C4R sing N N 167 NNR C3R C4R sing N N 168 NNR C4R C5R sing N N 169 NNR C5R O5R sing N N 170 NNR O2R HO2R sing N N 171 NNR C2R H2R sing N N 172 NNR C3R H3R sing N N 173 NNR O3R HO3R sing N N 174 NNR C4R H4R sing N N 175 NNR C5R H5R1 sing N N 176 NNR C5R H5R2 sing N N 177 NNR O5R HO5R sing N N 178 NNR C1R H1R sing N N 179 NNR C2 H2 sing N N 180 NNR C6 H6 sing N N 181 NNR C5 H5 sing N N 182 NNR C4 H4 sing N N 183 NNR N7 HN71 sing N N 184 NNR N7 HN72 sing N N 185 U OP3 P sing N N 186 U OP3 HOP3 sing N N 187 U P OP1 doub N N 188 U P OP2 sing N N 189 U P "O5'" sing N N 190 U OP2 HOP2 sing N N 191 U "O5'" "C5'" sing N N 192 U "C5'" "C4'" sing N N 193 U "C5'" "H5'" sing N N 194 U "C5'" "H5''" sing N N 195 U "C4'" "O4'" sing N N 196 U "C4'" "C3'" sing N N 197 U "C4'" "H4'" sing N N 198 U "O4'" "C1'" sing N N 199 U "C3'" "O3'" sing N N 200 U "C3'" "C2'" sing N N 201 U "C3'" "H3'" sing N N 202 U "O3'" "HO3'" sing N N 203 U "C2'" "O2'" sing N N 204 U "C2'" "C1'" sing N N 205 U "C2'" "H2'" sing N N 206 U "O2'" "HO2'" sing N N 207 U "C1'" N1 sing N N 208 U "C1'" "H1'" sing N N 209 U N1 C2 sing N N 210 U N1 C6 sing N N 211 U C2 O2 doub N N 212 U C2 N3 sing N N 213 U N3 C4 sing N N 214 U N3 H3 sing N N 215 U C4 O4 doub N N 216 U C4 C5 sing N N 217 U C5 C6 doub N N 218 U C5 H5 sing N N 219 U C6 H6 sing N N 220 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8HB3 'double helix' 8HB3 'a-form double helix' 8HB3 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 B C 12 1_555 -0.371 -0.240 0.008 -10.097 -7.517 2.098 1 A_G2:C37_B A 2 ? B 37 ? 19 1 1 A A 3 1_555 B U 11 1_555 -0.077 -0.226 0.616 2.850 0.092 -3.034 2 A_A3:U36_B A 3 ? B 36 ? 20 1 1 A G 4 1_555 B C 10 1_555 -0.156 -0.244 0.297 1.796 -3.970 1.195 3 A_G4:C35_B A 4 ? B 35 ? 19 1 1 A C 5 1_555 B G 9 1_555 0.228 -0.215 0.474 -4.328 0.573 -0.546 4 A_C5:G34_B A 5 ? B 34 ? 19 1 1 B C 21 1_555 B G 8 1_555 3.191 1.146 0.249 -0.910 -11.608 51.036 5 B_C46:G33_B B 46 ? B 33 ? ? 5 1 A U 7 1_555 B A 22 1_555 -0.784 3.595 -0.593 5.666 -2.619 -70.090 6 A_U7:A47_B A 7 ? B 47 ? 23 3 1 A U 8 1_555 B A 25 1_555 -0.333 -1.321 -0.480 -2.862 -10.190 -172.099 7 A_U8:A50_B A 8 ? B 50 ? 21 2 1 B A 6 1_555 A G 15 1_555 -3.225 3.630 0.225 13.775 -5.110 73.159 8 B_A31:G15_A B 31 ? A 15 ? 10 6 1 B G 26 1_555 A C 14 1_555 -0.145 -0.252 0.077 0.153 -12.249 2.402 9 B_G51:C14_A B 51 ? A 14 ? 19 1 1 B G 27 1_555 A C 13 1_555 -0.259 -0.253 -0.236 -5.473 -4.830 -0.972 10 B_G52:C13_A B 52 ? A 13 ? 19 1 1 B A 28 1_555 A U 12 1_555 -0.158 -0.246 -0.091 5.793 -2.816 7.726 11 B_A53:U12_A B 53 ? A 12 ? 20 1 1 B G 29 1_555 A C 10 1_555 -0.237 -0.240 0.179 3.662 -5.177 0.880 12 B_G54:C10_A B 54 ? A 10 ? 19 1 1 A G 19 1_555 B C 5 1_555 -0.094 -0.152 -0.697 -19.428 2.436 -2.919 13 A_G19:C30_B A 19 ? B 30 ? 19 1 1 A U 20 1_555 B A 4 1_555 -0.027 -0.097 -0.141 1.802 -0.100 -5.135 14 A_U20:A29_B A 20 ? B 29 ? 20 1 1 A CBV 21 1_555 B G 3 1_555 0.330 0.044 -0.049 6.387 -9.657 6.891 15 A_CBV21:G28_B A 21 ? B 28 ? 19 1 1 A G 22 1_555 B C 2 1_555 0.134 -0.272 -0.823 -10.292 5.190 -12.241 16 A_G22:C27_B A 22 ? B 27 ? 19 1 1 A C 23 1_555 B G 1 1_555 0.318 -0.192 -0.081 -0.734 4.389 -3.501 17 A_C23:G26_B A 23 ? B 26 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 B C 12 1_555 A A 3 1_555 B U 11 1_555 -0.190 -1.179 2.814 -6.014 -0.033 31.150 -2.153 -0.610 2.802 -0.061 11.071 31.711 1 AA_G2A3:U36C37_BB A 2 ? B 37 ? A 3 ? B 36 ? 1 A A 3 1_555 B U 11 1_555 A G 4 1_555 B C 10 1_555 -0.368 -1.938 3.122 2.702 1.622 32.712 -3.686 1.084 2.986 2.872 -4.784 32.860 2 AA_A3G4:C35U36_BB A 3 ? B 36 ? A 4 ? B 35 ? 1 A G 4 1_555 B C 10 1_555 A C 5 1_555 B G 9 1_555 0.547 -1.902 3.346 1.241 1.487 31.788 -3.742 -0.769 3.275 2.712 -2.262 31.845 3 AA_G4C5:G34C35_BB A 4 ? B 35 ? A 5 ? B 34 ? 1 A C 5 1_555 B G 9 1_555 B C 21 1_555 B G 8 1_555 -2.646 1.183 3.448 6.203 -3.666 80.054 1.015 2.217 3.223 -2.845 -4.813 80.323 4 AB_C5C46:G33G34_BB A 5 ? B 34 ? B 46 ? B 33 ? 1 B C 21 1_555 B G 8 1_555 A U 7 1_555 B A 22 1_555 -1.411 -3.394 3.280 1.971 -2.189 -26.020 8.071 -2.594 3.085 4.843 4.360 -26.183 5 BA_C46U7:A47G33_BB B 46 ? B 33 ? A 7 ? B 47 ? 1 A U 7 1_555 B A 22 1_555 A U 8 1_555 B A 25 1_555 -0.685 0.265 3.146 5.879 2.783 86.260 0.134 0.625 3.110 2.033 -4.294 86.457 6 AA_U7U8:A50A47_BB A 7 ? B 47 ? A 8 ? B 50 ? 1 A U 8 1_555 B A 25 1_555 B A 6 1_555 A G 15 1_555 4.408 -0.395 3.080 168.049 -37.020 -52.071 0.231 2.359 -2.588 18.988 86.193 -172.883 7 AB_U8A31:G15A50_AB A 8 ? B 50 ? B 31 ? A 15 ? 1 B A 6 1_555 A G 15 1_555 B G 26 1_555 A C 14 1_555 -2.900 -2.192 -0.912 114.413 -127.215 -35.214 0.855 -1.673 0.018 65.915 59.281 -171.514 8 BB_A31G51:C14G15_AA B 31 ? A 15 ? B 51 ? A 14 ? 1 B G 26 1_555 A C 14 1_555 B G 27 1_555 A C 13 1_555 -0.911 -2.291 3.287 -0.622 7.342 27.477 -6.214 1.724 2.618 15.115 1.280 28.429 9 BB_G51G52:C13C14_AA B 51 ? A 14 ? B 52 ? A 13 ? 1 B G 27 1_555 A C 13 1_555 B A 28 1_555 A U 12 1_555 0.501 -0.921 2.958 -2.952 3.531 34.848 -1.993 -1.220 2.804 5.864 4.903 35.141 10 BB_G52A53:U12C13_AA B 52 ? A 13 ? B 53 ? A 12 ? 1 B A 28 1_555 A U 12 1_555 B G 29 1_555 A C 10 1_555 1.563 -1.158 3.127 4.144 11.846 48.656 -2.167 -1.564 2.904 14.107 -4.935 50.153 11 BB_A53G54:C10U12_AA B 53 ? A 12 ? B 54 ? A 10 ? 1 A G 19 1_555 B C 5 1_555 A U 20 1_555 B A 4 1_555 0.260 -1.129 2.799 -3.465 6.351 30.298 -3.094 -1.025 2.473 11.938 6.514 31.130 12 AA_G19U20:A29C30_BB A 19 ? B 30 ? A 20 ? B 29 ? 1 A U 20 1_555 B A 4 1_555 A CBV 21 1_555 B G 3 1_555 0.588 -1.348 3.016 3.000 5.564 30.512 -3.461 -0.584 2.777 10.431 -5.625 31.145 13 AA_U20CBV21:G28A29_BB A 20 ? B 29 ? A 21 ? B 28 ? 1 A CBV 21 1_555 B G 3 1_555 A G 22 1_555 B C 2 1_555 -0.132 -2.157 3.713 6.496 6.006 27.046 -5.856 1.852 3.059 12.427 -13.441 28.431 14 AA_CBV21G22:C27G28_BB A 21 ? B 28 ? A 22 ? B 27 ? 1 A G 22 1_555 B C 2 1_555 A C 23 1_555 B G 1 1_555 0.169 -2.079 3.028 -3.919 5.465 36.392 -3.922 -0.730 2.667 8.659 6.209 36.987 15 AA_G22C23:G26C27_BB A 22 ? B 27 ? A 23 ? B 26 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Natural Science Foundation of China (NSFC)' China 32171191 1 'Cancer Research UK' 'United Kingdom' A18604 2 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id NNR _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id NNR _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_entity_nonpoly.entity_id 3 _pdbx_entity_nonpoly.name 'Nicotinamide riboside' _pdbx_entity_nonpoly.comp_id NNR # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8HB1 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'P 32 2 1' _space_group.name_Hall ;P 32 2" ; _space_group.IT_number 154 _space_group.crystal_system trigonal _space_group.id 1 #