data_8HB8 # _entry.id 8HB8 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8HB8 pdb_00008hb8 10.2210/pdb8hb8/pdb WWPDB D_1300033211 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8HB8 _pdbx_database_status.recvd_initial_deposition_date 2022-10-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Peng, X.' 1 ? 'Lilley, D.M.J.' 2 ? 'Huang, L.' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 51 _citation.language ? _citation.page_first 2904 _citation.page_last 2914 _citation.title 'Crystal structures of the NAD+-II riboswitch reveal two distinct ligand-binding pockets.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkad102 _citation.pdbx_database_id_PubMed 36840714 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Peng, X.' 1 ? primary 'Liao, W.' 2 0000-0001-9823-9949 primary 'Lin, X.' 3 ? primary 'Lilley, D.M.J.' 4 0000-0001-6882-2818 primary 'Huang, L.' 5 0000-0002-2121-365X # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 8HB8 _cell.details ? _cell.formula_units_Z ? _cell.length_a 121.362 _cell.length_a_esd ? _cell.length_b 121.362 _cell.length_b_esd ? _cell.length_c 109.055 _cell.length_c_esd ? _cell.volume 1606242.200 _cell.volume_esd ? _cell.Z_PDB 16 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8HB8 _symmetry.cell_setting ? _symmetry.Int_Tables_number 98 _symmetry.space_group_name_Hall 'I 4bw 2bw' _symmetry.space_group_name_H-M 'I 41 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (55-MER)' 17827.766 1 ? ? ? ? 2 non-polymer syn 'BETA-NICOTINAMIDE RIBOSE MONOPHOSPHATE' 335.227 2 ? ? ? ? 3 non-polymer syn 'BARIUM ION' 137.327 7 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GCGGCGUUGCGUCCGAAAGUCUAAACAGACACGGCCGCUUAAAAACAAAAGGAGA _entity_poly.pdbx_seq_one_letter_code_can GCGGCGUUGCGUCCGAAAGUCUAAACAGACACGGCCGCUUAAAAACAAAAGGAGA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 C n 1 3 G n 1 4 G n 1 5 C n 1 6 G n 1 7 U n 1 8 U n 1 9 G n 1 10 C n 1 11 G n 1 12 U n 1 13 C n 1 14 C n 1 15 G n 1 16 A n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 C n 1 22 U n 1 23 A n 1 24 A n 1 25 A n 1 26 C n 1 27 A n 1 28 G n 1 29 A n 1 30 C n 1 31 A n 1 32 C n 1 33 G n 1 34 G n 1 35 C n 1 36 C n 1 37 G n 1 38 C n 1 39 U n 1 40 U n 1 41 A n 1 42 A n 1 43 A n 1 44 A n 1 45 A n 1 46 C n 1 47 A n 1 48 A n 1 49 A n 1 50 A n 1 51 G n 1 52 G n 1 53 A n 1 54 G n 1 55 A n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 55 _pdbx_entity_src_syn.organism_scientific 'Streptococcus parasanguinis' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 1318 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8HB8 _struct_ref.pdbx_db_accession 8HB8 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8HB8 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 55 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8HB8 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 55 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 55 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 BA non-polymer . 'BARIUM ION' ? 'Ba 2' 137.327 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 NMN non-polymer . 'BETA-NICOTINAMIDE RIBOSE MONOPHOSPHATE' 'NICOTINAMIDE MONONUCLEOTIDE' 'C11 H16 N2 O8 P 1' 335.227 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8HB8 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.6 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 78.16 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 5.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 291 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.012 M Sodium chloride, 0.08 M Potassium chloride 0.04 M Sodium cacodylate trihydrate pH 5.5 45% v/v (+/-)-2-Methyl-2,4-pentanediol 0.02 M Hexammine cobalt(III) chloride Soaking with BaCl2 ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-11-07 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9785 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.9785 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate 70.63 _reflns.entry_id 8HB8 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.30 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 17176 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I 1.0 _reflns.percent_possible_obs 93.2 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 13.3 _reflns.pdbx_Rmerge_I_obs 0.082 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 26.6 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.017 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? _reflns.pdbx_CC_split_method ? # _reflns_shell.d_res_high 2.30 _reflns_shell.d_res_low 2.42 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 1.0 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 2642 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 3.4 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.75 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.642 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 93.23 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8HB8 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.30 _refine.ls_d_res_low 27.26 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 17080 _refine.ls_number_reflns_R_free 853 _refine.ls_number_reflns_R_work 16227 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 92.87 _refine.ls_percent_reflns_R_free 4.99 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2284 _refine.ls_R_factor_R_free 0.2531 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2271 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.33 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 8HB1 _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 38.4222 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.6039 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.30 _refine_hist.d_res_low 27.26 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1218 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1167 _refine_hist.pdbx_number_atoms_ligand 51 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0020 ? 1354 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.6382 ? 2106 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0302 ? 281 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0039 ? 57 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 16.4374 ? 671 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.30 2.44 . . 157 2823 99.33 . . . 0.5004 . 0.4347 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.44 2.63 . . 144 2869 99.54 . . . 0.4342 . 0.4073 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.63 2.90 . . 112 2166 75.26 . . . 0.3793 . 0.3449 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.90 3.32 . . 146 2874 99.37 . . . 0.2742 . 0.2487 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.32 4.17 . . 126 2451 83.59 . . . 0.2275 . 0.2031 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.18 27.26 . . 168 3044 99.94 . . . 0.2178 . 0.1909 . . . . . . . . . . . # _struct.entry_id 8HB8 _struct.title 'Crystal structure of NAD-II riboswitch (single strand) with NMN' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8HB8 _struct_keywords.text 'Riboswitch, NAD, NMN, Aptamer, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 3 ? J N N 3 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A G 6 "O3'" ? ? ? 1_555 D BA . BA ? ? A G 6 A BA 103 1_555 ? ? ? ? ? ? ? 3.188 ? ? metalc2 metalc ? ? A U 7 OP2 ? ? ? 1_555 D BA . BA ? ? A U 7 A BA 103 1_555 ? ? ? ? ? ? ? 2.629 ? ? metalc3 metalc ? ? A G 15 O6 ? ? ? 1_555 D BA . BA ? ? A G 15 A BA 103 1_555 ? ? ? ? ? ? ? 3.464 ? ? metalc4 metalc ? ? C NMN . O1P ? ? ? 1_555 G BA . BA ? ? A NMN 102 A BA 106 1_555 ? ? ? ? ? ? ? 2.731 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 1 N2 ? ? ? 1_555 A U 39 O4 ? ? A G 1 A U 39 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog5 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 2 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 2 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 2 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 4 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 4 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 4 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 5 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 5 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 5 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 5 O2 ? ? ? 1_555 A A 45 N6 ? ? A C 5 A A 45 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog18 hydrog ? ? A G 6 N2 ? ? ? 1_555 A U 8 O4 ? ? A G 6 A U 8 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog19 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 6 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 6 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 6 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 47 N7 ? ? A U 7 A A 47 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog23 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 47 N6 ? ? A U 7 A A 47 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog24 hydrog ? ? A U 8 O4 ? ? ? 1_555 A G 15 N1 ? ? A U 8 A G 15 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog25 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 50 N1 ? ? A U 8 A A 50 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog26 hydrog ? ? A U 8 O2 ? ? ? 1_555 A A 50 N6 ? ? A U 8 A A 50 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog27 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 54 N1 ? ? A C 10 A G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 54 O6 ? ? A C 10 A G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 54 N2 ? ? A C 10 A G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 12 N3 ? ? ? 1_555 A A 53 N1 ? ? A U 12 A A 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 12 O4 ? ? ? 1_555 A A 53 N6 ? ? A U 12 A A 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 52 N1 ? ? A C 13 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 52 O6 ? ? A C 13 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 52 N2 ? ? A C 13 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 51 N1 ? ? A C 14 A G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 51 O6 ? ? A C 14 A G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 51 N2 ? ? A C 14 A G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 15 N2 ? ? ? 1_555 A A 31 N1 ? ? A G 15 A A 31 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog39 hydrog ? ? A G 15 N3 ? ? ? 1_555 A A 31 N6 ? ? A G 15 A A 31 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog40 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 19 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 19 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 19 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A U 20 N3 ? ? ? 1_555 A A 29 N1 ? ? A U 20 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 20 O4 ? ? ? 1_555 A A 29 N6 ? ? A U 20 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 21 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 21 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 21 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 32 O2 ? ? ? 1_555 A A 47 N6 ? ? A C 32 A A 47 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog49 hydrog ? ? A G 33 N1 ? ? ? 1_555 A C 46 O2 ? ? A G 33 A C 46 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog50 hydrog ? ? A G 34 N2 ? ? ? 1_555 A A 45 N1 ? ? A G 34 A A 45 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog51 hydrog ? ? A C 35 O2 ? ? ? 1_555 A A 44 N6 ? ? A C 35 A A 44 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog52 hydrog ? ? A G 37 N2 ? ? ? 1_555 A A 41 N3 ? ? A G 37 A A 41 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog53 hydrog ? ? A A 48 N6 ? ? ? 1_555 A G 51 O6 ? ? A A 48 A G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 8HB8 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.008240 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.008240 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009170 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source BA ? ? 46.69444 9.00985 ? ? 2.07616 47.04031 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? H ? ? 0.51345 0.48472 ? ? 24.73122 6.32584 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 4.49882 3.47563 ? ? 15.80542 1.70748 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 C 2 2 2 C C A . n A 1 3 G 3 3 3 G G A . n A 1 4 G 4 4 4 G G A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 U 8 8 8 U U A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 G 11 11 11 G G A . n A 1 12 U 12 12 12 U U A . n A 1 13 C 13 13 13 C C A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 U 22 22 22 U U A . n A 1 23 A 23 23 23 A A A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 C 26 26 26 C C A . n A 1 27 A 27 27 27 A A A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 29 A A A . n A 1 30 C 30 30 30 C C A . n A 1 31 A 31 31 31 A A A . n A 1 32 C 32 32 32 C C A . n A 1 33 G 33 33 33 G G A . n A 1 34 G 34 34 34 G G A . n A 1 35 C 35 35 35 C C A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 C 38 38 38 C C A . n A 1 39 U 39 39 39 U U A . n A 1 40 U 40 40 40 U U A . n A 1 41 A 41 41 41 A A A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 A 44 44 44 A A A . n A 1 45 A 45 45 45 A A A . n A 1 46 C 46 46 46 C C A . n A 1 47 A 47 47 47 A A A . n A 1 48 A 48 48 48 A A A . n A 1 49 A 49 49 49 A A A . n A 1 50 A 50 50 50 A A A . n A 1 51 G 51 51 51 G G A . n A 1 52 G 52 52 52 G G A . n A 1 53 A 53 53 53 A A A . n A 1 54 G 54 54 54 G G A . n A 1 55 A 55 55 55 A A A . n # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 huanglin36@mail.sysu.edu.cn Lin Huang ? 'principal investigator/group leader' 0000-0002-2121-365X 3 d.m.j.lilley@dundee.ac.uk David Lilley M.J 'principal investigator/group leader' 0000-0001-6882-2818 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 NMN 1 101 101 NMN NMN A . C 2 NMN 1 102 102 NMN NMN A . D 3 BA 1 103 1 BA BA A . E 3 BA 1 104 2 BA BA A . F 3 BA 1 105 3 BA BA A . G 3 BA 1 106 4 BA BA A . H 3 BA 1 107 5 BA BA A . I 3 BA 1 108 6 BA BA A . J 3 BA 1 109 7 BA BA A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 1850 ? 1 MORE -50 ? 1 'SSA (A^2)' 9510 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 "O3'" ? A G 6 ? A G 6 ? 1_555 BA ? D BA . ? A BA 103 ? 1_555 OP2 ? A U 7 ? A U 7 ? 1_555 49.6 ? 2 "O3'" ? A G 6 ? A G 6 ? 1_555 BA ? D BA . ? A BA 103 ? 1_555 O6 ? A G 15 ? A G 15 ? 1_555 81.6 ? 3 OP2 ? A U 7 ? A U 7 ? 1_555 BA ? D BA . ? A BA 103 ? 1_555 O6 ? A G 15 ? A G 15 ? 1_555 120.9 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-03-22 2 'Structure model' 1 1 2023-04-19 3 'Structure model' 1 2 2023-11-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' chem_comp_atom 3 3 'Structure model' chem_comp_bond 4 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y+1/2,x,z+3/4 3 y+1/2,-x,z+3/4 4 x+1/2,-y,-z+3/4 5 -x+1/2,y,-z+3/4 6 -x,-y,z 7 y,x,-z 8 -y,-x,-z 9 x+1/2,y+1/2,z+1/2 10 -y+1,x+1/2,z+5/4 11 y+1,-x+1/2,z+5/4 12 x+1,-y+1/2,-z+5/4 13 -x+1,y+1/2,-z+5/4 14 -x+1/2,-y+1/2,z+1/2 15 y+1/2,x+1/2,-z+1/2 16 -y+1/2,-x+1/2,-z+1/2 # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined -3.11699303823 -8.56380098346 -18.1608984746 1.21323408592 ? -0.295617014058 ? 0.126136654375 ? 1.08305260944 ? -0.170270287023 ? 0.958214055849 ? 4.62147586155 ? -0.280014841811 ? -1.05367538798 ? 0.750036413622 ? 1.32999152153 ? 2.65488694384 ? -0.302565552799 ? 1.45071368064 ? -0.651929845958 ? -1.11277753982 ? -0.298067011756 ? 0.808252618341 ? -1.36172306624 ? 0.263840649411 ? 0.579500445832 ? 2 'X-RAY DIFFRACTION' ? refined -16.6387615126 -24.4080847127 -15.9744699885 0.713255837482 ? -0.0798112677843 ? -0.0333508883714 ? 0.881848035934 ? -0.0522553364197 ? 0.743852957497 ? 2.34833641253 ? 0.302418940366 ? -0.502929392841 ? 1.86751785134 ? 0.159781816501 ? 3.05592565758 ? 0.114657631771 ? 0.28583996164 ? -0.235092756234 ? -0.333339303735 ? 0.158351711417 ? -0.194400336757 ? -0.348539540106 ? 0.687368506096 ? -0.312197415282 ? 3 'X-RAY DIFFRACTION' ? refined -6.53481949508 -14.7360725553 -21.7205895879 1.0844810222 ? -0.258451059445 ? 0.183221407549 ? 1.22058419022 ? -0.083291810539 ? 0.875848519719 ? 1.59897401621 ? 0.194390097094 ? 1.62106471338 ? 2.54728204249 ? 1.11539147485 ? 2.70375364426 ? 0.187670480561 ? 0.39765125993 ? 0.0975528153892 ? -0.512845638291 ? 0.13586070116 ? -0.687745489002 ? -0.332194321845 ? 0.924467177446 ? -0.153453842305 ? 4 'X-RAY DIFFRACTION' ? refined -22.6651530116 -20.5314264046 -14.781621282 0.781822109026 ? -0.0460108860547 ? -0.0138725740835 ? 0.713071289773 ? 0.00644077396136 ? 0.64548379934 ? 3.55627754207 ? -0.501548398215 ? -0.513735222103 ? 2.08751232408 ? 0.979653594607 ? 3.00602029153 ? 0.129702222388 ? 0.318326084082 ? 0.0149691361608 ? -0.15112734612 ? -0.322072821678 ? 0.183541995616 ? 0.0692523097302 ? -0.511591996629 ? 0.0844311841489 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 A ? A 1 ? A ? A 5 ? ? ;chain 'A' and (resid 1 through 5 ) ; 2 'X-RAY DIFFRACTION' 2 A ? A 6 ? A ? A 21 ? ? ;chain 'A' and (resid 6 through 21 ) ; 3 'X-RAY DIFFRACTION' 3 A ? A 22 ? A ? A 45 ? ? ;chain 'A' and (resid 22 through 45 ) ; 4 'X-RAY DIFFRACTION' 4 A ? A 46 ? A ? A 55 ? ? ;chain 'A' and (resid 46 through 55 ) ; # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? SCALA ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 8HB8 _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 OP1 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 C _pdbx_validate_close_contact.auth_seq_id_1 10 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 HN71 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 NMN _pdbx_validate_close_contact.auth_seq_id_2 102 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.57 # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A C 26 ? N1 ? A C 26 N1 2 1 Y 1 A C 26 ? C2 ? A C 26 C2 3 1 Y 1 A C 26 ? O2 ? A C 26 O2 4 1 Y 1 A C 26 ? N3 ? A C 26 N3 5 1 Y 1 A C 26 ? C4 ? A C 26 C4 6 1 Y 1 A C 26 ? N4 ? A C 26 N4 7 1 Y 1 A C 26 ? C5 ? A C 26 C5 8 1 Y 1 A C 26 ? C6 ? A C 26 C6 9 1 Y 1 A A 27 ? N9 ? A A 27 N9 10 1 Y 1 A A 27 ? C8 ? A A 27 C8 11 1 Y 1 A A 27 ? N7 ? A A 27 N7 12 1 Y 1 A A 27 ? C5 ? A A 27 C5 13 1 Y 1 A A 27 ? C6 ? A A 27 C6 14 1 Y 1 A A 27 ? N6 ? A A 27 N6 15 1 Y 1 A A 27 ? N1 ? A A 27 N1 16 1 Y 1 A A 27 ? C2 ? A A 27 C2 17 1 Y 1 A A 27 ? N3 ? A A 27 N3 18 1 Y 1 A A 27 ? C4 ? A A 27 C4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 BA BA BA N N 38 C OP3 O N N 39 C P P N N 40 C OP1 O N N 41 C OP2 O N N 42 C "O5'" O N N 43 C "C5'" C N N 44 C "C4'" C N R 45 C "O4'" O N N 46 C "C3'" C N S 47 C "O3'" O N N 48 C "C2'" C N R 49 C "O2'" O N N 50 C "C1'" C N R 51 C N1 N N N 52 C C2 C N N 53 C O2 O N N 54 C N3 N N N 55 C C4 C N N 56 C N4 N N N 57 C C5 C N N 58 C C6 C N N 59 C HOP3 H N N 60 C HOP2 H N N 61 C "H5'" H N N 62 C "H5''" H N N 63 C "H4'" H N N 64 C "H3'" H N N 65 C "HO3'" H N N 66 C "H2'" H N N 67 C "HO2'" H N N 68 C "H1'" H N N 69 C H41 H N N 70 C H42 H N N 71 C H5 H N N 72 C H6 H N N 73 G OP3 O N N 74 G P P N N 75 G OP1 O N N 76 G OP2 O N N 77 G "O5'" O N N 78 G "C5'" C N N 79 G "C4'" C N R 80 G "O4'" O N N 81 G "C3'" C N S 82 G "O3'" O N N 83 G "C2'" C N R 84 G "O2'" O N N 85 G "C1'" C N R 86 G N9 N Y N 87 G C8 C Y N 88 G N7 N Y N 89 G C5 C Y N 90 G C6 C N N 91 G O6 O N N 92 G N1 N N N 93 G C2 C N N 94 G N2 N N N 95 G N3 N N N 96 G C4 C Y N 97 G HOP3 H N N 98 G HOP2 H N N 99 G "H5'" H N N 100 G "H5''" H N N 101 G "H4'" H N N 102 G "H3'" H N N 103 G "HO3'" H N N 104 G "H2'" H N N 105 G "HO2'" H N N 106 G "H1'" H N N 107 G H8 H N N 108 G H1 H N N 109 G H21 H N N 110 G H22 H N N 111 NMN O3P O N N 112 NMN P P N N 113 NMN O1P O N N 114 NMN O2P O N N 115 NMN O5R O N N 116 NMN C5R C N N 117 NMN C4R C N R 118 NMN O4R O N N 119 NMN C3R C N S 120 NMN O3R O N N 121 NMN C2R C N R 122 NMN O2R O N N 123 NMN C1R C N R 124 NMN N1 N Y N 125 NMN C2 C Y N 126 NMN C3 C Y N 127 NMN C7 C N N 128 NMN O7 O N N 129 NMN N7 N N N 130 NMN C4 C Y N 131 NMN C5 C Y N 132 NMN C6 C Y N 133 NMN H1PO H N N 134 NMN H2PO H N N 135 NMN H5R1 H N N 136 NMN H5R2 H N N 137 NMN H4RC H N N 138 NMN H3RC H N N 139 NMN H3RO H N N 140 NMN H2RC H N N 141 NMN H2RO H N N 142 NMN H1RC H N N 143 NMN HC2 H N N 144 NMN HN71 H N N 145 NMN HN72 H N N 146 NMN HC4 H N N 147 NMN HC5 H N N 148 NMN HC6 H N N 149 U OP3 O N N 150 U P P N N 151 U OP1 O N N 152 U OP2 O N N 153 U "O5'" O N N 154 U "C5'" C N N 155 U "C4'" C N R 156 U "O4'" O N N 157 U "C3'" C N S 158 U "O3'" O N N 159 U "C2'" C N R 160 U "O2'" O N N 161 U "C1'" C N R 162 U N1 N N N 163 U C2 C N N 164 U O2 O N N 165 U N3 N N N 166 U C4 C N N 167 U O4 O N N 168 U C5 C N N 169 U C6 C N N 170 U HOP3 H N N 171 U HOP2 H N N 172 U "H5'" H N N 173 U "H5''" H N N 174 U "H4'" H N N 175 U "H3'" H N N 176 U "HO3'" H N N 177 U "H2'" H N N 178 U "HO2'" H N N 179 U "H1'" H N N 180 U H3 H N N 181 U H5 H N N 182 U H6 H N N 183 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 NMN O3P P doub N N 116 NMN P O1P sing N N 117 NMN P O2P sing N N 118 NMN P O5R sing N N 119 NMN O1P H1PO sing N N 120 NMN O2P H2PO sing N N 121 NMN O5R C5R sing N N 122 NMN C5R C4R sing N N 123 NMN C5R H5R1 sing N N 124 NMN C5R H5R2 sing N N 125 NMN C4R O4R sing N N 126 NMN C4R C3R sing N N 127 NMN C4R H4RC sing N N 128 NMN O4R C1R sing N N 129 NMN C3R O3R sing N N 130 NMN C3R C2R sing N N 131 NMN C3R H3RC sing N N 132 NMN O3R H3RO sing N N 133 NMN C2R O2R sing N N 134 NMN C2R C1R sing N N 135 NMN C2R H2RC sing N N 136 NMN O2R H2RO sing N N 137 NMN C1R N1 sing N N 138 NMN C1R H1RC sing N N 139 NMN N1 C2 doub Y N 140 NMN N1 C6 sing Y N 141 NMN C2 C3 sing Y N 142 NMN C2 HC2 sing N N 143 NMN C3 C7 sing N N 144 NMN C3 C4 doub Y N 145 NMN C7 O7 doub N N 146 NMN C7 N7 sing N N 147 NMN N7 HN71 sing N N 148 NMN N7 HN72 sing N N 149 NMN C4 C5 sing Y N 150 NMN C4 HC4 sing N N 151 NMN C5 C6 doub Y N 152 NMN C5 HC5 sing N N 153 NMN C6 HC6 sing N N 154 U OP3 P sing N N 155 U OP3 HOP3 sing N N 156 U P OP1 doub N N 157 U P OP2 sing N N 158 U P "O5'" sing N N 159 U OP2 HOP2 sing N N 160 U "O5'" "C5'" sing N N 161 U "C5'" "C4'" sing N N 162 U "C5'" "H5'" sing N N 163 U "C5'" "H5''" sing N N 164 U "C4'" "O4'" sing N N 165 U "C4'" "C3'" sing N N 166 U "C4'" "H4'" sing N N 167 U "O4'" "C1'" sing N N 168 U "C3'" "O3'" sing N N 169 U "C3'" "C2'" sing N N 170 U "C3'" "H3'" sing N N 171 U "O3'" "HO3'" sing N N 172 U "C2'" "O2'" sing N N 173 U "C2'" "C1'" sing N N 174 U "C2'" "H2'" sing N N 175 U "O2'" "HO2'" sing N N 176 U "C1'" N1 sing N N 177 U "C1'" "H1'" sing N N 178 U N1 C2 sing N N 179 U N1 C6 sing N N 180 U C2 O2 doub N N 181 U C2 N3 sing N N 182 U N3 C4 sing N N 183 U N3 H3 sing N N 184 U C4 O4 doub N N 185 U C4 C5 sing N N 186 U C5 C6 doub N N 187 U C5 H5 sing N N 188 U C6 H6 sing N N 189 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8HB8 'double helix' 8HB8 'a-form double helix' 8HB8 'hairpin loop' 8HB8 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 38 1_555 -0.191 -0.200 0.408 2.347 -0.453 -2.204 1 A_G1:C38_A A 1 ? A 38 ? 19 1 1 A C 2 1_555 A G 37 1_555 0.171 -0.137 0.386 -1.578 -7.544 -0.619 2 A_C2:G37_A A 2 ? A 37 ? 19 1 1 A G 3 1_555 A C 36 1_555 -0.174 -0.117 -0.111 -5.957 -7.617 0.639 3 A_G3:C36_A A 3 ? A 36 ? 19 1 1 A G 4 1_555 A C 35 1_555 -0.162 -0.160 -0.009 -2.620 -6.222 -0.979 4 A_G4:C35_A A 4 ? A 35 ? 19 1 1 A C 5 1_555 A G 34 1_555 0.199 -0.178 0.267 -1.614 -5.234 -0.114 5 A_C5:G34_A A 5 ? A 34 ? 19 1 1 A C 46 1_555 A G 33 1_555 3.408 1.169 -0.303 10.066 -12.796 54.708 6 A_C46:G33_A A 46 ? A 33 ? ? 5 1 A U 7 1_555 A A 47 1_555 -0.367 3.594 -0.321 6.833 4.280 -61.454 7 A_U7:A47_A A 7 ? A 47 ? 23 3 1 A U 8 1_555 A A 50 1_555 -0.105 -1.305 -0.013 4.807 -9.509 -168.635 8 A_U8:A50_A A 8 ? A 50 ? 21 2 1 A A 31 1_555 A G 15 1_555 -3.294 3.974 0.043 13.563 -5.329 77.685 9 A_A31:G15_A A 31 ? A 15 ? 10 6 1 A G 51 1_555 A C 14 1_555 -0.152 -0.171 0.055 2.410 -11.500 0.966 10 A_G51:C14_A A 51 ? A 14 ? 19 1 1 A G 52 1_555 A C 13 1_555 -0.166 -0.179 0.013 -0.390 -3.666 -1.330 11 A_G52:C13_A A 52 ? A 13 ? 19 1 1 A A 53 1_555 A U 12 1_555 0.189 -0.115 0.281 3.305 -3.152 3.533 12 A_A53:U12_A A 53 ? A 12 ? 20 1 1 A G 54 1_555 A C 10 1_555 -0.072 -0.145 0.308 5.246 -7.406 -2.105 13 A_G54:C10_A A 54 ? A 10 ? 19 1 1 A G 19 1_555 A C 30 1_555 -0.238 -0.208 -0.116 -3.418 -12.044 3.542 14 A_G19:C30_A A 19 ? A 30 ? 19 1 1 A U 20 1_555 A A 29 1_555 -0.039 -0.170 0.230 -0.010 -2.219 6.267 15 A_U20:A29_A A 20 ? A 29 ? 20 1 1 A C 21 1_555 A G 28 1_555 0.222 -0.208 0.312 1.875 -4.617 -0.905 16 A_C21:G28_A A 21 ? A 28 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 38 1_555 A C 2 1_555 A G 37 1_555 -0.080 -1.806 3.274 -1.485 3.554 37.387 -3.255 -0.064 3.096 5.527 2.309 37.578 1 AA_G1C2:G37C38_AA A 1 ? A 38 ? A 2 ? A 37 ? 1 A C 2 1_555 A G 37 1_555 A G 3 1_555 A C 36 1_555 -0.492 -1.672 3.077 3.678 8.614 31.886 -4.180 1.396 2.483 15.272 -6.521 33.199 2 AA_C2G3:C36G37_AA A 2 ? A 37 ? A 3 ? A 36 ? 1 A G 3 1_555 A C 36 1_555 A G 4 1_555 A C 35 1_555 -0.065 -1.710 3.154 0.346 3.095 30.194 -3.850 0.190 2.968 5.921 -0.662 30.350 3 AA_G3G4:C35C36_AA A 3 ? A 36 ? A 4 ? A 35 ? 1 A G 4 1_555 A C 35 1_555 A C 5 1_555 A G 34 1_555 0.774 -1.818 3.314 1.818 0.945 34.098 -3.246 -1.027 3.299 1.609 -3.097 34.157 4 AA_G4C5:G34C35_AA A 4 ? A 35 ? A 5 ? A 34 ? 1 A C 5 1_555 A G 34 1_555 A C 46 1_555 A G 33 1_555 -3.027 1.604 3.092 7.976 3.019 76.290 1.213 2.652 2.865 2.437 -6.438 76.693 5 AA_C5C46:G33G34_AA A 5 ? A 34 ? A 46 ? A 33 ? 1 A C 46 1_555 A G 33 1_555 A U 7 1_555 A A 47 1_555 -2.103 -3.517 3.686 -4.325 1.638 -20.501 8.883 -7.780 3.441 -4.527 -11.956 -21.011 6 AA_C46U7:A47G33_AA A 46 ? A 33 ? A 7 ? A 47 ? 1 A U 7 1_555 A A 47 1_555 A U 8 1_555 A A 50 1_555 -0.469 0.444 3.083 4.542 3.104 85.637 0.260 0.441 3.072 2.282 -3.338 85.779 7 AA_U7U8:A50A47_AA A 7 ? A 47 ? A 8 ? A 50 ? 1 A U 8 1_555 A A 50 1_555 A A 31 1_555 A G 15 1_555 1.072 0.759 5.244 168.013 -36.053 31.247 0.980 2.255 2.272 -18.652 -86.920 172.140 8 AA_U8A31:G15A50_AA A 8 ? A 50 ? A 31 ? A 15 ? 1 A A 31 1_555 A G 15 1_555 A G 51 1_555 A C 14 1_555 -2.443 -2.497 -1.016 114.340 -127.199 -2.717 0.792 -1.639 -0.248 66.854 60.095 -171.038 9 AA_A31G51:C14G15_AA A 31 ? A 15 ? A 51 ? A 14 ? 1 A G 51 1_555 A C 14 1_555 A G 52 1_555 A C 13 1_555 -1.086 -2.396 3.158 -4.966 8.477 26.808 -6.576 1.200 2.458 17.552 10.283 28.521 10 AA_G51G52:C13C14_AA A 51 ? A 14 ? A 52 ? A 13 ? 1 A G 52 1_555 A C 13 1_555 A A 53 1_555 A U 12 1_555 0.619 -1.336 3.089 -2.545 7.094 36.212 -2.968 -1.286 2.739 11.263 4.041 36.962 11 AA_G52A53:U12C13_AA A 52 ? A 13 ? A 53 ? A 12 ? 1 A A 53 1_555 A U 12 1_555 A G 54 1_555 A C 10 1_555 1.488 -0.707 3.144 3.333 11.027 46.276 -1.720 -1.588 3.005 13.781 -4.165 47.612 12 AA_A53G54:C10U12_AA A 53 ? A 12 ? A 54 ? A 10 ? 1 A G 19 1_555 A C 30 1_555 A U 20 1_555 A A 29 1_555 0.316 -0.948 3.272 -5.708 8.700 30.871 -3.143 -1.517 2.808 15.791 10.360 32.537 13 AA_G19U20:A29C30_AA A 19 ? A 30 ? A 20 ? A 29 ? 1 A U 20 1_555 A A 29 1_555 A C 21 1_555 A G 28 1_555 0.032 -1.669 3.030 -1.134 6.973 33.746 -3.767 -0.208 2.640 11.851 1.927 34.456 14 AA_U20C21:G28A29_AA A 20 ? A 29 ? A 21 ? A 28 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Natural Science Foundation of China (NSFC)' China 32171191 1 'Cancer Research UK' 'United Kingdom' A18604 2 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id NMN _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id NMN _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'BETA-NICOTINAMIDE RIBOSE MONOPHOSPHATE' NMN 3 'BARIUM ION' BA # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8HB1 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'I 41 2 2' _space_group.name_Hall 'I 4bw 2bw' _space_group.IT_number 98 _space_group.crystal_system tetragonal _space_group.id 1 #