data_8Q6N # _entry.id 8Q6N # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.395 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8Q6N pdb_00008q6n 10.2210/pdb8q6n/pdb WWPDB D_1292132690 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2024-08-28 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8Q6N _pdbx_database_status.recvd_initial_deposition_date 2023-08-14 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name PDB _pdbx_database_related.details . _pdbx_database_related.db_id 7elr _pdbx_database_related.content_type re-refinement # _pdbx_contact_author.id 2 _pdbx_contact_author.email herbert.nar@boehringer-ingelheim.com _pdbx_contact_author.name_first Herbert _pdbx_contact_author.name_last Nar _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-3878-6964 # _audit_author.name 'Nar, H.' _audit_author.pdbx_ordinal 1 _audit_author.identifier_ORCID 0000-0002-3878-6964 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Artificial oxypurinol-responsive riboswitches for gene expression control in mammalian cells based on bacterial xanthine aptamers' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Schnapp, G.' 1 ? primary 'Hartig, J.' 2 ? primary 'Nar, H.' 3 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'Xanthin riboswitch NMT-46 (46-MER)' 14903.956 1 ? ? ? oxypurinol 2 non-polymer syn Oxypurinol 152.111 1 ? ? ? ? 3 water nat water 18.015 17 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAGUAGAAGCGUUCAGCGGCCGAAAGGCCGCCCGGAAAUUGCUCC _entity_poly.pdbx_seq_one_letter_code_can GGAGUAGAAGCGUUCAGCGGCCGAAAGGCCGCCCGGAAAUUGCUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 Oxypurinol 141 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 U n 1 6 A n 1 7 G n 1 8 A n 1 9 A n 1 10 G n 1 11 C n 1 12 G n 1 13 U n 1 14 U n 1 15 C n 1 16 A n 1 17 G n 1 18 C n 1 19 G n 1 20 G n 1 21 C n 1 22 C n 1 23 G n 1 24 A n 1 25 A n 1 26 A n 1 27 G n 1 28 G n 1 29 C n 1 30 C n 1 31 G n 1 32 C n 1 33 C n 1 34 C n 1 35 G n 1 36 G n 1 37 A n 1 38 A n 1 39 A n 1 40 U n 1 41 U n 1 42 G n 1 43 C n 1 44 U n 1 45 C n 1 46 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 46 _pdbx_entity_src_syn.organism_scientific 'Ideonella sp. B508-1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 137716 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 141 non-polymer . Oxypurinol Alloxanthine 'C5 H4 N4 O2' 152.111 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 A 9 9 9 A A A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 A 16 16 16 A A A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 G 23 23 23 G G A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 C 29 29 29 C C A . n A 1 30 C 30 30 30 C C A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 C 33 33 33 C C A . n A 1 34 C 34 34 34 C C A . n A 1 35 G 35 35 35 G G A . n A 1 36 G 36 36 36 G G A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 A 39 39 39 A A A . n A 1 40 U 40 40 40 U U A . n A 1 41 U 41 41 41 U U A . n A 1 42 G 42 42 42 G G A . n A 1 43 C 43 43 43 C C A . n A 1 44 U 44 44 44 U U A . n A 1 45 C 45 45 45 C C A . n A 1 46 C 46 46 46 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 141 1 101 102 141 LIG A . C 3 HOH 1 201 10 HOH HOH A . C 3 HOH 2 202 2 HOH HOH A . C 3 HOH 3 203 15 HOH HOH A . C 3 HOH 4 204 9 HOH HOH A . C 3 HOH 5 205 11 HOH HOH A . C 3 HOH 6 206 6 HOH HOH A . C 3 HOH 7 207 13 HOH HOH A . C 3 HOH 8 208 4 HOH HOH A . C 3 HOH 9 209 1 HOH HOH A . C 3 HOH 10 210 12 HOH HOH A . C 3 HOH 11 211 14 HOH HOH A . C 3 HOH 12 212 3 HOH HOH A . C 3 HOH 13 213 8 HOH HOH A . C 3 HOH 14 214 5 HOH HOH A . C 3 HOH 15 215 17 HOH HOH A . C 3 HOH 16 216 7 HOH HOH A . C 3 HOH 17 217 16 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? BUSTER ? ? ? 2.11.8 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90 _cell.angle_alpha_esd ? _cell.angle_beta 90 _cell.angle_beta_esd ? _cell.angle_gamma 90 _cell.angle_gamma_esd ? _cell.entry_id 8Q6N _cell.details ? _cell.formula_units_Z ? _cell.length_a 72.811 _cell.length_a_esd ? _cell.length_b 85.091 _cell.length_b_esd ? _cell.length_c 97.162 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8Q6N _symmetry.cell_setting ? _symmetry.Int_Tables_number 23 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'I 2 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8Q6N _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.05 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 75.64 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.1M ammonium sulfate, 0.1M sodium chloride, 20% PEG 8000, 1M sodium formate, 50mM Bis-Tris' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 287 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-10-23 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.102 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.102 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate 97 _reflns.entry_id 8Q6N _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.63 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6639 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 12 _reflns.pdbx_netI_over_av_sigmaI 23.3 _reflns.pdbx_netI_over_sigmaI 4.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.013 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.0 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.1 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.66 _reflns_shell.d_res_low 2.76 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 0.2 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 332 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 9.6 _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 2.9 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all 84.9 _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.047 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] 7.4481 _refine.aniso_B[1][2] 0 _refine.aniso_B[1][3] 0 _refine.aniso_B[2][2] 0.3076 _refine.aniso_B[2][3] 0 _refine.aniso_B[3][3] -7.7557 _refine.B_iso_max ? _refine.B_iso_mean 123.43 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc 0.948 _refine.correlation_coeff_Fo_to_Fc_free 0.932 _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8Q6N _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.63 _refine.ls_d_res_low 21.34 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6620 _refine.ls_number_reflns_R_free 318 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 71.5 _refine.ls_percent_reflns_R_free ? _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2391 _refine.ls_R_factor_R_free 0.2819 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2371 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 7ELP _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI 0.317 _refine.pdbx_overall_SU_R_free_Blow_DPI 0.336 _refine.pdbx_overall_SU_R_Blow_DPI 0.504 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML ? _refine.overall_SU_R_Cruickshank_DPI 0.429 _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_analyze.entry_id 8Q6N _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_analyze.Luzzati_coordinate_error_free ? _refine_analyze.Luzzati_coordinate_error_obs 0.48 _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.Luzzati_d_res_low_obs ? _refine_analyze.Luzzati_sigma_a_free ? _refine_analyze.Luzzati_sigma_a_free_details ? _refine_analyze.Luzzati_sigma_a_obs ? _refine_analyze.Luzzati_sigma_a_obs_details ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.RG_d_res_high ? _refine_analyze.RG_d_res_low ? _refine_analyze.RG_free ? _refine_analyze.RG_work ? _refine_analyze.RG_free_work_ratio ? _refine_analyze.pdbx_Luzzati_d_res_high_obs ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.63 _refine_hist.d_res_low 21.34 _refine_hist.number_atoms_solvent 17 _refine_hist.number_atoms_total 1015 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 987 _refine_hist.pdbx_number_atoms_ligand 11 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.008 ? 1117 ? t_bond_d 2 HARMONIC 'X-RAY DIFFRACTION' ? 0.78 ? 1740 ? t_angle_deg 2 HARMONIC 'X-RAY DIFFRACTION' ? ? ? 225 ? t_dihedral_angle_d 2 SINUSOIDAL 'X-RAY DIFFRACTION' ? ? ? 52 ? t_gen_planes 5 HARMONIC 'X-RAY DIFFRACTION' ? ? ? 1117 ? t_it 10 HARMONIC 'X-RAY DIFFRACTION' ? ? ? 184 ? t_chiral_improper_torsion 5 SEMIHARMONIC 'X-RAY DIFFRACTION' ? ? ? 503 ? t_ideal_dist_contact 4 SEMIHARMONIC 'X-RAY DIFFRACTION' ? 22.06 ? ? ? t_other_torsion ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 2.63 _refine_ls_shell.d_res_low 2.91 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs 442 _refine_ls_shell.number_reflns_R_free 27 _refine_ls_shell.number_reflns_R_work ? _refine_ls_shell.percent_reflns_obs 18.29 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs 0.3547 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.3545 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? _refine_ls_shell.R_factor_R_free 0.358 # _struct.entry_id 8Q6N _struct.title 'Xanthin riboswitch in complex with oxypurinol' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8Q6N _struct_keywords.text 'RNA riboswitch xanthin ligand, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8Q6N _struct_ref.pdbx_db_accession 8Q6N _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8Q6N _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 46 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8Q6N _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 46 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 46 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 350 ? 1 MORE 5 ? 1 'SSA (A^2)' 7740 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support homology _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 46 N3 ? ? A G 1 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 46 O2 ? ? A G 1 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 46 N4 ? ? A G 1 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 45 N3 ? ? A G 2 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 45 O2 ? ? A G 2 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 45 N4 ? ? A G 2 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 44 N3 ? ? A A 3 A U 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 44 O4 ? ? A A 3 A U 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 4 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 43 O2 ? ? A G 4 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 43 N4 ? ? A G 4 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 42 O6 ? ? A U 5 A G 42 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 42 N1 ? ? A U 5 A G 42 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 41 N3 ? ? A A 6 A U 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 41 O4 ? ? A A 6 A U 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 7 O6 ? ? ? 1_555 A G 42 N2 ? ? A G 7 A G 42 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A A 8 N6 ? ? ? 1_555 A G 42 N3 ? ? A A 8 A G 42 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 41 O2 ? ? A A 9 A U 41 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog19 hydrog ? ? A G 10 N2 ? ? ? 1_555 A U 40 O2 ? ? A G 10 A U 40 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog20 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 35 N1 ? ? A C 11 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 35 O6 ? ? A C 11 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 35 N2 ? ? A C 11 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 38 N1 ? ? A U 13 A A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 38 N6 ? ? A U 13 A A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 37 N1 ? ? A U 14 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 37 N6 ? ? A U 14 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 15 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 15 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 15 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 16 N6 ? ? ? 1_555 A C 33 N3 ? ? A A 16 A C 33 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog31 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 17 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 17 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 17 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 18 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 18 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 18 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 19 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 19 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 19 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 20 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 20 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 20 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 21 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 21 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 21 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 22 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 22 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 22 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 23 N2 ? ? ? 1_555 A A 26 N7 ? ? A G 23 A A 26 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog50 hydrog ? ? A G 35 N2 ? ? ? 1_555 A A 39 N1 ? ? A G 35 A A 39 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog51 hydrog ? ? A G 35 N3 ? ? ? 1_555 A A 39 N6 ? ? A G 35 A A 39 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 "O3'" _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 A _pdbx_validate_rmsd_bond.auth_seq_id_1 24 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 "C3'" _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 A _pdbx_validate_rmsd_bond.auth_seq_id_2 24 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.508 _pdbx_validate_rmsd_bond.bond_target_value 1.427 _pdbx_validate_rmsd_bond.bond_deviation 0.081 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.012 _pdbx_validate_rmsd_bond.linker_flag N # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 1 _pdbx_validate_planes.auth_comp_id G _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 23 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.052 _pdbx_validate_planes.type 'SIDE CHAIN' # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method ? _pdbx_refine_tls.origin_x -7.7492 _pdbx_refine_tls.origin_y -16.8967 _pdbx_refine_tls.origin_z -22.7353 _pdbx_refine_tls.T[1][1] 0.0834 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0675 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.1264 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.1572 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] -0.304 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] -0.0411 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 3.7794 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 1.3143 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.8778 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 4.6409 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 5.8208 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 3.7297 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.14 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.1432 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.4717 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.1432 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.9302 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.4088 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.4717 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.4088 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.7903 _pdbx_refine_tls.S[3][3]_esd ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 ? ? A 1 ? ? ? A 46 ? ? '{ A|* }' 2 'X-RAY DIFFRACTION' 1 ? ? A 102 ? ? ? A 102 ? ? '{ A|* }' # _pdbx_entry_details.entry_id 8Q6N _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 141 O6 O N N 1 141 C6 C N N 2 141 C5 C N N 3 141 C7 C N N 4 141 N8 N N N 5 141 N9 N N N 6 141 C4 C N N 7 141 N3 N N N 8 141 O2 O N N 9 141 C2 C N N 10 141 N1 N N N 11 141 H1 H N N 12 141 H2 H N N 13 141 H4 H N N 14 141 H5 H N N 15 A OP3 O N N 16 A P P N N 17 A OP1 O N N 18 A OP2 O N N 19 A "O5'" O N N 20 A "C5'" C N N 21 A "C4'" C N R 22 A "O4'" O N N 23 A "C3'" C N S 24 A "O3'" O N N 25 A "C2'" C N R 26 A "O2'" O N N 27 A "C1'" C N R 28 A N9 N Y N 29 A C8 C Y N 30 A N7 N Y N 31 A C5 C Y N 32 A C6 C Y N 33 A N6 N N N 34 A N1 N Y N 35 A C2 C Y N 36 A N3 N Y N 37 A C4 C Y N 38 A HOP3 H N N 39 A HOP2 H N N 40 A "H5'" H N N 41 A "H5''" H N N 42 A "H4'" H N N 43 A "H3'" H N N 44 A "HO3'" H N N 45 A "H2'" H N N 46 A "HO2'" H N N 47 A "H1'" H N N 48 A H8 H N N 49 A H61 H N N 50 A H62 H N N 51 A H2 H N N 52 C OP3 O N N 53 C P P N N 54 C OP1 O N N 55 C OP2 O N N 56 C "O5'" O N N 57 C "C5'" C N N 58 C "C4'" C N R 59 C "O4'" O N N 60 C "C3'" C N S 61 C "O3'" O N N 62 C "C2'" C N R 63 C "O2'" O N N 64 C "C1'" C N R 65 C N1 N N N 66 C C2 C N N 67 C O2 O N N 68 C N3 N N N 69 C C4 C N N 70 C N4 N N N 71 C C5 C N N 72 C C6 C N N 73 C HOP3 H N N 74 C HOP2 H N N 75 C "H5'" H N N 76 C "H5''" H N N 77 C "H4'" H N N 78 C "H3'" H N N 79 C "HO3'" H N N 80 C "H2'" H N N 81 C "HO2'" H N N 82 C "H1'" H N N 83 C H41 H N N 84 C H42 H N N 85 C H5 H N N 86 C H6 H N N 87 G OP3 O N N 88 G P P N N 89 G OP1 O N N 90 G OP2 O N N 91 G "O5'" O N N 92 G "C5'" C N N 93 G "C4'" C N R 94 G "O4'" O N N 95 G "C3'" C N S 96 G "O3'" O N N 97 G "C2'" C N R 98 G "O2'" O N N 99 G "C1'" C N R 100 G N9 N Y N 101 G C8 C Y N 102 G N7 N Y N 103 G C5 C Y N 104 G C6 C N N 105 G O6 O N N 106 G N1 N N N 107 G C2 C N N 108 G N2 N N N 109 G N3 N N N 110 G C4 C Y N 111 G HOP3 H N N 112 G HOP2 H N N 113 G "H5'" H N N 114 G "H5''" H N N 115 G "H4'" H N N 116 G "H3'" H N N 117 G "HO3'" H N N 118 G "H2'" H N N 119 G "HO2'" H N N 120 G "H1'" H N N 121 G H8 H N N 122 G H1 H N N 123 G H21 H N N 124 G H22 H N N 125 HOH O O N N 126 HOH H1 H N N 127 HOH H2 H N N 128 U OP3 O N N 129 U P P N N 130 U OP1 O N N 131 U OP2 O N N 132 U "O5'" O N N 133 U "C5'" C N N 134 U "C4'" C N R 135 U "O4'" O N N 136 U "C3'" C N S 137 U "O3'" O N N 138 U "C2'" C N R 139 U "O2'" O N N 140 U "C1'" C N R 141 U N1 N N N 142 U C2 C N N 143 U O2 O N N 144 U N3 N N N 145 U C4 C N N 146 U O4 O N N 147 U C5 C N N 148 U C6 C N N 149 U HOP3 H N N 150 U HOP2 H N N 151 U "H5'" H N N 152 U "H5''" H N N 153 U "H4'" H N N 154 U "H3'" H N N 155 U "HO3'" H N N 156 U "H2'" H N N 157 U "HO2'" H N N 158 U "H1'" H N N 159 U H3 H N N 160 U H5 H N N 161 U H6 H N N 162 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 141 N8 C7 sing N N 1 141 N8 N9 sing N N 2 141 C7 C5 doub N N 3 141 N9 C4 sing N N 4 141 C5 C4 sing N N 5 141 C5 C6 sing N N 6 141 C4 N3 doub N N 7 141 C6 O6 doub N N 8 141 C6 N1 sing N N 9 141 N3 C2 sing N N 10 141 N1 C2 sing N N 11 141 C2 O2 doub N N 12 141 C7 H1 sing N N 13 141 N8 H2 sing N N 14 141 N1 H4 sing N N 15 141 N9 H5 sing N N 16 A OP3 P sing N N 17 A OP3 HOP3 sing N N 18 A P OP1 doub N N 19 A P OP2 sing N N 20 A P "O5'" sing N N 21 A OP2 HOP2 sing N N 22 A "O5'" "C5'" sing N N 23 A "C5'" "C4'" sing N N 24 A "C5'" "H5'" sing N N 25 A "C5'" "H5''" sing N N 26 A "C4'" "O4'" sing N N 27 A "C4'" "C3'" sing N N 28 A "C4'" "H4'" sing N N 29 A "O4'" "C1'" sing N N 30 A "C3'" "O3'" sing N N 31 A "C3'" "C2'" sing N N 32 A "C3'" "H3'" sing N N 33 A "O3'" "HO3'" sing N N 34 A "C2'" "O2'" sing N N 35 A "C2'" "C1'" sing N N 36 A "C2'" "H2'" sing N N 37 A "O2'" "HO2'" sing N N 38 A "C1'" N9 sing N N 39 A "C1'" "H1'" sing N N 40 A N9 C8 sing Y N 41 A N9 C4 sing Y N 42 A C8 N7 doub Y N 43 A C8 H8 sing N N 44 A N7 C5 sing Y N 45 A C5 C6 sing Y N 46 A C5 C4 doub Y N 47 A C6 N6 sing N N 48 A C6 N1 doub Y N 49 A N6 H61 sing N N 50 A N6 H62 sing N N 51 A N1 C2 sing Y N 52 A C2 N3 doub Y N 53 A C2 H2 sing N N 54 A N3 C4 sing Y N 55 C OP3 P sing N N 56 C OP3 HOP3 sing N N 57 C P OP1 doub N N 58 C P OP2 sing N N 59 C P "O5'" sing N N 60 C OP2 HOP2 sing N N 61 C "O5'" "C5'" sing N N 62 C "C5'" "C4'" sing N N 63 C "C5'" "H5'" sing N N 64 C "C5'" "H5''" sing N N 65 C "C4'" "O4'" sing N N 66 C "C4'" "C3'" sing N N 67 C "C4'" "H4'" sing N N 68 C "O4'" "C1'" sing N N 69 C "C3'" "O3'" sing N N 70 C "C3'" "C2'" sing N N 71 C "C3'" "H3'" sing N N 72 C "O3'" "HO3'" sing N N 73 C "C2'" "O2'" sing N N 74 C "C2'" "C1'" sing N N 75 C "C2'" "H2'" sing N N 76 C "O2'" "HO2'" sing N N 77 C "C1'" N1 sing N N 78 C "C1'" "H1'" sing N N 79 C N1 C2 sing N N 80 C N1 C6 sing N N 81 C C2 O2 doub N N 82 C C2 N3 sing N N 83 C N3 C4 doub N N 84 C C4 N4 sing N N 85 C C4 C5 sing N N 86 C N4 H41 sing N N 87 C N4 H42 sing N N 88 C C5 C6 doub N N 89 C C5 H5 sing N N 90 C C6 H6 sing N N 91 G OP3 P sing N N 92 G OP3 HOP3 sing N N 93 G P OP1 doub N N 94 G P OP2 sing N N 95 G P "O5'" sing N N 96 G OP2 HOP2 sing N N 97 G "O5'" "C5'" sing N N 98 G "C5'" "C4'" sing N N 99 G "C5'" "H5'" sing N N 100 G "C5'" "H5''" sing N N 101 G "C4'" "O4'" sing N N 102 G "C4'" "C3'" sing N N 103 G "C4'" "H4'" sing N N 104 G "O4'" "C1'" sing N N 105 G "C3'" "O3'" sing N N 106 G "C3'" "C2'" sing N N 107 G "C3'" "H3'" sing N N 108 G "O3'" "HO3'" sing N N 109 G "C2'" "O2'" sing N N 110 G "C2'" "C1'" sing N N 111 G "C2'" "H2'" sing N N 112 G "O2'" "HO2'" sing N N 113 G "C1'" N9 sing N N 114 G "C1'" "H1'" sing N N 115 G N9 C8 sing Y N 116 G N9 C4 sing Y N 117 G C8 N7 doub Y N 118 G C8 H8 sing N N 119 G N7 C5 sing Y N 120 G C5 C6 sing N N 121 G C5 C4 doub Y N 122 G C6 O6 doub N N 123 G C6 N1 sing N N 124 G N1 C2 sing N N 125 G N1 H1 sing N N 126 G C2 N2 sing N N 127 G C2 N3 doub N N 128 G N2 H21 sing N N 129 G N2 H22 sing N N 130 G N3 C4 sing N N 131 HOH O H1 sing N N 132 HOH O H2 sing N N 133 U OP3 P sing N N 134 U OP3 HOP3 sing N N 135 U P OP1 doub N N 136 U P OP2 sing N N 137 U P "O5'" sing N N 138 U OP2 HOP2 sing N N 139 U "O5'" "C5'" sing N N 140 U "C5'" "C4'" sing N N 141 U "C5'" "H5'" sing N N 142 U "C5'" "H5''" sing N N 143 U "C4'" "O4'" sing N N 144 U "C4'" "C3'" sing N N 145 U "C4'" "H4'" sing N N 146 U "O4'" "C1'" sing N N 147 U "C3'" "O3'" sing N N 148 U "C3'" "C2'" sing N N 149 U "C3'" "H3'" sing N N 150 U "O3'" "HO3'" sing N N 151 U "C2'" "O2'" sing N N 152 U "C2'" "C1'" sing N N 153 U "C2'" "H2'" sing N N 154 U "O2'" "HO2'" sing N N 155 U "C1'" N1 sing N N 156 U "C1'" "H1'" sing N N 157 U N1 C2 sing N N 158 U N1 C6 sing N N 159 U C2 O2 doub N N 160 U C2 N3 sing N N 161 U N3 C4 sing N N 162 U N3 H3 sing N N 163 U C4 O4 doub N N 164 U C4 C5 sing N N 165 U C5 C6 doub N N 166 U C5 H5 sing N N 167 U C6 H6 sing N N 168 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8Q6N 'double helix' 8Q6N 'a-form double helix' 8Q6N tetraloop 8Q6N 'bulge loop' 8Q6N 'mismatched base pair' 8Q6N 'internal loop' 8Q6N 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 46 1_555 0.110 -0.200 0.297 6.852 -21.057 -1.833 1 A_G1:C46_A A 1 ? A 46 ? 19 1 1 A G 2 1_555 A C 45 1_555 -0.224 -0.201 -0.293 -12.448 -16.552 -0.857 2 A_G2:C45_A A 2 ? A 45 ? 19 1 1 A A 3 1_555 A U 44 1_555 0.287 0.090 0.376 -2.199 -14.201 2.445 3 A_A3:U44_A A 3 ? A 44 ? 20 1 1 A G 4 1_555 A C 43 1_555 0.014 -0.212 0.253 -8.053 -23.454 -3.008 4 A_G4:C43_A A 4 ? A 43 ? 19 1 1 A U 5 1_555 A G 42 1_555 1.652 -0.375 0.687 -7.683 -11.248 3.188 5 A_U5:G42_A A 5 ? A 42 ? 28 1 1 A A 6 1_555 A U 41 1_555 -0.038 -0.260 0.131 6.330 1.429 -0.341 6 A_A6:U41_A A 6 ? A 41 ? 20 1 1 A G 10 1_555 A U 40 1_555 -1.228 3.406 0.193 -21.006 -19.555 66.870 7 A_G10:U40_A A 10 ? A 40 ? ? ? 1 A C 11 1_555 A G 35 1_555 0.626 -0.248 0.482 -8.215 -2.550 -2.968 8 A_C11:G35_A A 11 ? A 35 ? 19 1 1 A U 13 1_555 A A 38 1_555 -1.099 0.314 0.062 10.914 5.997 9.364 9 A_U13:A38_A A 13 ? A 38 ? 20 1 1 A U 14 1_555 A A 37 1_555 -0.500 -0.133 -0.801 22.201 6.829 1.136 10 A_U14:A37_A A 14 ? A 37 ? 20 1 1 A C 15 1_555 A G 36 1_555 0.926 0.043 -0.188 5.367 -1.351 6.201 11 A_C15:G36_A A 15 ? A 36 ? 19 1 1 A A 16 1_555 A C 33 1_555 -3.571 -0.289 -0.791 3.301 2.420 -0.841 12 A_A16:C33_A A 16 ? A 33 ? ? 1 1 A G 17 1_555 A C 32 1_555 -0.474 -0.165 0.081 -3.202 -2.967 -1.110 13 A_G17:C32_A A 17 ? A 32 ? 19 1 1 A C 18 1_555 A G 31 1_555 -0.818 0.056 0.367 -2.141 -11.706 5.554 14 A_C18:G31_A A 18 ? A 31 ? 19 1 1 A G 19 1_555 A C 30 1_555 0.474 -0.011 0.322 -1.254 -16.920 4.568 15 A_G19:C30_A A 19 ? A 30 ? 19 1 1 A G 20 1_555 A C 29 1_555 1.042 0.042 0.323 -0.065 -13.908 5.260 16 A_G20:C29_A A 20 ? A 29 ? 19 1 1 A C 21 1_555 A G 28 1_555 0.634 0.039 -0.145 7.621 -12.254 6.040 17 A_C21:G28_A A 21 ? A 28 ? 19 1 1 A C 22 1_555 A G 27 1_555 0.375 0.086 0.801 -2.754 2.126 8.096 18 A_C22:G27_A A 22 ? A 27 ? 19 1 1 A G 23 1_555 A A 26 1_555 7.622 -5.553 0.995 5.154 -10.142 -39.084 19 A_G23:A26_A A 23 ? A 26 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 46 1_555 A G 2 1_555 A C 45 1_555 -0.512 -1.988 3.626 -1.322 13.474 35.257 -4.835 0.619 2.729 21.301 2.090 37.690 1 AA_G1G2:C45C46_AA A 1 ? A 46 ? A 2 ? A 45 ? 1 A G 2 1_555 A C 45 1_555 A A 3 1_555 A U 44 1_555 0.326 -1.169 2.923 -4.468 3.937 36.267 -2.322 -1.047 2.728 6.273 7.118 36.737 2 AA_G2A3:U44C45_AA A 2 ? A 45 ? A 3 ? A 44 ? 1 A A 3 1_555 A U 44 1_555 A G 4 1_555 A C 43 1_555 0.109 -2.007 3.364 3.267 7.859 27.916 -5.612 0.460 2.706 15.831 -6.581 29.160 3 AA_A3G4:C43U44_AA A 3 ? A 44 ? A 4 ? A 43 ? 1 A G 4 1_555 A C 43 1_555 A U 5 1_555 A G 42 1_555 0.192 -1.295 3.161 -1.338 2.707 40.543 -2.150 -0.417 3.064 3.901 1.927 40.651 4 AA_G4U5:G42C43_AA A 4 ? A 43 ? A 5 ? A 42 ? 1 A U 5 1_555 A G 42 1_555 A A 6 1_555 A U 41 1_555 -0.485 -1.082 2.691 4.699 10.264 23.140 -4.573 2.071 1.912 23.851 -10.920 25.713 5 AA_U5A6:U41G42_AA A 5 ? A 42 ? A 6 ? A 41 ? 1 A A 6 1_555 A U 41 1_555 A G 10 1_555 A U 40 1_555 -3.351 0.355 3.688 -2.559 -4.626 78.676 0.424 2.559 3.756 -3.645 2.016 78.825 6 AA_A6G10:U40U41_AA A 6 ? A 41 ? A 10 ? A 40 ? 1 A G 10 1_555 A U 40 1_555 A C 11 1_555 A G 35 1_555 1.315 1.347 3.258 -4.382 0.447 74.118 1.103 -1.225 3.194 0.371 3.633 74.230 7 AA_G10C11:G35U40_AA A 10 ? A 40 ? A 11 ? A 35 ? 1 A U 13 1_555 A A 38 1_555 A U 14 1_555 A A 37 1_555 -0.503 -1.312 3.042 5.669 6.055 32.922 -3.106 1.666 2.645 10.478 -9.810 33.923 8 AA_U13U14:A37A38_AA A 13 ? A 38 ? A 14 ? A 37 ? 1 A U 14 1_555 A A 37 1_555 A C 15 1_555 A G 36 1_555 0.639 -1.978 3.574 0.029 16.972 38.318 -4.513 -0.893 2.516 24.447 -0.041 41.779 9 AA_U14C15:G36A37_AA A 14 ? A 37 ? A 15 ? A 36 ? 1 A C 15 1_555 A G 36 1_555 A A 16 1_555 A C 33 1_555 3.500 -1.174 3.506 -9.959 8.741 46.882 -2.056 -4.969 2.512 10.738 12.233 48.616 10 AA_C15A16:C33G36_AA A 15 ? A 36 ? A 16 ? A 33 ? 1 A A 16 1_555 A C 33 1_555 A G 17 1_555 A C 32 1_555 -0.299 -1.586 3.474 -10.026 4.277 41.596 -2.613 -0.637 3.286 5.901 13.835 42.939 11 AA_A16G17:C32C33_AA A 16 ? A 33 ? A 17 ? A 32 ? 1 A G 17 1_555 A C 32 1_555 A C 18 1_555 A G 31 1_555 0.037 -1.967 3.241 -2.199 1.627 29.852 -4.130 -0.513 3.121 3.150 4.257 29.974 12 AA_G17C18:G31C32_AA A 17 ? A 32 ? A 18 ? A 31 ? 1 A C 18 1_555 A G 31 1_555 A G 19 1_555 A C 30 1_555 -0.083 -1.016 3.248 0.381 1.986 36.366 -1.898 0.184 3.189 3.179 -0.610 36.420 13 AA_C18G19:C30G31_AA A 18 ? A 31 ? A 19 ? A 30 ? 1 A G 19 1_555 A C 30 1_555 A G 20 1_555 A C 29 1_555 0.169 -1.937 3.215 0.270 1.302 32.164 -3.719 -0.258 3.137 2.349 -0.486 32.190 14 AA_G19G20:C29C30_AA A 19 ? A 30 ? A 20 ? A 29 ? 1 A G 20 1_555 A C 29 1_555 A C 21 1_555 A G 28 1_555 0.317 -1.509 3.065 4.561 1.948 27.491 -3.559 0.351 2.965 4.058 -9.500 27.926 15 AA_G20C21:G28C29_AA A 20 ? A 29 ? A 21 ? A 28 ? 1 A C 21 1_555 A G 28 1_555 A C 22 1_555 A G 27 1_555 0.296 -1.947 3.485 -5.940 7.856 31.101 -4.820 -1.549 2.820 14.211 10.745 32.587 16 AA_C21C22:G27G28_AA A 21 ? A 28 ? A 22 ? A 27 ? 1 A C 22 1_555 A G 27 1_555 A G 23 1_555 A A 26 1_555 -3.807 -1.759 2.709 4.358 8.976 53.577 -2.330 4.359 2.119 9.861 -4.788 54.431 17 AA_C22G23:A26G27_AA A 22 ? A 27 ? A 23 ? A 26 ? # _pdbx_audit_support.funding_organization 'Not funded' _pdbx_audit_support.country ? _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 141 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 141 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _atom_sites.entry_id 8Q6N _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.013734 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.011752 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010292 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_