data_8TB3 # _entry.id 8TB3 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8TB3 pdb_00008tb3 10.2210/pdb8tb3/pdb WWPDB D_1000275292 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8TB3 _pdbx_database_status.recvd_initial_deposition_date 2023-06-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 145 _citation.language ? _citation.page_first 26075 _citation.page_last 26085 _citation.title ;Site-Specific Arrangement and Structure Determination of Minor Groove Binding Molecules in Self-Assembled Three-Dimensional DNA Crystals. ; _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.3c07802 _citation.pdbx_database_id_PubMed 37987645 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 0000-0002-2290-6132 primary 'Buchberger, A.' 2 ? primary 'Henry, S.J.W.' 3 0000-0002-5132-3948 primary 'Novacek, A.' 4 ? primary 'Fahmi, N.E.' 5 ? primary 'MacCulloch, T.' 6 ? primary 'Stephanopoulos, N.' 7 0000-0001-7859-410X primary 'Yan, H.' 8 0000-0001-7397-9852 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 8TB3 _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.635 _cell.length_a_esd ? _cell.length_b 68.635 _cell.length_b_esd ? _cell.length_c 62.566 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8TB3 _symmetry.cell_setting ? _symmetry.Int_Tables_number 154 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*CP*AP*AP*TP*TP*GP*CP*TP*GP*AP*CP*GP*AP*CP*AP*CP*TP*CP*A)-3') ; 6416.175 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*GP*TP*CP*A)-3') ; 1480.012 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*T)-3') ; 2761.820 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*GP*CP*AP*AP*TP*TP*G*(DAP))-3') ; 2137.435 1 ? ? ? ? 5 non-polymer syn '6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE' 277.324 1 ? ? ? ? 6 water nat water 18.015 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DC)(DA)(DA)(DT)(DT)(DG)(DC)(DT)(DG)(DA)(DC)(DG)(DA)(DC)(DA)(DC)(DT)(DC) (DA) ; GACAATTGCTGACGACACTCA A ? 2 polydeoxyribonucleotide no no '(DC)(DG)(DT)(DC)(DA)' CGTCA B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DG)(DT)' TCTGAGTGT C ? 4 polydeoxyribonucleotide no no '(DG)(DC)(DA)(DA)(DT)(DT)(DG)' GCAATTG D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DC n 1 4 DA n 1 5 DA n 1 6 DT n 1 7 DT n 1 8 DG n 1 9 DC n 1 10 DT n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DA n 1 16 DC n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DG n 2 3 DT n 2 4 DC n 2 5 DA n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DG n 3 9 DT n 4 1 DG n 4 2 DC n 4 3 DA n 4 4 DA n 4 5 DT n 4 6 DT n 4 7 DG n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 5 'synthetic construct' ? 32630 ? 3 1 sample 1 9 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 8TB3 8TB3 ? 1 ? 1 2 PDB 8TB3 8TB3 ? 2 ? 1 3 PDB 8TB3 8TB3 ? 3 ? 1 4 PDB 8TB3 8TB3 ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8TB3 A 1 ? 21 ? 8TB3 1 ? 21 ? 1 21 2 2 8TB3 B 1 ? 5 ? 8TB3 1 ? 5 ? 1 5 3 3 8TB3 C 1 ? 9 ? 8TB3 1 ? 9 ? 1 9 4 4 8TB3 D 1 ? 7 ? 8TB3 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DAP non-polymer . '6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE' ? 'C16 H15 N5' 277.324 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HOH non-polymer . WATER ? 'H2 O' 18.015 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8TB3 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.32 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 63.00 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Na Cacodylate pH 6.5 with 18 mM MgCl2, 2.25 mM spermine, and 9% Isopropanol was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock. ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 298 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2018-12-15 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.92 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 19-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.92 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 19-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8TB3 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.00 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 3620 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 7.1 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 15.0 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.864 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.063 _reflns.pdbx_Rpim_I_all 0.024 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.00 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.058 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 3.00 3.05 ? ? ? ? ? ? 165 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.109 ? ? 0.987 0.364 ? 1 1 0.907 0.975 ? 100.0 ? 0.917 ? ? ? ? ? ? ? ? ? 3.05 3.11 ? ? ? ? ? ? 184 ? ? ? ? ? ? ? ? ? ? ? 7.3 1.311 ? ? 0.529 0.197 ? 2 1 0.973 0.993 ? 100.0 ? 0.491 ? ? ? ? ? ? ? ? ? 3.11 3.17 ? ? ? ? ? ? 166 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.293 ? ? 0.368 0.138 ? 3 1 0.992 0.998 ? 100.0 ? 0.341 ? ? ? ? ? ? ? ? ? 3.17 3.23 ? ? ? ? ? ? 182 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.498 ? ? 0.150 0.055 ? 4 1 0.998 1.000 ? 100.0 ? 0.139 ? ? ? ? ? ? ? ? ? 3.23 3.30 ? ? ? ? ? ? 185 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.413 ? ? 0.107 0.040 ? 5 1 0.998 1.000 ? 100.0 ? 0.099 ? ? ? ? ? ? ? ? ? 3.30 3.38 ? ? ? ? ? ? 172 ? ? ? ? ? ? ? ? ? ? ? 7.4 1.505 ? ? 0.099 0.036 ? 6 1 0.998 1.000 ? 100.0 ? 0.092 ? ? ? ? ? ? ? ? ? 3.38 3.46 ? ? ? ? ? ? 179 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.578 ? ? 0.109 0.040 ? 7 1 0.999 1.000 ? 100.0 ? 0.101 ? ? ? ? ? ? ? ? ? 3.46 3.56 ? ? ? ? ? ? 182 ? ? ? ? ? ? ? ? ? ? ? 7.3 1.480 ? ? 0.115 0.043 ? 8 1 0.997 0.999 ? 100.0 ? 0.107 ? ? ? ? ? ? ? ? ? 3.56 3.66 ? ? ? ? ? ? 166 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.366 ? ? 0.107 0.040 ? 9 1 0.998 0.999 ? 100.0 ? 0.100 ? ? ? ? ? ? ? ? ? 3.66 3.78 ? ? ? ? ? ? 186 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.619 ? ? 0.145 0.054 ? 10 1 0.993 0.998 ? 100.0 ? 0.134 ? ? ? ? ? ? ? ? ? 3.78 3.91 ? ? ? ? ? ? 175 ? ? ? ? ? ? ? ? ? ? ? 7.3 1.598 ? ? 0.102 0.038 ? 11 1 0.997 0.999 ? 100.0 ? 0.095 ? ? ? ? ? ? ? ? ? 3.91 4.07 ? ? ? ? ? ? 190 ? ? ? ? ? ? ? ? ? ? ? 7.2 1.688 ? ? 0.091 0.034 ? 12 1 0.996 0.999 ? 100.0 ? 0.085 ? ? ? ? ? ? ? ? ? 4.07 4.26 ? ? ? ? ? ? 176 ? ? ? ? ? ? ? ? ? ? ? 7.1 1.563 ? ? 0.079 0.030 ? 13 1 0.995 0.999 ? 100.0 ? 0.073 ? ? ? ? ? ? ? ? ? 4.26 4.48 ? ? ? ? ? ? 183 ? ? ? ? ? ? ? ? ? ? ? 7.1 1.693 ? ? 0.070 0.026 ? 14 1 0.998 0.999 ? 100.0 ? 0.065 ? ? ? ? ? ? ? ? ? 4.48 4.76 ? ? ? ? ? ? 175 ? ? ? ? ? ? ? ? ? ? ? 7.1 1.759 ? ? 0.068 0.026 ? 15 1 0.997 0.999 ? 100.0 ? 0.063 ? ? ? ? ? ? ? ? ? 4.76 5.13 ? ? ? ? ? ? 183 ? ? ? ? ? ? ? ? ? ? ? 7.0 1.674 ? ? 0.054 0.021 ? 16 1 0.999 1.000 ? 100.0 ? 0.050 ? ? ? ? ? ? ? ? ? 5.13 5.64 ? ? ? ? ? ? 191 ? ? ? ? ? ? ? ? ? ? ? 7.0 1.609 ? ? 0.042 0.016 ? 17 1 0.999 1.000 ? 100.0 ? 0.038 ? ? ? ? ? ? ? ? ? 5.64 6.46 ? ? ? ? ? ? 182 ? ? ? ? ? ? ? ? ? ? ? 6.8 1.750 ? ? 0.040 0.015 ? 18 1 0.999 1.000 ? 100.0 ? 0.037 ? ? ? ? ? ? ? ? ? 6.46 8.13 ? ? ? ? ? ? 191 ? ? ? ? ? ? ? ? ? ? ? 6.7 2.007 ? ? 0.039 0.015 ? 19 1 0.999 1.000 ? 100.0 ? 0.036 ? ? ? ? ? ? ? ? ? 8.13 50.00 ? ? ? ? ? ? 207 ? ? ? ? ? ? ? ? ? ? ? 5.8 8.308 ? ? 0.047 0.019 ? 20 1 0.999 1.000 ? 96.3 ? 0.042 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] -0.02 _refine.aniso_B[1][2] -0.01 _refine.aniso_B[1][3] -0.00 _refine.aniso_B[2][2] -0.02 _refine.aniso_B[2][3] 0.00 _refine.aniso_B[3][3] 0.07 _refine.B_iso_max ? _refine.B_iso_mean 81.184 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc 0.968 _refine.correlation_coeff_Fo_to_Fc_free 0.966 _refine.details 'HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS' _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8TB3 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.00 _refine.ls_d_res_low 43.09 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3429 _refine.ls_number_reflns_R_free 178 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.75 _refine.ls_percent_reflns_R_free 4.9 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.19615 _refine.ls_R_factor_R_free 0.23968 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.19338 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details MASK _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'MAXIMUM LIKELIHOOD' _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free 0.370 _refine.pdbx_solvent_vdw_probe_radii 1.20 _refine.pdbx_solvent_ion_probe_radii 0.80 _refine.pdbx_solvent_shrinkage_radii 0.80 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B 16.850 _refine.overall_SU_ML 0.300 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id 1 _refine_hist.details ? _refine_hist.d_res_high 3.00 _refine_hist.d_res_low 43.09 _refine_hist.number_atoms_solvent 2 _refine_hist.number_atoms_total 878 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 21 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 0.011 979 ? r_bond_refined_d ? ? 'X-RAY DIFFRACTION' ? 0.011 0.017 485 ? r_bond_other_d ? ? 'X-RAY DIFFRACTION' ? 2.002 1.791 1500 ? r_angle_refined_deg ? ? 'X-RAY DIFFRACTION' ? 0.580 1.544 1147 ? r_angle_other_deg ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_dihedral_angle_1_deg ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_dihedral_angle_2_deg ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_dihedral_angle_3_deg ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_dihedral_angle_4_deg ? ? 'X-RAY DIFFRACTION' ? 0.162 0.200 164 ? r_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.013 0.020 532 ? r_gen_planes_refined ? ? 'X-RAY DIFFRACTION' ? 0.002 0.020 157 ? r_gen_planes_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_nbd_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_nbd_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_nbtor_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_nbtor_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_xyhbond_nbd_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_xyhbond_nbd_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_metal_ion_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_metal_ion_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_symmetry_vdw_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_symmetry_vdw_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_symmetry_hbond_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_symmetry_hbond_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_symmetry_metal_ion_refined ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_symmetry_metal_ion_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_mcbond_it ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_mcbond_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_mcangle_it ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_mcangle_other ? ? 'X-RAY DIFFRACTION' ? 8.318 8.232 979 ? r_scbond_it ? ? 'X-RAY DIFFRACTION' ? 8.314 8.235 980 ? r_scbond_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_scangle_it ? ? 'X-RAY DIFFRACTION' ? 12.108 12.351 1501 ? r_scangle_other ? ? 'X-RAY DIFFRACTION' ? 13.653 ? 1481 ? r_long_range_B_refined ? ? 'X-RAY DIFFRACTION' ? 13.648 ? 1482 ? r_long_range_B_other ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_rigid_bond_restr ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_sphericity_free ? ? 'X-RAY DIFFRACTION' ? ? ? ? ? r_sphericity_bonded ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 3.00 _refine_ls_shell.d_res_low 3.077 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 6 _refine_ls_shell.number_reflns_R_work 242 _refine_ls_shell.percent_reflns_obs 100.00 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.353 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? _refine_ls_shell.R_factor_R_free 0.570 # _struct.entry_id 8TB3 _struct.title ;Sequence specific (AATT) orientation of DAPI molecules at a unique minor groove binding site (position1) within a self-assembled 3D DNA lattice (4x5) ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8TB3 _struct_keywords.text ;Self-Assembly, DNA Nanotechnology, DNA Scaffold, Crystal Lattice, DNA, Minor Groove Binders, Netropsin, DAPI, Hoechst, ImPyPy, polyamide, host-guest ; _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 6 ? G N N 6 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DC 3 N3 ? ? ? 1_555 D DG 7 N1 ? ? A DC 3 D DG 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DC 3 N4 ? ? ? 1_555 D DG 7 O6 ? ? A DC 3 D DG 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DC 3 O2 ? ? ? 1_555 D DG 7 N2 ? ? A DC 3 D DG 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DA 4 N1 ? ? ? 1_555 D DT 6 N3 ? ? A DA 4 D DT 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DA 4 N6 ? ? ? 1_555 D DT 6 O4 ? ? A DA 4 D DT 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DT 6 N3 ? ? ? 1_555 D DA 4 N1 ? ? A DT 6 D DA 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DT 6 O4 ? ? ? 1_555 D DA 4 N6 ? ? A DT 6 D DA 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DT 7 N3 ? ? ? 1_555 D DA 3 N1 ? ? A DT 7 D DA 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DT 7 O4 ? ? ? 1_555 D DA 3 N6 ? ? A DT 7 D DA 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 8 N1 ? ? ? 1_555 D DC 2 N3 ? ? A DG 8 D DC 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 8 N2 ? ? ? 1_555 D DC 2 O2 ? ? A DG 8 D DC 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DG 8 O6 ? ? ? 1_555 D DC 2 N4 ? ? A DG 8 D DC 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 9 N3 ? ? ? 1_555 D DG 1 N1 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 9 N4 ? ? ? 1_555 D DG 1 O6 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 O2 ? ? ? 1_555 D DG 1 N2 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 5 N1 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 5 N6 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 4 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 4 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 4 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 3 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 3 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 2 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 2 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 2 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DA 15 N1 ? ? ? 1_555 C DT 9 N3 ? ? A DA 15 C DT 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DA 15 N6 ? ? ? 1_555 C DT 9 O4 ? ? A DA 15 C DT 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DC 16 N3 ? ? ? 1_555 C DG 8 N1 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DC 16 N4 ? ? ? 1_555 C DG 8 O6 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DC 16 O2 ? ? ? 1_555 C DG 8 N2 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 8TB3 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014570 _atom_sites.fract_transf_matrix[1][2] 0.008412 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] -0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016824 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] -0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015983 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DC 3 3 3 DC DC A . n A 1 4 DA 4 4 4 DA DA A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DT 6 6 6 DT DT A . n A 1 7 DT 7 7 7 DT DT A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DA 15 15 15 DA DA A . n A 1 16 DC 16 16 16 DC DC A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 1 1 DC DC B . n B 2 2 DG 2 2 2 DG DG B . n B 2 3 DT 3 3 3 DT DT B . n B 2 4 DC 4 4 4 DC DC B . n B 2 5 DA 5 5 5 DA DA B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DG 8 8 8 DG DG C . n C 3 9 DT 9 9 9 DT DT C . n D 4 1 DG 1 10 10 DG DG D . n D 4 2 DC 2 11 11 DC DC D . n D 4 3 DA 3 12 12 DA DA D . n D 4 4 DA 4 13 13 DA DA D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DT 6 15 15 DT DT D . n D 4 7 DG 7 16 16 DG DG D . n # _pdbx_contact_author.id 2 _pdbx_contact_author.email hao.yan@asu.edu _pdbx_contact_author.name_first Hao _pdbx_contact_author.name_last Yan _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-7397-9852 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 DAP 1 101 101 DAP DAP D . F 6 HOH 1 101 1 HOH HOH C . G 6 HOH 1 201 2 HOH HOH D . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2023-12-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? REFMAC ? ? ? 5.8.0352 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 8TB3 _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_symm_contact.id _pdbx_validate_symm_contact.PDB_model_num _pdbx_validate_symm_contact.auth_atom_id_1 _pdbx_validate_symm_contact.auth_asym_id_1 _pdbx_validate_symm_contact.auth_comp_id_1 _pdbx_validate_symm_contact.auth_seq_id_1 _pdbx_validate_symm_contact.PDB_ins_code_1 _pdbx_validate_symm_contact.label_alt_id_1 _pdbx_validate_symm_contact.site_symmetry_1 _pdbx_validate_symm_contact.auth_atom_id_2 _pdbx_validate_symm_contact.auth_asym_id_2 _pdbx_validate_symm_contact.auth_comp_id_2 _pdbx_validate_symm_contact.auth_seq_id_2 _pdbx_validate_symm_contact.PDB_ins_code_2 _pdbx_validate_symm_contact.label_alt_id_2 _pdbx_validate_symm_contact.site_symmetry_2 _pdbx_validate_symm_contact.dist 1 1 "O3'" C DT 9 ? ? 1_555 OP1 D DG 10 ? ? 2_564 1.68 2 1 "O3'" C DT 9 ? ? 1_555 OP2 D DG 10 ? ? 2_564 1.76 3 1 "O3'" C DT 9 ? ? 1_555 P D DG 10 ? ? 2_564 1.99 4 1 OP1 B DC 1 ? ? 1_555 "O3'" B DA 5 ? ? 2_564 2.08 5 1 OP2 B DC 1 ? ? 1_555 "O3'" B DA 5 ? ? 2_564 2.18 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A DG 1 ? ? "O3'" A DG 1 ? ? P A DA 2 ? ? 109.18 119.70 -10.52 1.20 Y 2 1 "C3'" A DA 4 ? ? "O3'" A DA 4 ? ? P A DA 5 ? ? 112.11 119.70 -7.59 1.20 Y 3 1 "C3'" A DT 6 ? ? "O3'" A DT 6 ? ? P A DT 7 ? ? 108.48 119.70 -11.22 1.20 Y 4 1 "C3'" A DT 7 ? ? "C2'" A DT 7 ? ? "C1'" A DT 7 ? ? 97.12 102.40 -5.28 0.80 N 5 1 "C3'" A DT 7 ? ? "O3'" A DT 7 ? ? P A DG 8 ? ? 110.01 119.70 -9.69 1.20 Y 6 1 "O4'" A DG 8 ? ? "C1'" A DG 8 ? ? N9 A DG 8 ? ? 111.21 108.30 2.91 0.30 N 7 1 "C3'" A DG 8 ? ? "O3'" A DG 8 ? ? P A DC 9 ? ? 111.55 119.70 -8.15 1.20 Y 8 1 "C3'" A DT 10 ? ? "O3'" A DT 10 ? ? P A DG 11 ? ? 104.90 119.70 -14.80 1.20 Y 9 1 "C3'" A DA 12 ? ? "O3'" A DA 12 ? ? P A DC 13 ? ? 111.45 119.70 -8.25 1.20 Y 10 1 "O4'" A DC 13 ? ? "C1'" A DC 13 ? ? N1 A DC 13 ? ? 110.95 108.30 2.65 0.30 N 11 1 "C3'" A DC 13 ? ? "O3'" A DC 13 ? ? P A DG 14 ? ? 103.06 119.70 -16.64 1.20 Y 12 1 "C3'" A DA 17 ? ? "O3'" A DA 17 ? ? P A DC 18 ? ? 107.22 119.70 -12.48 1.20 Y 13 1 "C3'" A DC 18 ? ? "O3'" A DC 18 ? ? P A DT 19 ? ? 108.74 119.70 -10.96 1.20 Y 14 1 "C3'" C DT 1 ? ? "O3'" C DT 1 ? ? P C DC 2 ? ? 111.63 119.70 -8.07 1.20 Y 15 1 "C3'" C DT 3 ? ? "O3'" C DT 3 ? ? P C DG 4 ? ? 107.87 119.70 -11.83 1.20 Y 16 1 "C3'" C DT 7 ? ? "O3'" C DT 7 ? ? P C DG 8 ? ? 111.97 119.70 -7.73 1.20 Y 17 1 "O5'" D DG 10 ? ? P D DG 10 ? ? OP1 D DG 10 ? ? 99.20 105.70 -6.50 0.90 N 18 1 "C3'" D DA 12 ? ? "O3'" D DA 12 ? ? P D DA 13 ? ? 106.48 119.70 -13.22 1.20 Y 19 1 "C3'" D DA 13 ? ? "O3'" D DA 13 ? ? P D DT 14 ? ? 107.00 119.70 -12.70 1.20 Y 20 1 "O4'" D DT 14 ? ? "C1'" D DT 14 ? ? N1 D DT 14 ? ? 110.93 108.30 2.63 0.30 N 21 1 "C3'" D DT 14 ? ? "O3'" D DT 14 ? ? P D DT 15 ? ? 104.14 119.70 -15.56 1.20 Y 22 1 "O5'" D DT 15 ? ? "C5'" D DT 15 ? ? "C4'" D DT 15 ? ? 104.24 109.40 -5.16 0.80 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DAP N1 N Y N 37 DAP C2 C Y N 38 DAP C3 C Y N 39 DAP C4 C Y N 40 DAP C5 C Y N 41 DAP C6 C Y N 42 DAP C7 C Y N 43 DAP C8 C Y N 44 DAP C9 C Y N 45 DAP C10 C N N 46 DAP N2 N N N 47 DAP N3 N N N 48 DAP "C1'" C Y N 49 DAP "C2'" C Y N 50 DAP "C3'" C Y N 51 DAP "C4'" C Y N 52 DAP "C5'" C Y N 53 DAP "C6'" C Y N 54 DAP C11 C N N 55 DAP N4 N N N 56 DAP N5 N N N 57 DAP HN1 H N N 58 DAP H3 H N N 59 DAP H4 H N N 60 DAP H5 H N N 61 DAP H7 H N N 62 DAP HN2 H N N 63 DAP HN31 H N N 64 DAP HN32 H N N 65 DAP "H2'" H N N 66 DAP "H3'" H N N 67 DAP "H5'" H N N 68 DAP "H6'" H N N 69 DAP HN4 H N N 70 DAP HN51 H N N 71 DAP HN52 H N N 72 DC OP3 O N N 73 DC P P N N 74 DC OP1 O N N 75 DC OP2 O N N 76 DC "O5'" O N N 77 DC "C5'" C N N 78 DC "C4'" C N R 79 DC "O4'" O N N 80 DC "C3'" C N S 81 DC "O3'" O N N 82 DC "C2'" C N N 83 DC "C1'" C N R 84 DC N1 N N N 85 DC C2 C N N 86 DC O2 O N N 87 DC N3 N N N 88 DC C4 C N N 89 DC N4 N N N 90 DC C5 C N N 91 DC C6 C N N 92 DC HOP3 H N N 93 DC HOP2 H N N 94 DC "H5'" H N N 95 DC "H5''" H N N 96 DC "H4'" H N N 97 DC "H3'" H N N 98 DC "HO3'" H N N 99 DC "H2'" H N N 100 DC "H2''" H N N 101 DC "H1'" H N N 102 DC H41 H N N 103 DC H42 H N N 104 DC H5 H N N 105 DC H6 H N N 106 DG OP3 O N N 107 DG P P N N 108 DG OP1 O N N 109 DG OP2 O N N 110 DG "O5'" O N N 111 DG "C5'" C N N 112 DG "C4'" C N R 113 DG "O4'" O N N 114 DG "C3'" C N S 115 DG "O3'" O N N 116 DG "C2'" C N N 117 DG "C1'" C N R 118 DG N9 N Y N 119 DG C8 C Y N 120 DG N7 N Y N 121 DG C5 C Y N 122 DG C6 C N N 123 DG O6 O N N 124 DG N1 N N N 125 DG C2 C N N 126 DG N2 N N N 127 DG N3 N N N 128 DG C4 C Y N 129 DG HOP3 H N N 130 DG HOP2 H N N 131 DG "H5'" H N N 132 DG "H5''" H N N 133 DG "H4'" H N N 134 DG "H3'" H N N 135 DG "HO3'" H N N 136 DG "H2'" H N N 137 DG "H2''" H N N 138 DG "H1'" H N N 139 DG H8 H N N 140 DG H1 H N N 141 DG H21 H N N 142 DG H22 H N N 143 DT OP3 O N N 144 DT P P N N 145 DT OP1 O N N 146 DT OP2 O N N 147 DT "O5'" O N N 148 DT "C5'" C N N 149 DT "C4'" C N R 150 DT "O4'" O N N 151 DT "C3'" C N S 152 DT "O3'" O N N 153 DT "C2'" C N N 154 DT "C1'" C N R 155 DT N1 N N N 156 DT C2 C N N 157 DT O2 O N N 158 DT N3 N N N 159 DT C4 C N N 160 DT O4 O N N 161 DT C5 C N N 162 DT C7 C N N 163 DT C6 C N N 164 DT HOP3 H N N 165 DT HOP2 H N N 166 DT "H5'" H N N 167 DT "H5''" H N N 168 DT "H4'" H N N 169 DT "H3'" H N N 170 DT "HO3'" H N N 171 DT "H2'" H N N 172 DT "H2''" H N N 173 DT "H1'" H N N 174 DT H3 H N N 175 DT H71 H N N 176 DT H72 H N N 177 DT H73 H N N 178 DT H6 H N N 179 HOH O O N N 180 HOH H1 H N N 181 HOH H2 H N N 182 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DAP N1 C2 sing Y N 39 DAP N1 C8 sing Y N 40 DAP N1 HN1 sing N N 41 DAP C2 C3 doub Y N 42 DAP C2 "C1'" sing Y N 43 DAP C3 C9 sing Y N 44 DAP C3 H3 sing N N 45 DAP C4 C5 doub Y N 46 DAP C4 C9 sing Y N 47 DAP C4 H4 sing N N 48 DAP C5 C6 sing Y N 49 DAP C5 H5 sing N N 50 DAP C6 C7 doub Y N 51 DAP C6 C10 sing N N 52 DAP C7 C8 sing Y N 53 DAP C7 H7 sing N N 54 DAP C8 C9 doub Y N 55 DAP C10 N2 doub N N 56 DAP C10 N3 sing N N 57 DAP N2 HN2 sing N N 58 DAP N3 HN31 sing N N 59 DAP N3 HN32 sing N N 60 DAP "C1'" "C2'" doub Y N 61 DAP "C1'" "C6'" sing Y N 62 DAP "C2'" "C3'" sing Y N 63 DAP "C2'" "H2'" sing N N 64 DAP "C3'" "C4'" doub Y N 65 DAP "C3'" "H3'" sing N N 66 DAP "C4'" "C5'" sing Y N 67 DAP "C4'" C11 sing N N 68 DAP "C5'" "C6'" doub Y N 69 DAP "C5'" "H5'" sing N N 70 DAP "C6'" "H6'" sing N N 71 DAP C11 N4 doub N N 72 DAP C11 N5 sing N N 73 DAP N4 HN4 sing N N 74 DAP N5 HN51 sing N N 75 DAP N5 HN52 sing N N 76 DC OP3 P sing N N 77 DC OP3 HOP3 sing N N 78 DC P OP1 doub N N 79 DC P OP2 sing N N 80 DC P "O5'" sing N N 81 DC OP2 HOP2 sing N N 82 DC "O5'" "C5'" sing N N 83 DC "C5'" "C4'" sing N N 84 DC "C5'" "H5'" sing N N 85 DC "C5'" "H5''" sing N N 86 DC "C4'" "O4'" sing N N 87 DC "C4'" "C3'" sing N N 88 DC "C4'" "H4'" sing N N 89 DC "O4'" "C1'" sing N N 90 DC "C3'" "O3'" sing N N 91 DC "C3'" "C2'" sing N N 92 DC "C3'" "H3'" sing N N 93 DC "O3'" "HO3'" sing N N 94 DC "C2'" "C1'" sing N N 95 DC "C2'" "H2'" sing N N 96 DC "C2'" "H2''" sing N N 97 DC "C1'" N1 sing N N 98 DC "C1'" "H1'" sing N N 99 DC N1 C2 sing N N 100 DC N1 C6 sing N N 101 DC C2 O2 doub N N 102 DC C2 N3 sing N N 103 DC N3 C4 doub N N 104 DC C4 N4 sing N N 105 DC C4 C5 sing N N 106 DC N4 H41 sing N N 107 DC N4 H42 sing N N 108 DC C5 C6 doub N N 109 DC C5 H5 sing N N 110 DC C6 H6 sing N N 111 DG OP3 P sing N N 112 DG OP3 HOP3 sing N N 113 DG P OP1 doub N N 114 DG P OP2 sing N N 115 DG P "O5'" sing N N 116 DG OP2 HOP2 sing N N 117 DG "O5'" "C5'" sing N N 118 DG "C5'" "C4'" sing N N 119 DG "C5'" "H5'" sing N N 120 DG "C5'" "H5''" sing N N 121 DG "C4'" "O4'" sing N N 122 DG "C4'" "C3'" sing N N 123 DG "C4'" "H4'" sing N N 124 DG "O4'" "C1'" sing N N 125 DG "C3'" "O3'" sing N N 126 DG "C3'" "C2'" sing N N 127 DG "C3'" "H3'" sing N N 128 DG "O3'" "HO3'" sing N N 129 DG "C2'" "C1'" sing N N 130 DG "C2'" "H2'" sing N N 131 DG "C2'" "H2''" sing N N 132 DG "C1'" N9 sing N N 133 DG "C1'" "H1'" sing N N 134 DG N9 C8 sing Y N 135 DG N9 C4 sing Y N 136 DG C8 N7 doub Y N 137 DG C8 H8 sing N N 138 DG N7 C5 sing Y N 139 DG C5 C6 sing N N 140 DG C5 C4 doub Y N 141 DG C6 O6 doub N N 142 DG C6 N1 sing N N 143 DG N1 C2 sing N N 144 DG N1 H1 sing N N 145 DG C2 N2 sing N N 146 DG C2 N3 doub N N 147 DG N2 H21 sing N N 148 DG N2 H22 sing N N 149 DG N3 C4 sing N N 150 DT OP3 P sing N N 151 DT OP3 HOP3 sing N N 152 DT P OP1 doub N N 153 DT P OP2 sing N N 154 DT P "O5'" sing N N 155 DT OP2 HOP2 sing N N 156 DT "O5'" "C5'" sing N N 157 DT "C5'" "C4'" sing N N 158 DT "C5'" "H5'" sing N N 159 DT "C5'" "H5''" sing N N 160 DT "C4'" "O4'" sing N N 161 DT "C4'" "C3'" sing N N 162 DT "C4'" "H4'" sing N N 163 DT "O4'" "C1'" sing N N 164 DT "C3'" "O3'" sing N N 165 DT "C3'" "C2'" sing N N 166 DT "C3'" "H3'" sing N N 167 DT "O3'" "HO3'" sing N N 168 DT "C2'" "C1'" sing N N 169 DT "C2'" "H2'" sing N N 170 DT "C2'" "H2''" sing N N 171 DT "C1'" N1 sing N N 172 DT "C1'" "H1'" sing N N 173 DT N1 C2 sing N N 174 DT N1 C6 sing N N 175 DT C2 O2 doub N N 176 DT C2 N3 sing N N 177 DT N3 C4 sing N N 178 DT N3 H3 sing N N 179 DT C4 O4 doub N N 180 DT C4 C5 sing N N 181 DT C5 C7 sing N N 182 DT C5 C6 doub N N 183 DT C7 H71 sing N N 184 DT C7 H72 sing N N 185 DT C7 H73 sing N N 186 DT C6 H6 sing N N 187 HOH O H1 sing N N 188 HOH O H2 sing N N 189 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8TB3 'double helix' 8TB3 'a-form double helix' 8TB3 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DC 3 1_555 D DG 7 1_555 -0.164 -0.192 0.142 5.565 -0.202 -6.489 1 A_DC3:DG16_D A 3 ? D 16 ? 19 1 1 A DA 4 1_555 D DT 6 1_555 -0.503 0.255 0.527 13.460 -7.237 -0.217 2 A_DA4:DT15_D A 4 ? D 15 ? 20 1 1 A DA 5 1_555 D DT 5 1_555 0.547 -0.066 0.612 7.332 -7.864 -0.487 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DT 6 1_555 D DA 4 1_555 0.190 -0.542 0.837 -3.774 -4.299 6.546 4 A_DT6:DA13_D A 6 ? D 13 ? 20 1 1 A DT 7 1_555 D DA 3 1_555 -0.561 -0.393 0.160 -3.006 -9.454 -8.877 5 A_DT7:DA12_D A 7 ? D 12 ? 20 1 1 A DG 8 1_555 D DC 2 1_555 -0.167 0.034 -0.084 -5.282 -0.496 2.374 6 A_DG8:DC11_D A 8 ? D 11 ? 19 1 1 A DC 9 1_555 D DG 1 1_555 -0.427 0.030 0.602 -3.659 -1.712 0.859 7 A_DC9:DG10_D A 9 ? D 10 ? 19 1 1 A DT 10 1_555 B DA 5 1_555 -0.404 -0.063 0.398 -2.756 -2.184 -1.616 8 A_DT10:DA5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 4 1_555 0.663 -0.103 0.826 20.640 -1.053 -6.261 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 3 1_555 0.552 -0.444 0.058 3.234 -3.613 -7.038 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 2 1_555 -0.422 -0.466 0.478 -3.494 -9.497 -3.801 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DG 14 1_555 B DC 1 1_555 -0.049 -0.059 0.280 3.797 -2.397 -0.453 12 A_DG14:DC1_B A 14 ? B 1 ? 19 1 1 A DA 15 1_555 C DT 9 1_555 0.252 0.102 0.482 -3.162 1.667 -2.587 13 A_DA15:DT9_C A 15 ? C 9 ? 20 1 1 A DC 16 1_555 C DG 8 1_555 0.242 -0.157 0.200 4.729 -3.179 0.996 14 A_DC16:DG8_C A 16 ? C 8 ? 19 1 1 A DA 17 1_555 C DT 7 1_555 0.505 -0.283 0.184 2.474 -5.565 -9.054 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 -1.077 -0.236 0.308 -10.737 -2.344 0.712 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -0.464 -0.152 0.271 -5.194 -0.983 -7.324 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 0.584 0.105 -0.286 3.074 -4.537 -1.621 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 -0.812 -0.120 0.266 7.570 1.271 0.566 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DC 3 1_555 D DG 7 1_555 A DA 4 1_555 D DT 6 1_555 -0.102 0.268 3.242 -0.892 0.767 35.634 0.327 0.039 3.248 1.253 1.458 35.653 1 AA_DC3DA4:DT15DG16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DA 4 1_555 D DT 6 1_555 A DA 5 1_555 D DT 5 1_555 0.101 -0.507 3.389 -2.026 0.434 41.648 -0.759 -0.363 3.375 0.610 2.848 41.697 2 AA_DA4DA5:DT14DT15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DT 6 1_555 D DA 4 1_555 0.360 -1.072 3.573 -3.875 -4.115 30.577 -1.127 -1.494 3.611 -7.721 7.271 31.083 3 AA_DA5DT6:DA13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DT 6 1_555 D DA 4 1_555 A DT 7 1_555 D DA 3 1_555 -0.784 -0.796 3.123 7.459 -1.999 30.641 -1.116 2.735 2.901 -3.710 -13.840 31.577 4 AA_DT6DT7:DA12DA13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DT 7 1_555 D DA 3 1_555 A DG 8 1_555 D DC 2 1_555 0.807 -0.279 3.442 0.188 -1.583 33.487 -0.210 -1.366 3.456 -2.745 -0.326 33.523 5 AA_DT7DG8:DC11DA12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DG 8 1_555 D DC 2 1_555 A DC 9 1_555 D DG 1 1_555 -0.687 -0.700 3.212 -9.921 6.449 39.252 -1.702 -0.096 3.139 9.345 14.377 40.929 6 AA_DG8DC9:DG10DC11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DC 9 1_555 D DG 1 1_555 A DT 10 1_555 B DA 5 1_555 -1.067 -1.201 3.186 0.654 -5.779 28.178 -1.112 2.295 3.336 -11.711 -1.325 28.760 7 AA_DC9DT10:DA5DG10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DT 10 1_555 B DA 5 1_555 A DG 11 1_555 B DC 4 1_555 -0.196 0.858 2.894 -3.375 6.861 34.105 0.481 -0.140 3.010 11.519 5.666 34.927 8 AA_DT10DG11:DC4DA5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 4 1_555 A DA 12 1_555 B DT 3 1_555 0.099 -0.427 3.788 4.243 6.682 35.591 -1.749 0.518 3.639 10.768 -6.837 36.433 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 3 1_555 A DC 13 1_555 B DG 2 1_555 0.701 -1.025 3.365 -6.540 5.481 28.842 -3.077 -2.665 2.900 10.712 12.780 30.052 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 2 1_555 A DG 14 1_555 B DC 1 1_555 -0.037 -1.199 3.133 -0.990 -2.606 35.685 -1.586 -0.078 3.209 -4.245 1.613 35.790 11 AA_DC13DG14:DC1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DG 14 1_555 B DC 1 1_555 A DA 15 1_555 C DT 9 1_555 -1.272 -0.710 3.467 -1.934 -0.971 35.462 -1.012 1.782 3.546 -1.592 3.172 35.525 12 AA_DG14DA15:DT9DC1_CB A 14 ? B 1 ? A 15 ? C 9 ? 1 A DA 15 1_555 C DT 9 1_555 A DC 16 1_555 C DG 8 1_555 0.353 -0.450 3.227 2.343 0.900 28.553 -1.109 -0.191 3.229 1.820 -4.739 28.661 13 AA_DA15DC16:DG8DT9_CC A 15 ? C 9 ? A 16 ? C 8 ? 1 A DC 16 1_555 C DG 8 1_555 A DA 17 1_555 C DT 7 1_555 -0.180 0.230 3.397 -1.115 4.445 36.512 -0.267 0.127 3.404 7.061 1.771 36.788 14 AA_DC16DA17:DT7DG8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 0.817 -1.062 3.657 -2.155 -1.729 21.995 -2.028 -3.039 3.632 -4.509 5.620 22.166 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 -0.291 -0.872 3.152 5.046 2.311 40.587 -1.487 0.941 3.044 3.313 -7.234 40.949 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.815 0.444 3.157 7.446 7.543 38.774 -0.214 -0.338 3.279 11.110 -10.969 40.143 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.037 1.701 3.213 -4.238 -0.546 37.880 2.673 -0.468 3.175 -0.837 6.504 38.111 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 5 '6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE' DAP 6 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5KEK _pdbx_initial_refinement_model.details ? #