data_wwPDB_remediated_restraints_file_for_PDB_entry_5j0m # This wwPDB archive file contains, for PDB entry 5j0m: # # - Sequence information from the PDB mmCIF file # - NMR restraints from the PDB MR file # # In this file, the NMR restraints share the same atom names as in the coordinate # file, and in this way can differ from the data deposited at the wwPDB. To achieve # this aim, the NMR restraints were parsed from their original format files, and # the coordinates and NMR restraints information were subsequently harmonized. # # Due to the complexity of this harmonization process, minor modifications could # have occurred to the NMR restraints information, or data could have been lost # because of parsing or conversion errors. The PDB file remains the # authoritative reference for the atomic coordinates and the originally deposited # restraints files remain the primary reference for these data. # # This file is generated as part of the wwPDB at the BioMagResBank (BMRB) in # collaboration with the PDBe (formerly MSD) group at the European # Bioinformatics Institute (EBI) and the CMBI/IMM group at the Radboud # University of Nijmegen. # # Several software packages were used to produce this file: # # - Wattos (BMRB and CMBI/IMM). # - FormatConverter and NMRStarExport (PDBe). # - CCPN framework (http://www.ccpn.ac.uk/). # # More information about this process can be found in the references below. # Please cite the original reference for this PDB entry. # # JF Doreleijers, A Nederveen, W Vranken, J Lin, AM Bonvin, R Kaptein, JL # Markley, and EL Ulrich (2005). BioMagResBank databases DOCR and FRED # containing converted and filtered sets of experimental NMR restraints and # coordinates from over 500 protein PDB structures. J. Biomol. NMR 32, 1-12. # # WF Vranken, W Boucher, TJ Stevens, RH Fogh, A Pajon, M Llinas, EL Ulrich, JL # Markley, J Ionides, ED Laue (2005). The CCPN data model for NMR spectroscopy: # development of a software pipeline. Proteins 59, 687-696. # # JF Doreleijers, WF Vranken, C Schulte, J Lin, JR Wedell, CJ Penkett, GW Vuister, # G Vriend, JL Markley, and EL Ulrich (2009). The NMR Restraints Grid at BMRB for # 5,266 Protein and Nucleic Acid PDB Entries. J Biomol. NMR 45, 389-396. ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID rr_5j0m _Entry.Title 'wwPDB remediated NMR restraints for PDB entry 5j0m' _Entry.Version_type original _Entry.NMR_STAR_version 3.1.0.8 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details 'Contains the remediated restraint lists and coordinates for PDB entry 5j0m' _Entry.PDB_coordinate_file_version 3.20 loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 5j0m 'Master copy' rr_5j0m stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID rr_5j0m _Assembly.ID 1 _Assembly.Name 5j0m _Assembly.Number_of_components 2 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 11138.79404 loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'Cyclic peptide mimetic of HIV 1 Tat' 1 $Cyclic_peptide_mimetic_of_HIV_1_Tat A . no . . . . . . rr_5j0m 1 2 'Apical region 29 mer of the HIV 1 TAR RNA element' 2 $Apical_region__29_mer__of_the_HIV_1_TAR_RNA_element B . no . . . . . . rr_5j0m 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_Cyclic_peptide_mimetic_of_HIV_1_Tat _Entity.Sf_category entity _Entity.Sf_framecode Cyclic_peptide_mimetic_of_HIV_1_Tat _Entity.Entry_ID rr_5j0m _Entity.ID 1 _Entity.Name Cyclic_peptide_mimetic_of_HIV_1_Tat _Entity.Type polymer _Entity.Polymer_type polypeptide(L) _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code RVRTRKGRRIRIXP _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer yes _Entity.Nstd_chirality yes _Entity.Nstd_linkage no _Entity.Number_of_monomers 14 _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Parent_entity_ID 1 _Entity.Formula_weight 1767.1978 loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . ARG . rr_5j0m 1 2 . VAL . rr_5j0m 1 3 . ARG . rr_5j0m 1 4 . THR . rr_5j0m 1 5 . ARG . rr_5j0m 1 6 . LYS . rr_5j0m 1 7 . GLY . rr_5j0m 1 8 . ARG . rr_5j0m 1 9 . ARG . rr_5j0m 1 10 . ILE . rr_5j0m 1 11 . ARG . rr_5j0m 1 12 . ILE . rr_5j0m 1 13 . DPR . rr_5j0m 1 14 . PRO . rr_5j0m 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . ARG 1 1 rr_5j0m 1 . VAL 2 2 rr_5j0m 1 . ARG 3 3 rr_5j0m 1 . THR 4 4 rr_5j0m 1 . ARG 5 5 rr_5j0m 1 . LYS 6 6 rr_5j0m 1 . GLY 7 7 rr_5j0m 1 . ARG 8 8 rr_5j0m 1 . ARG 9 9 rr_5j0m 1 . ILE 10 10 rr_5j0m 1 . ARG 11 11 rr_5j0m 1 . ILE 12 12 rr_5j0m 1 . DPR 13 13 rr_5j0m 1 . PRO 14 14 rr_5j0m 1 stop_ save_ save_Apical_region__29_mer__of_the_HIV_1_TAR_RNA_element _Entity.Sf_category entity _Entity.Sf_framecode Apical_region__29_mer__of_the_HIV_1_TAR_RNA_element _Entity.Entry_ID rr_5j0m _Entity.ID 2 _Entity.Name Apical_region__29_mer__of_the_HIV_1_TAR_RNA_element _Entity.Type polymer _Entity.Polymer_type polyribonucleotide _Entity.Polymer_strand_ID B _Entity.Polymer_seq_one_letter_code ; GGCAGAUCUGAGCCUGGGAG CUCUCUGCC ; _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality yes _Entity.Nstd_linkage no _Entity.Number_of_monomers 29 _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Parent_entity_ID 2 _Entity.Formula_weight 9371.59624 loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . rr_5j0m 2 2 . G . rr_5j0m 2 3 . C . rr_5j0m 2 4 . A . rr_5j0m 2 5 . G . rr_5j0m 2 6 . A . rr_5j0m 2 7 . U . rr_5j0m 2 8 . C . rr_5j0m 2 9 . U . rr_5j0m 2 10 . G . rr_5j0m 2 11 . A . rr_5j0m 2 12 . G . rr_5j0m 2 13 . C . rr_5j0m 2 14 . C . rr_5j0m 2 15 . U . rr_5j0m 2 16 . G . rr_5j0m 2 17 . G . rr_5j0m 2 18 . G . rr_5j0m 2 19 . A . rr_5j0m 2 20 . G . rr_5j0m 2 21 . C . rr_5j0m 2 22 . U . rr_5j0m 2 23 . C . rr_5j0m 2 24 . U . rr_5j0m 2 25 . C . rr_5j0m 2 26 . U . rr_5j0m 2 27 . G . rr_5j0m 2 28 . C . rr_5j0m 2 29 . C . rr_5j0m 2 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 rr_5j0m 2 . G 2 2 rr_5j0m 2 . C 3 3 rr_5j0m 2 . A 4 4 rr_5j0m 2 . G 5 5 rr_5j0m 2 . A 6 6 rr_5j0m 2 . U 7 7 rr_5j0m 2 . C 8 8 rr_5j0m 2 . U 9 9 rr_5j0m 2 . G 10 10 rr_5j0m 2 . A 11 11 rr_5j0m 2 . G 12 12 rr_5j0m 2 . C 13 13 rr_5j0m 2 . C 14 14 rr_5j0m 2 . U 15 15 rr_5j0m 2 . G 16 16 rr_5j0m 2 . G 17 17 rr_5j0m 2 . G 18 18 rr_5j0m 2 . A 19 19 rr_5j0m 2 . G 20 20 rr_5j0m 2 . C 21 21 rr_5j0m 2 . U 22 22 rr_5j0m 2 . C 23 23 rr_5j0m 2 . U 24 24 rr_5j0m 2 . C 25 25 rr_5j0m 2 . U 26 26 rr_5j0m 2 . G 27 27 rr_5j0m 2 . C 28 28 rr_5j0m 2 . C 29 29 rr_5j0m 2 stop_ save_ ################################# # Polymer residues and ligands # ################################# save_chem_comp_DPR _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_DPR _Chem_comp.Entry_ID rr_5j0m _Chem_comp.ID DPR _Chem_comp.Name D-proline _Chem_comp.Type 'L-peptide linking' _Chem_comp.PDB_code DPR _Chem_comp.Std_deriv_one_letter_code P _Chem_comp.Std_deriv_three_letter_code Pro _Chem_comp.Std_deriv_PDB_code PRO _Chem_comp.Std_deriv_chem_comp_name PROLINE _Chem_comp.Formal_charge 0 _Chem_comp.Paramagnetic no _Chem_comp.Aromatic no _Chem_comp.Formula 'C5 H7 N O' _Chem_comp.Formula_weight 97.1164 loop_ _Chem_comp_common_name.Name _Chem_comp_common_name.Type _Chem_comp_common_name.Entry_ID _Chem_comp_common_name.Comp_ID L-proline name rr_5j0m DPR stop_ save_ ############################## # Structure determinations # ############################## ########################## # Conformer statistics # ########################## save_conformer_statistics _Conformer_stat_list.Sf_category conformer_statistics _Conformer_stat_list.Sf_framecode conformer_statistics _Conformer_stat_list.Entry_ID rr_5j0m _Conformer_stat_list.ID 1 _Conformer_stat_list.Conf_family_coord_set_ID 1 _Conformer_stat_list.Conf_family_coord_set_label $Original_constraints_and_structures _Conformer_stat_list.Conformer_submitted_total_num 10 save_ ########################### # Constraint Statistics # ########################### save_constraint_statistics _Constraint_stat_list.Sf_framecode constraint_statistics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID rr_5j0m _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 5j0m.mr . . 'MR format' 1 comment 'Not applicable' 'Not applicable' 0 rr_5j0m 1 1 5j0m.mr . . XPLOR/CNS 2 'dipolar coupling' 'Not applicable' 'Not applicable' 58 rr_5j0m 1 1 5j0m.mr . . 'MR format' 3 'nomenclature mapping' 'Not applicable' 'Not applicable' 0 rr_5j0m 1 stop_ save_ save_CNS/XPLOR_dipolar_coupling_2 _RDC_constraint_list.Sf_category RDC_constraints _RDC_constraint_list.Sf_framecode CNS/XPLOR_dipolar_coupling_2 _RDC_constraint_list.Entry_ID rr_5j0m _RDC_constraint_list.ID 1 _RDC_constraint_list.Details 'Generated by Wattos' _RDC_constraint_list.Constraint_file_ID 1 _RDC_constraint_list.Block_ID 2 loop_ _RDC_constraint_software.Software_ID _RDC_constraint_software.Software_label _RDC_constraint_software.Method_ID _RDC_constraint_software.Method_label _RDC_constraint_software.Entry_ID _RDC_constraint_software.RDC_constraint_list_ID . . . . rr_5j0m 1 stop_ loop_ _RDC_constraint.ID _RDC_constraint.Assembly_atom_ID_1 _RDC_constraint.Entity_assembly_ID_1 _RDC_constraint.Entity_ID_1 _RDC_constraint.Comp_index_ID_1 _RDC_constraint.Seq_ID_1 _RDC_constraint.Comp_ID_1 _RDC_constraint.Atom_ID_1 _RDC_constraint.Atom_type_1 _RDC_constraint.Atom_isotope_number_1 _RDC_constraint.Resonance_ID_1 _RDC_constraint.Assembly_atom_ID_2 _RDC_constraint.Entity_assembly_ID_2 _RDC_constraint.Entity_ID_2 _RDC_constraint.Comp_index_ID_2 _RDC_constraint.Seq_ID_2 _RDC_constraint.Comp_ID_2 _RDC_constraint.Atom_ID_2 _RDC_constraint.Atom_type_2 _RDC_constraint.Atom_isotope_number_2 _RDC_constraint.Resonance_ID_2 _RDC_constraint.RDC_val _RDC_constraint.RDC_lower_bound _RDC_constraint.RDC_upper_bound _RDC_constraint.RDC_val_err _RDC_constraint.RDC_val_scale_factor _RDC_constraint.RDC_bond_length _RDC_constraint.Source_experiment_ID _RDC_constraint.PDB_record_ID_1 _RDC_constraint.PDB_model_num_1 _RDC_constraint.PDB_strand_ID_1 _RDC_constraint.PDB_ins_code_1 _RDC_constraint.PDB_residue_no_1 _RDC_constraint.PDB_residue_name_1 _RDC_constraint.PDB_atom_name_1 _RDC_constraint.PDB_record_ID_2 _RDC_constraint.PDB_model_num_2 _RDC_constraint.PDB_strand_ID_2 _RDC_constraint.PDB_ins_code_2 _RDC_constraint.PDB_residue_no_2 _RDC_constraint.PDB_residue_name_2 _RDC_constraint.PDB_atom_name_2 _RDC_constraint.Auth_entity_assembly_ID_1 _RDC_constraint.Auth_asym_ID_1 _RDC_constraint.Auth_chain_ID_1 _RDC_constraint.Auth_seq_ID_1 _RDC_constraint.Auth_comp_ID_1 _RDC_constraint.Auth_atom_ID_1 _RDC_constraint.Auth_alt_ID_1 _RDC_constraint.Auth_atom_name_1 _RDC_constraint.Auth_entity_assembly_ID_2 _RDC_constraint.Auth_asym_ID_2 _RDC_constraint.Auth_chain_ID_2 _RDC_constraint.Auth_seq_ID_2 _RDC_constraint.Auth_comp_ID_2 _RDC_constraint.Auth_atom_ID_2 _RDC_constraint.Auth_alt_ID_2 _RDC_constraint.Auth_atom_name_2 _RDC_constraint.Entry_ID _RDC_constraint.RDC_constraint_list_ID 1 . 2 2 1 1 G C8 C . . . 2 2 1 1 G H8 H . . 7.5 . . . . . . . . B . 17 G C8 . . B . 17 G H8 . . . 15 . C8 . . . . . 15 . H8 . . rr_5j0m 1 2 . 2 2 2 2 G C1' C . . . 2 2 2 2 G H1' H . . -25.5 . . . . . . . . B . 18 G C1' . . B . 18 G H1' . . . 16 . C1' . . . . . 16 . H1' . . rr_5j0m 1 3 . 2 2 2 2 G C8 C . . . 2 2 2 2 G H8 H . . 5.5 . . . . . . . . B . 18 G C8 . . B . 18 G H8 . . . 16 . C8 . . . . . 16 . H8 . . rr_5j0m 1 4 . 2 2 3 3 C C1' C . . . 2 2 3 3 C H1' H . . -14.5 . . . . . . . . B . 19 C C1' . . B . 19 C H1' . . . 17 . C1' . . . . . 17 . H1' . . rr_5j0m 1 5 . 2 2 3 3 C C5 C . . . 2 2 3 3 C H5 H . . 2.5 . . . . . . . . B . 19 C C5 . . B . 19 C H5 . . . 17 . C5 . . . . . 17 . H5 . . rr_5j0m 1 6 . 2 2 3 3 C C6 C . . . 2 2 3 3 C H6 H . . 14.5 . . . . . . . . B . 19 C C6 . . B . 19 C H6 . . . 17 . C6 . . . . . 17 . H6 . . rr_5j0m 1 7 . 2 2 4 4 A C1' C . . . 2 2 4 4 A H1' H . . -16.0 . . . . . . . . B . 20 A C1' . . B . 20 A H1' . . . 18 . C1' . . . . . 18 . H1' . . rr_5j0m 1 8 . 2 2 4 4 A C2 C . . . 2 2 4 4 A H2 H . . 6.5 . . . . . . . . B . 20 A C2 . . B . 20 A H2 . . . 18 . C2 . . . . . 18 . H2 . . rr_5j0m 1 9 . 2 2 4 4 A C8 C . . . 2 2 4 4 A H8 H . . 18.5 . . . . . . . . B . 20 A C8 . . B . 20 A H8 . . . 18 . C8 . . . . . 18 . H8 . . rr_5j0m 1 10 . 2 2 5 5 G C8 C . . . 2 2 5 5 G H8 H . . 23.5 . . . . . . . . B . 21 G C8 . . B . 21 G H8 . . . 19 . C8 . . . . . 19 . H8 . . rr_5j0m 1 11 . 2 2 6 6 A C1' C . . . 2 2 6 6 A H1' H . . 4.5 . . . . . . . . B . 22 A C1' . . B . 22 A H1' . . . 20 . C1' . . . . . 20 . H1' . . rr_5j0m 1 12 . 2 2 6 6 A C2 C . . . 2 2 6 6 A H2 H . . 23.5 . . . . . . . . B . 22 A C2 . . B . 22 A H2 . . . 20 . C2 . . . . . 20 . H2 . . rr_5j0m 1 13 . 2 2 6 6 A C8 C . . . 2 2 6 6 A H8 H . . 25.0 . . . . . . . . B . 22 A C8 . . B . 22 A H8 . . . 20 . C8 . . . . . 20 . H8 . . rr_5j0m 1 14 . 2 2 7 7 U C1' C . . . 2 2 7 7 U H1' H . . 17.5 . . . . . . . . B . 23 U C1' . . B . 23 U H1' . . . 21 . C1' . . . . . 21 . H1' . . rr_5j0m 1 15 . 2 2 7 7 U C4' C . . . 2 2 7 7 U H4' H . . 8.5 . . . . . . . . B . 23 U C4' . . B . 23 U H4' . . . 21 . C4' . . . . . 21 . H4' . . rr_5j0m 1 16 . 2 2 8 8 C C4' C . . . 2 2 8 8 C H4' H . . 7.0 . . . . . . . . B . 24 C C4' . . B . 24 C H4' . . . 22 . C4' . . . . . 22 . H4' . . rr_5j0m 1 17 . 2 2 8 8 C C5 C . . . 2 2 8 8 C H5 H . . 2.5 . . . . . . . . B . 24 C C5 . . B . 24 C H5 . . . 22 . C5 . . . . . 22 . H5 . . rr_5j0m 1 18 . 2 2 8 8 C C6 C . . . 2 2 8 8 C H6 H . . -3.5 . . . . . . . . B . 24 C C6 . . B . 24 C H6 . . . 22 . C6 . . . . . 22 . H6 . . rr_5j0m 1 19 . 2 2 9 9 U C1' C . . . 2 2 9 9 U H1' H . . -8.5 . . . . . . . . B . 25 U C1' . . B . 25 U H1' . . . 23 . C1' . . . . . 23 . H1' . . rr_5j0m 1 20 . 2 2 9 9 U C5 C . . . 2 2 9 9 U H5 H . . -13.5 . . . . . . . . B . 25 U C5 . . B . 25 U H5 . . . 23 . C5 . . . . . 23 . H5 . . rr_5j0m 1 21 . 2 2 9 9 U C6 C . . . 2 2 9 9 U H6 H . . -8.0 . . . . . . . . B . 25 U C6 . . B . 25 U H6 . . . 23 . C6 . . . . . 23 . H6 . . rr_5j0m 1 22 . 2 2 10 10 G C1' C . . . 2 2 10 10 G H1' H . . -10.0 . . . . . . . . B . 26 G C1' . . B . 26 G H1' . . . 24 . C1' . . . . . 24 . H1' . . rr_5j0m 1 23 . 2 2 10 10 G C8 C . . . 2 2 10 10 G H8 H . . 8.5 . . . . . . . . B . 26 G C8 . . B . 26 G H8 . . . 24 . C8 . . . . . 24 . H8 . . rr_5j0m 1 24 . 2 2 11 11 A C1' C . . . 2 2 11 11 A H1' H . . -3.0 . . . . . . . . B . 27 A C1' . . B . 27 A H1' . . . 25 . C1' . . . . . 25 . H1' . . rr_5j0m 1 25 . 2 2 11 11 A C2 C . . . 2 2 11 11 A H2 H . . 17.5 . . . . . . . . B . 27 A C2 . . B . 27 A H2 . . . 25 . C2 . . . . . 25 . H2 . . rr_5j0m 1 26 . 2 2 11 11 A C8 C . . . 2 2 11 11 A H8 H . . 7.5 . . . . . . . . B . 27 A C8 . . B . 27 A H8 . . . 25 . C8 . . . . . 25 . H8 . . rr_5j0m 1 27 . 2 2 12 12 G C1' C . . . 2 2 12 12 G H1' H . . -9.5 . . . . . . . . B . 28 G C1' . . B . 28 G H1' . . . 26 . C1' . . . . . 26 . H1' . . rr_5j0m 1 28 . 2 2 12 12 G C8 C . . . 2 2 12 12 G H8 H . . 8.5 . . . . . . . . B . 28 G C8 . . B . 28 G H8 . . . 26 . C8 . . . . . 26 . H8 . . rr_5j0m 1 29 . 2 2 13 13 C C6 C . . . 2 2 13 13 C H6 H . . 16.5 . . . . . . . . B . 29 C C6 . . B . 29 C H6 . . . 27 . C6 . . . . . 27 . H6 . . rr_5j0m 1 30 . 2 2 14 14 C C5 C . . . 2 2 14 14 C H5 H . . 14.5 . . . . . . . . B . 30 C C5 . . B . 30 C H5 . . . 28 . C5 . . . . . 28 . H5 . . rr_5j0m 1 31 . 2 2 15 15 U C4' C . . . 2 2 15 15 U H4' H . . 10.0 . . . . . . . . B . 31 U C4' . . B . 31 U H4' . . . 29 . C4' . . . . . 29 . H4' . . rr_5j0m 1 32 . 2 2 15 15 U C5 C . . . 2 2 15 15 U H5 H . . 16.0 . . . . . . . . B . 31 U C5 . . B . 31 U H5 . . . 29 . C5 . . . . . 29 . H5 . . rr_5j0m 1 33 . 2 2 16 16 G C1' C . . . 2 2 16 16 G H1' H . . 7.5 . . . . . . . . B . 32 G C1' . . B . 32 G H1' . . . 30 . C1' . . . . . 30 . H1' . . rr_5j0m 1 34 . 2 2 16 16 G C8 C . . . 2 2 16 16 G H8 H . . 7.0 . . . . . . . . B . 32 G C8 . . B . 32 G H8 . . . 30 . C8 . . . . . 30 . H8 . . rr_5j0m 1 35 . 2 2 17 17 G C8 C . . . 2 2 17 17 G H8 H . . 12.0 . . . . . . . . B . 33 G C8 . . B . 33 G H8 . . . 31 . C8 . . . . . 31 . H8 . . rr_5j0m 1 36 . 2 2 18 18 G C8 C . . . 2 2 18 18 G H8 H . . 14.5 . . . . . . . . B . 34 G C8 . . B . 34 G H8 . . . 32 . C8 . . . . . 32 . H8 . . rr_5j0m 1 37 . 2 2 19 19 A C1' C . . . 2 2 19 19 A H1' H . . -4.5 . . . . . . . . B . 35 A C1' . . B . 35 A H1' . . . 33 . C1' . . . . . 33 . H1' . . rr_5j0m 1 38 . 2 2 19 19 A C2 C . . . 2 2 19 19 A H2 H . . -6.0 . . . . . . . . B . 35 A C2 . . B . 35 A H2 . . . 33 . C2 . . . . . 33 . H2 . . rr_5j0m 1 39 . 2 2 19 19 A C8 C . . . 2 2 19 19 A H8 H . . -4.5 . . . . . . . . B . 35 A C8 . . B . 35 A H8 . . . 33 . C8 . . . . . 33 . H8 . . rr_5j0m 1 40 . 2 2 20 20 G C1' C . . . 2 2 20 20 G H1' H . . -6.0 . . . . . . . . B . 36 G C1' . . B . 36 G H1' . . . 34 . C1' . . . . . 34 . H1' . . rr_5j0m 1 41 . 2 2 21 21 C C1' C . . . 2 2 21 21 C H1' H . . -9.0 . . . . . . . . B . 37 C C1' . . B . 37 C H1' . . . 35 . C1' . . . . . 35 . H1' . . rr_5j0m 1 42 . 2 2 21 21 C C6 C . . . 2 2 21 21 C H6 H . . 8.5 . . . . . . . . B . 37 C C6 . . B . 37 C H6 . . . 35 . C6 . . . . . 35 . H6 . . rr_5j0m 1 43 . 2 2 22 22 U C1' C . . . 2 2 22 22 U H1' H . . -5.5 . . . . . . . . B . 38 U C1' . . B . 38 U H1' . . . 36 . C1' . . . . . 36 . H1' . . rr_5j0m 1 44 . 2 2 22 22 U C5 C . . . 2 2 22 22 U H5 H . . 25.0 . . . . . . . . B . 38 U C5 . . B . 38 U H5 . . . 36 . C5 . . . . . 36 . H5 . . rr_5j0m 1 45 . 2 2 23 23 C C1' C . . . 2 2 23 23 C H1' H . . -23.0 . . . . . . . . B . 39 C C1' . . B . 39 C H1' . . . 37 . C1' . . . . . 37 . H1' . . rr_5j0m 1 46 . 2 2 23 23 C C5 C . . . 2 2 23 23 C H5 H . . 16.0 . . . . . . . . B . 39 C C5 . . B . 39 C H5 . . . 37 . C5 . . . . . 37 . H5 . . rr_5j0m 1 47 . 2 2 23 23 C C6 C . . . 2 2 23 23 C H6 H . . 8.5 . . . . . . . . B . 39 C C6 . . B . 39 C H6 . . . 37 . C6 . . . . . 37 . H6 . . rr_5j0m 1 48 . 2 2 24 24 U C5 C . . . 2 2 24 24 U H5 H . . 8.0 . . . . . . . . B . 40 U C5 . . B . 40 U H5 . . . 38 . C5 . . . . . 38 . H5 . . rr_5j0m 1 49 . 2 2 24 24 U C6 C . . . 2 2 24 24 U H6 H . . 23.5 . . . . . . . . B . 40 U C6 . . B . 40 U H6 . . . 38 . C6 . . . . . 38 . H6 . . rr_5j0m 1 50 . 2 2 25 25 C C5 C . . . 2 2 25 25 C H5 H . . 15.5 . . . . . . . . B . 41 C C5 . . B . 41 C H5 . . . 39 . C5 . . . . . 39 . H5 . . rr_5j0m 1 51 . 2 2 25 25 C C6 C . . . 2 2 25 25 C H6 H . . 20.5 . . . . . . . . B . 41 C C6 . . B . 41 C H6 . . . 39 . C6 . . . . . 39 . H6 . . rr_5j0m 1 52 . 2 2 26 26 U C1' C . . . 2 2 26 26 U H1' H . . 3.0 . . . . . . . . B . 42 U C1' . . B . 42 U H1' . . . 40 . C1' . . . . . 40 . H1' . . rr_5j0m 1 53 . 2 2 26 26 U C5 C . . . 2 2 26 26 U H5 H . . 19.5 . . . . . . . . B . 42 U C5 . . B . 42 U H5 . . . 40 . C5 . . . . . 40 . H5 . . rr_5j0m 1 54 . 2 2 26 26 U C6 C . . . 2 2 26 26 U H6 H . . 15.5 . . . . . . . . B . 42 U C6 . . B . 42 U H6 . . . 40 . C6 . . . . . 40 . H6 . . rr_5j0m 1 55 . 2 2 27 27 G C8 C . . . 2 2 27 27 G H8 H . . 7.5 . . . . . . . . B . 43 G C8 . . B . 43 G H8 . . . 41 . C8 . . . . . 41 . H8 . . rr_5j0m 1 56 . 2 2 29 29 C C4' C . . . 2 2 29 29 C H4' H . . 17.0 . . . . . . . . B . 45 C C4' . . B . 45 C H4' . . . 43 . C4' . . . . . 43 . H4' . . rr_5j0m 1 57 . 2 2 29 29 C C5 C . . . 2 2 29 29 C H5 H . . 14.5 . . . . . . . . B . 45 C C5 . . B . 45 C H5 . . . 43 . C5 . . . . . 43 . H5 . . rr_5j0m 1 58 . 2 2 29 29 C C6 C . . . 2 2 29 29 C H6 H . . 8.0 . . . . . . . . B . 45 C C6 . . B . 45 C H6 . . . 43 . C6 . . . . . 43 . H6 . . rr_5j0m 1 stop_ loop_ _RDC_constraint_comment_org.ID _RDC_constraint_comment_org.Comment_text _RDC_constraint_comment_org.Comment_begin_line _RDC_constraint_comment_org.Comment_begin_column _RDC_constraint_comment_org.Comment_end_line _RDC_constraint_comment_org.Comment_end_column _RDC_constraint_comment_org.Entry_ID _RDC_constraint_comment_org.RDC_constraint_list_ID 1 G17 1 1 1 5 rr_5j0m 1 2 G18 9 1 9 5 rr_5j0m 1 3 G18 17 1 17 5 rr_5j0m 1 4 C19 25 1 25 5 rr_5j0m 1 5 C19 33 1 33 5 rr_5j0m 1 6 C19 41 1 41 5 rr_5j0m 1 7 A20 49 1 49 5 rr_5j0m 1 8 A20 57 1 57 5 rr_5j0m 1 9 A20 65 1 65 5 rr_5j0m 1 10 G21 73 1 73 5 rr_5j0m 1 11 A22 81 1 81 5 rr_5j0m 1 12 A22 89 1 89 5 rr_5j0m 1 13 A22 97 1 97 5 rr_5j0m 1 14 U23 105 1 105 5 rr_5j0m 1 15 U23 113 1 113 5 rr_5j0m 1 16 C24 121 1 121 5 rr_5j0m 1 17 C24 129 1 129 5 rr_5j0m 1 18 C24 137 1 137 5 rr_5j0m 1 19 U25 145 1 145 5 rr_5j0m 1 20 U25 153 1 153 5 rr_5j0m 1 21 U25 161 1 161 5 rr_5j0m 1 22 G26 169 1 169 5 rr_5j0m 1 23 G26 177 1 177 5 rr_5j0m 1 24 A27 185 1 185 5 rr_5j0m 1 25 A27 193 1 193 5 rr_5j0m 1 26 A27 201 1 201 5 rr_5j0m 1 27 G28 209 1 209 5 rr_5j0m 1 28 G28 217 1 217 5 rr_5j0m 1 29 C29 225 1 225 5 rr_5j0m 1 30 C30 233 1 233 5 rr_5j0m 1 31 U31 241 1 241 5 rr_5j0m 1 32 U31 249 1 249 5 rr_5j0m 1 33 G32 257 1 257 5 rr_5j0m 1 34 G32 265 1 265 5 rr_5j0m 1 35 G33 273 1 273 5 rr_5j0m 1 36 G34 281 1 281 5 rr_5j0m 1 37 A35 289 1 289 5 rr_5j0m 1 38 A35 297 1 297 5 rr_5j0m 1 39 A35 305 1 305 5 rr_5j0m 1 40 G36 313 1 313 5 rr_5j0m 1 41 C37 321 1 321 5 rr_5j0m 1 42 C37 329 1 329 5 rr_5j0m 1 43 U38 337 1 337 5 rr_5j0m 1 44 U38 345 1 345 5 rr_5j0m 1 45 C39 353 1 353 5 rr_5j0m 1 46 C39 361 1 361 5 rr_5j0m 1 47 C39 369 1 369 5 rr_5j0m 1 48 U40 377 1 377 5 rr_5j0m 1 49 U40 385 1 385 5 rr_5j0m 1 50 C41 393 1 393 5 rr_5j0m 1 51 C41 401 1 401 5 rr_5j0m 1 52 U42 409 1 409 5 rr_5j0m 1 53 U42 417 1 417 5 rr_5j0m 1 54 U42 425 1 425 5 rr_5j0m 1 55 G43 433 1 433 5 rr_5j0m 1 56 C45 441 1 441 5 rr_5j0m 1 57 C45 449 1 449 5 rr_5j0m 1 58 C45 457 1 457 5 rr_5j0m 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_framecode MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID rr_5j0m _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details 'Generated by Wattos' _Org_constr_file_comment.Comment ; *HEADER VIRAL PROTEIN 28-MAR-16 5J0M *TITLE GROUND STATE SAMPLED DURING RDC RESTRAINED REPLICA-AVERAGED *TITLE 2 METADYNAMICS (RAM) SIMULATIONS OF THE HIV-1 TAR COMPLEXED WITH CYCLIC *TITLE 3 PEPTIDE MIMETIC OF TAT *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: CYCLIC PEPTIDE MIMETIC OF HIV-1 TAT; *COMPND 3 CHAIN: A; *COMPND 4 ENGINEERED: YES; *COMPND 5 MOL_ID: 2; *COMPND 6 MOLECULE: APICAL REGION (29-MER) OF THE HIV-1 TAR RNA ELEMENT; *COMPND 7 CHAIN: B; *COMPND 8 ENGINEERED: YES *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES; *SOURCE 3 ORGANISM_SCIENTIFIC: HUMAN IMMUNODEFICIENCY VIRUS 1; *SOURCE 4 ORGANISM_TAXID: 11676; *SOURCE 5 MOL_ID: 2; *SOURCE 6 ORGANISM_SCIENTIFIC: HUMAN IMMUNODEFICIENCY VIRUS 1; *SOURCE 7 ORGANISM_TAXID: 11676; *SOURCE 8 EXPRESSION_SYSTEM: IN VITRO TRANSCRIPTION VECTOR PT7-FLUC(DELTAI); *SOURCE 9 EXPRESSION_SYSTEM_TAXID: 905932 *KEYWDS TAR:TAT COMPLEX, RAM SIMULATIONS, RESIDUAL DIPOLAR COUPLINGS, GROUND *KEYWDS 2 STATE, VIRAL PROTEIN *EXPDTA SOLUTION NMR *NUMMDL 10 *AUTHOR A.N.BORKAR,M.F.BARDARO JR.,G.VARANI,M.VENDRUCOLO *REVDAT 1 08-JUN-16 5J0M 0 # Restraints file 1: TARpRAM_pf1.txt !RDC restraints used for generation of the TAR:Tat-peptide RAM ensemble !RDCs measured in aprox 12mg/ml phage !0.6 mM fully labeled sample, 10 mM K phosphate buffer !with 0.1 mM EDTA pH 6.6, Da/R -30 and 0.25 !Average experimental error 2.0 ; save_