*HEADER RNA 15-SEP-20 7K4L *TITLE DENGUE 5'UTR SLA *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: DENVSLA RNA; *COMPND 3 CHAIN: A; *COMPND 4 ENGINEERED: YES *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES; *SOURCE 3 ORGANISM_SCIENTIFIC: ESCHERICHIA PHAGE T7; *SOURCE 4 ORGANISM_TAXID: 10760 *KEYWDS DENV1, 5'-UTR, RNA, STRUCTURAL GENOMICS, SEATTLE STRUCTURAL GENOMICS *KEYWDS 2 CENTER FOR INFECTIOUS DISEASE, SSGCID *EXPDTA SOLUTION NMR *NUMMDL 10 *AUTHOR Y.T.SUN,G.VARANI,SEATTLE STRUCTURAL GENOMICS CENTER FOR INFECTIOUS *AUTHOR 2 DISEASE (SSGCID) *REVDAT 1 29-SEP-21 7K4L 0 # Restraints file 1: DenvSLA_dihedralSL.tbl ! ! Torsion angle restraints for sugar pucker in the ! - DENV 5’ UTR SLA ! Sequence GGAGUGGUUAGUCUACGUUUCGACGUAGUUCUAACC ! Helical G6 G7 U8 U9 A10 G11 C13 U14 A15 C16 G17 U18 ! C36 C35 A34 A33 U32 C31 G28 A27 U26 G25 C24 A23 ! ! ! Pucker is defined with ribose torsion angles nu1 and nu2. ! nu1 = O4'-C1'-C2'-C3' ! nu2 = C1'-C2'-C3'-C4' ! "N" C3' endo: ! nu1 = -20 +/- 10 ! nu2 = +35 +/- 5 ! "S" C2' endo: ! nu1 = +35 +/- 10 ! nu2 = -35 +/- 5 ! See Saenger page 20. ! ! C2' endo nucleotides (Judging from TOCSY): only if both H1'-H2' and ! H1'-H3' couplings both are strong (intensity of H1'-H3' even larger) ! Xhi is defined as follows... ! Purines = O4'-C1'-N9-C4 ! pyrimidine = O4'-C1'-N1-C2 ! Anti: ! Xhi = 180.0 +/- 90.0 ! including high-anti and excluding high-syn : ! Xhi = =-150 +/- 90.0 ! Syn: Xhi = 0.0 +/- 90.0 ! See Saenger page 22. ! U20 assign (resid 20 and name O4') (resid 20 and name C1') (resid 20 and name C2') (resid 20 and name C3') 1.0 35 10.0 2 assign (resid 20 and name C1') (resid 20 and name C2') (resid 20 and name C3') (resid 20 and name C4') 1.0 -35.0 5.0 2 assign (resid 20 and name c5') (resid 5 and name c4') (resid 20 and name c3') (resid 5 and name o3') 1.0 145.0 20.0 2 assign (resid 20 and name O4') (resid 5 and name C1') (resid 20 and name N1 ) (resid 5 and name C2 ) 1.0 -150.0 90.0 2 ! C21 assign (resid 21 and name O4') (resid 21 and name C1') (resid 21 and name C2') (resid 21 and name C3') 1.0 35 10.0 2 assign (resid 21 and name C1') (resid 21 and name C2') (resid 21 and name C3') (resid 21 and name C4') 1.0 -35.0 5.0 2 assign (resid 21 and name c5') (resid 5 and name c4') (resid 21 and name c3') (resid 5 and name o3') 1.0 145.0 20.0 2 assign (resid 21 and name O4') (resid 5 and name C1') (resid 21 and name N1 ) (resid 5 and name C2 ) 1.0 -150.0 90.0 2 !3' endo! ! G6 assign (resid 6 and name O4') (resid 6 and name C1') (resid 6 and name C2') (resid 6 and name C3') 1.0 -20.0 10.0 2 assign (resid 6 and name C1') (resid 6 and name C2') (resid 6 and name C3') (resid 6 and name C4') 1.0 35.0 5.0 2 assign (resid 6 and name c5') (resid 6 and name c4') (resid 6 and name c3') (resid 6 and name o3') 1.0 80.0 25.0 2 assign (resid 6 and name O4') (resid 6 and name C1') (resid 6 and name N9 ) (resid 6 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 5 and name O3') (resid 6 and name P ) (resid 6 and name O5') (resid 6 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 6 and name P ) (resid 6 and name O5') (resid 6 and name C5') (resid 6 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 6 and name O5') (resid 6 and name C5') (resid 6 and name C4') (resid 6 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 6 and name C4') (resid 6 and name C3') (resid 6 and name O3') (resid 7 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 6 and name C3') (resid 6 and name O3') (resid 7 and name P ) (resid 7 and name O5') 1.0 -70.0 50.0 2 ! G7 assign (resid 7 and name O4') (resid 7 and name C1') (resid 7 and name C2') (resid 7 and name C3') 1.0 -20.0 10.0 2 assign (resid 7 and name C1') (resid 7 and name C2') (resid 7 and name C3') (resid 7 and name C4') 1.0 35.0 5.0 2 assign (resid 7 and name c5') (resid 7 and name c4') (resid 7 and name c3') (resid 7 and name o3') 1.0 80.0 25.0 2 assign (resid 7 and name O4') (resid 7 and name C1') (resid 7 and name N9 ) (resid 7 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 6 and name O3') (resid 7 and name P ) (resid 7 and name O5') (resid 7 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 7 and name P ) (resid 7 and name O5') (resid 7 and name C5') (resid 7 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 7 and name O5') (resid 7 and name C5') (resid 7 and name C4') (resid 7 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 7 and name C4') (resid 7 and name C3') (resid 7 and name O3') (resid 8 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 7 and name C3') (resid 7 and name O3') (resid 8 and name P ) (resid 8 and name O5') 1.0 -70.0 50.0 2 ! U8 assign (resid 8 and name O4') (resid 8 and name C1') (resid 8 and name C2') (resid 8 and name C3') 1.0 -20.0 10.0 2 assign (resid 8 and name C1') (resid 8 and name C2') (resid 8 and name C3') (resid 8 and name C4') 1.0 35.0 5.0 2 assign (resid 8 and name c5') (resid 8 and name c4') (resid 8 and name c3') (resid 8 and name o3') 1.0 80.0 25.0 2 assign (resid 8 and name O4') (resid 8 and name C1') (resid 8 and name N1 ) (resid 8 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 7 and name O3') (resid 8 and name P ) (resid 8 and name O5') (resid 8 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 8 and name P ) (resid 8 and name O5') (resid 8 and name C5') (resid 8 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 8 and name O5') (resid 8 and name C5') (resid 8 and name C4') (resid 8 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 8 and name C4') (resid 8 and name C3') (resid 8 and name O3') (resid 9 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 8 and name C3') (resid 8 and name O3') (resid 9 and name P ) (resid 9 and name O5') 1.0 -70.0 50.0 2 ! U9 assign (resid 9 and name O4') (resid 9 and name C1') (resid 9 and name C2') (resid 9 and name C3') 1.0 -20.0 10.0 2 assign (resid 9 and name C1') (resid 9 and name C2') (resid 9 and name C3') (resid 9 and name C4') 1.0 35.0 5.0 2 assign (resid 9 and name c5') (resid 9 and name c4') (resid 9 and name c3') (resid 9 and name o3') 1.0 80.0 25.0 2 assign (resid 9 and name O4') (resid 9 and name C1') (resid 9 and name N1 ) (resid 9 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 8 and name O3') (resid 9 and name P ) (resid 9 and name O5') (resid 9 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 9 and name P ) (resid 9 and name O5') (resid 9 and name C5') (resid 9 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 9 and name O5') (resid 9 and name C5') (resid 9 and name C4') (resid 9 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 9 and name C4') (resid 9 and name C3') (resid 9 and name O3') (resid 10 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 9 and name C3') (resid 9 and name O3') (resid 10 and name P ) (resid 10 and name O5') 1.0 -70.0 50.0 2 ! A10 assign (resid 10 and name O4') (resid 10 and name C1') (resid 10 and name C2') (resid 10 and name C3') 1.0 -20.0 10.0 2 assign (resid 10 and name C1') (resid 10 and name C2') (resid 10 and name C3') (resid 10 and name C4') 1.0 35.0 5.0 2 assign (resid 10 and name c5') (resid 10 and name c4') (resid 10 and name c3') (resid 10 and name o3') 1.0 80.0 25.0 2 assign (resid 10 and name O4') (resid 10 and name C1') (resid 10 and name N9 ) (resid 10 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 9 and name O3') (resid 10 and name P ) (resid 10 and name O5') (resid 10 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 10 and name P ) (resid 10 and name O5') (resid 10 and name C5') (resid 10 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 10 and name O5') (resid 10 and name C5') (resid 10 and name C4') (resid 10 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 10 and name C4') (resid 10 and name C3') (resid 10 and name O3') (resid 11 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 10 and name C3') (resid 10 and name O3') (resid 11 and name P ) (resid 11 and name O5') 1.0 -70.0 50.0 2 ! G11 assign (resid 11 and name O4') (resid 11 and name C1') (resid 11 and name C2') (resid 11 and name C3') 1.0 -20.0 10.0 2 assign (resid 11 and name C1') (resid 11 and name C2') (resid 11 and name C3') (resid 11 and name C4') 1.0 35.0 5.0 2 assign (resid 11 and name c5') (resid 11 and name c4') (resid 11 and name c3') (resid 11 and name o3') 1.0 80.0 25.0 2 assign (resid 11 and name O4') (resid 11 and name C1') (resid 11 and name N9 ) (resid 11 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 10 and name O3') (resid 11 and name P ) (resid 11 and name O5') (resid 11 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 11 and name P ) (resid 11 and name O5') (resid 11 and name C5') (resid 11 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 11 and name O5') (resid 11 and name C5') (resid 11 and name C4') (resid 11 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 11 and name C4') (resid 11 and name C3') (resid 11 and name O3') (resid 12 and name P ) 1.0 -160.0 50.0 2 ! C13 assign (resid 13 and name O4') (resid 13 and name C1') (resid 13 and name C2') (resid 13 and name C3') 1.0 -20.0 10.0 2 assign (resid 13 and name C1') (resid 13 and name C2') (resid 13 and name C3') (resid 13 and name C4') 1.0 35.0 5.0 2 assign (resid 13 and name c5') (resid 13 and name c4') (resid 13 and name c3') (resid 13 and name o3') 1.0 80.0 25.0 2 assign (resid 13 and name O4') (resid 13 and name C1') (resid 13 and name N1 ) (resid 13 and name C2 ) 1.0 -150.0 90.0 2 !backbone beta assign (resid 13 and name P ) (resid 13 and name O5') (resid 13 and name C5') (resid 13 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 13 and name O5') (resid 13 and name C5') (resid 13 and name C4') (resid 13 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 13 and name C4') (resid 13 and name C3') (resid 13 and name O3') (resid 14 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 13 and name C3') (resid 13 and name O3') (resid 14 and name P ) (resid 14 and name O5') 1.0 -70.0 50.0 2 ! U14 assign (resid 14 and name O4') (resid 14 and name C1') (resid 14 and name C2') (resid 14 and name C3') 1.0 -20.0 10.0 2 assign (resid 14 and name C1') (resid 14 and name C2') (resid 14 and name C3') (resid 14 and name C4') 1.0 35.0 5.0 2 assign (resid 14 and name c5') (resid 14 and name c4') (resid 14 and name c3') (resid 14 and name o3') 1.0 80.0 25.0 2 assign (resid 14 and name O4') (resid 14 and name C1') (resid 14 and name N1 ) (resid 14 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 13 and name O3') (resid 14 and name P ) (resid 14 and name O5') (resid 14 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 14 and name P ) (resid 14 and name O5') (resid 14 and name C5') (resid 14 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 14 and name O5') (resid 14 and name C5') (resid 14 and name C4') (resid 14 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 14 and name C4') (resid 14 and name C3') (resid 14 and name O3') (resid 15 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 14 and name C3') (resid 14 and name O3') (resid 15 and name P ) (resid 15 and name O5') 1.0 -70.0 50.0 2 ! A15 assign (resid 15 and name O4') (resid 15 and name C1') (resid 15 and name C2') (resid 15 and name C3') 1.0 -20.0 10.0 2 assign (resid 15 and name C1') (resid 15 and name C2') (resid 15 and name C3') (resid 15 and name C4') 1.0 35.0 5.0 2 assign (resid 15 and name c5') (resid 15 and name c4') (resid 15 and name c3') (resid 15 and name o3') 1.0 80.0 25.0 2 assign (resid 15 and name O4') (resid 15 and name C1') (resid 15 and name N9 ) (resid 15 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 14 and name O3') (resid 15 and name P ) (resid 15 and name O5') (resid 15 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 15 and name P ) (resid 15 and name O5') (resid 15 and name C5') (resid 15 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 15 and name O5') (resid 15 and name C5') (resid 15 and name C4') (resid 15 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 15 and name C4') (resid 15 and name C3') (resid 15 and name O3') (resid 16 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 15 and name C3') (resid 15 and name O3') (resid 16 and name P ) (resid 16 and name O5') 1.0 -70.0 50.0 2 ! C16 assign (resid 16 and name O4') (resid 16 and name C1') (resid 16 and name C2') (resid 16 and name C3') 1.0 -20.0 10.0 2 assign (resid 16 and name C1') (resid 16 and name C2') (resid 16 and name C3') (resid 16 and name C4') 1.0 35.0 5.0 2 assign (resid 16 and name c5') (resid 16 and name c4') (resid 16 and name c3') (resid 16 and name o3') 1.0 80.0 25.0 2 assign (resid 16 and name O4') (resid 16 and name C1') (resid 16 and name N1 ) (resid 16 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 15 and name O3') (resid 16 and name P ) (resid 16 and name O5') (resid 16 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 16 and name P ) (resid 16 and name O5') (resid 16 and name C5') (resid 16 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 16 and name O5') (resid 16 and name C5') (resid 16 and name C4') (resid 16 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 16 and name C4') (resid 16 and name C3') (resid 16 and name O3') (resid 17 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 16 and name C3') (resid 16 and name O3') (resid 17 and name P ) (resid 17 and name O5') 1.0 -70.0 50.0 2 ! G17 assign (resid 17 and name O4') (resid 17 and name C1') (resid 17 and name C2') (resid 17 and name C3') 1.0 -20.0 10.0 2 assign (resid 17 and name C1') (resid 17 and name C2') (resid 17 and name C3') (resid 17 and name C4') 1.0 35.0 5.0 2 assign (resid 17 and name c5') (resid 17 and name c4') (resid 17 and name c3') (resid 17 and name o3') 1.0 80.0 25.0 2 assign (resid 17 and name O4') (resid 17 and name C1') (resid 17 and name N9 ) (resid 17 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 16 and name O3') (resid 17 and name P ) (resid 17 and name O5') (resid 17 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 17 and name P ) (resid 17 and name O5') (resid 17 and name C5') (resid 17 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 17 and name O5') (resid 17 and name C5') (resid 17 and name C4') (resid 17 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 17 and name C4') (resid 17 and name C3') (resid 17 and name O3') (resid 18 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 17 and name C3') (resid 17 and name O3') (resid 18 and name P ) (resid 18 and name O5') 1.0 -70.0 50.0 2 ! U18 assign (resid 18 and name O4') (resid 18 and name C1') (resid 18 and name C2') (resid 18 and name C3') 1.0 -20.0 10.0 2 assign (resid 18 and name C1') (resid 18 and name C2') (resid 18 and name C3') (resid 18 and name C4') 1.0 35.0 5.0 2 assign (resid 18 and name c5') (resid 18 and name c4') (resid 18 and name c3') (resid 18 and name o3') 1.0 80.0 25.0 2 assign (resid 18 and name O4') (resid 18 and name C1') (resid 18 and name N1 ) (resid 18 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 17 and name O3') (resid 18 and name P ) (resid 18 and name O5') (resid 18 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 18 and name P ) (resid 18 and name O5') (resid 18 and name C5') (resid 18 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 18 and name O5') (resid 18 and name C5') (resid 18 and name C4') (resid 18 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 18 and name C4') (resid 18 and name C3') (resid 18 and name O3') (resid 19 and name P ) 1.0 -160.0 50.0 2 ! A23 assign (resid 23 and name O4') (resid 23 and name C1') (resid 23 and name C2') (resid 23 and name C3') 1.0 -20.0 10.0 2 assign (resid 23 and name C1') (resid 23 and name C2') (resid 23 and name C3') (resid 23 and name C4') 1.0 35.0 5.0 2 assign (resid 23 and name c5') (resid 23 and name c4') (resid 23 and name c3') (resid 23 and name o3') 1.0 80.0 25.0 2 assign (resid 23 and name O4') (resid 23 and name C1') (resid 23 and name N9 ) (resid 23 and name C4 ) 1.0 -150.0 90.0 2 !backbone beta assign (resid 23 and name P ) (resid 23 and name O5') (resid 23 and name C5') (resid 23 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 23 and name O5') (resid 23 and name C5') (resid 23 and name C4') (resid 23 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 23 and name C4') (resid 23 and name C3') (resid 23 and name O3') (resid 24 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 23 and name C3') (resid 23 and name O3') (resid 24 and name P ) (resid 24 and name O5') 1.0 -70.0 50.0 2 ! C24 assign (resid 24 and name O4') (resid 24 and name C1') (resid 24 and name C2') (resid 24 and name C3') 1.0 -20.0 10.0 2 assign (resid 24 and name C1') (resid 24 and name C2') (resid 24 and name C3') (resid 24 and name C4') 1.0 35.0 5.0 2 assign (resid 24 and name c5') (resid 24 and name c4') (resid 24 and name c3') (resid 24 and name o3') 1.0 80.0 25.0 2 assign (resid 24 and name O4') (resid 24 and name C1') (resid 24 and name N1 ) (resid 24 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 23 and name O3') (resid 24 and name P ) (resid 24 and name O5') (resid 24 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 24 and name P ) (resid 24 and name O5') (resid 24 and name C5') (resid 24 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 24 and name O5') (resid 24 and name C5') (resid 24 and name C4') (resid 24 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 24 and name C4') (resid 24 and name C3') (resid 24 and name O3') (resid 25 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 24 and name C3') (resid 24 and name O3') (resid 25 and name P ) (resid 25 and name O5') 1.0 -70.0 50.0 2 ! G25 assign (resid 25 and name O4') (resid 25 and name C1') (resid 25 and name C2') (resid 25 and name C3') 1.0 -20.0 10.0 2 assign (resid 25 and name C1') (resid 25 and name C2') (resid 25 and name C3') (resid 25 and name C4') 1.0 35.0 5.0 2 assign (resid 25 and name c5') (resid 25 and name c4') (resid 25 and name c3') (resid 25 and name o3') 1.0 80.0 25.0 2 assign (resid 25 and name O4') (resid 25 and name C1') (resid 25 and name N9 ) (resid 25 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 24 and name O3') (resid 25 and name P ) (resid 25 and name O5') (resid 25 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 25 and name P ) (resid 25 and name O5') (resid 25 and name C5') (resid 25 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 25 and name O5') (resid 25 and name C5') (resid 25 and name C4') (resid 25 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 25 and name C4') (resid 25 and name C3') (resid 25 and name O3') (resid 26 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 25 and name C3') (resid 25 and name O3') (resid 26 and name P ) (resid 26 and name O5') 1.0 -70.0 50.0 2 ! U26 assign (resid 26 and name O4') (resid 26 and name C1') (resid 26 and name C2') (resid 26 and name C3') 1.0 -20.0 10.0 2 assign (resid 26 and name C1') (resid 26 and name C2') (resid 26 and name C3') (resid 26 and name C4') 1.0 35.0 5.0 2 assign (resid 26 and name c5') (resid 26 and name c4') (resid 26 and name c3') (resid 26 and name o3') 1.0 80.0 25.0 2 assign (resid 26 and name O4') (resid 26 and name C1') (resid 26 and name N1 ) (resid 26 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 25 and name O3') (resid 26 and name P ) (resid 26 and name O5') (resid 26 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 26 and name P ) (resid 26 and name O5') (resid 26 and name C5') (resid 26 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 26 and name O5') (resid 26 and name C5') (resid 26 and name C4') (resid 26 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 26 and name C4') (resid 26 and name C3') (resid 26 and name O3') (resid 27 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 26 and name C3') (resid 26 and name O3') (resid 27 and name P ) (resid 27 and name O5') 1.0 -70.0 50.0 2 ! A27 assign (resid 27 and name O4') (resid 27 and name C1') (resid 27 and name C2') (resid 27 and name C3') 1.0 -20.0 10.0 2 assign (resid 27 and name C1') (resid 27 and name C2') (resid 27 and name C3') (resid 27 and name C4') 1.0 35.0 5.0 2 assign (resid 27 and name c5') (resid 27 and name c4') (resid 27 and name c3') (resid 27 and name o3') 1.0 80.0 25.0 2 assign (resid 27 and name O4') (resid 27 and name C1') (resid 27 and name N9 ) (resid 27 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 26 and name O3') (resid 27 and name P ) (resid 27 and name O5') (resid 27 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 27 and name P ) (resid 27 and name O5') (resid 27 and name C5') (resid 27 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 27 and name O5') (resid 27 and name C5') (resid 27 and name C4') (resid 27 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 27 and name C4') (resid 27 and name C3') (resid 27 and name O3') (resid 28 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 27 and name C3') (resid 27 and name O3') (resid 28 and name P ) (resid 28 and name O5') 1.0 -70.0 50.0 2 ! G28 assign (resid 28 and name O4') (resid 28 and name C1') (resid 28 and name C2') (resid 28 and name C3') 1.0 -20.0 10.0 2 assign (resid 28 and name C1') (resid 28 and name C2') (resid 28 and name C3') (resid 28 and name C4') 1.0 35.0 5.0 2 assign (resid 28 and name c5') (resid 28 and name c4') (resid 28 and name c3') (resid 28 and name o3') 1.0 80.0 25.0 2 assign (resid 28 and name O4') (resid 28 and name C1') (resid 28 and name N9 ) (resid 28 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 27 and name O3') (resid 28 and name P ) (resid 28 and name O5') (resid 28 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 28 and name P ) (resid 28 and name O5') (resid 28 and name C5') (resid 28 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 28 and name O5') (resid 28 and name C5') (resid 28 and name C4') (resid 28 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 28 and name C4') (resid 28 and name C3') (resid 28 and name O3') (resid 29 and name P ) 1.0 -160.0 50.0 2 ! C31 assign (resid 31 and name O4') (resid 31 and name C1') (resid 31 and name C2') (resid 31 and name C3') 1.0 -20.0 10.0 2 assign (resid 31 and name C1') (resid 31 and name C2') (resid 31 and name C3') (resid 31 and name C4') 1.0 35.0 5.0 2 assign (resid 31 and name c5') (resid 31 and name c4') (resid 31 and name c3') (resid 31 and name o3') 1.0 80.0 25.0 2 assign (resid 31 and name O4') (resid 31 and name C1') (resid 31 and name N1 ) (resid 31 and name C2 ) 1.0 -150.0 90.0 2 !backbone beta assign (resid 31 and name P ) (resid 31 and name O5') (resid 31 and name C5') (resid 31 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 31 and name O5') (resid 31 and name C5') (resid 31 and name C4') (resid 31 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 31 and name C4') (resid 31 and name C3') (resid 31 and name O3') (resid 32 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 31 and name C3') (resid 31 and name O3') (resid 32 and name P ) (resid 32 and name O5') 1.0 -70.0 50.0 2 ! U32 assign (resid 32 and name O4') (resid 32 and name C1') (resid 32 and name C2') (resid 32 and name C3') 1.0 -20.0 10.0 2 assign (resid 32 and name C1') (resid 32 and name C2') (resid 32 and name C3') (resid 32 and name C4') 1.0 35.0 5.0 2 assign (resid 32 and name c5') (resid 32 and name c4') (resid 32 and name c3') (resid 32 and name o3') 1.0 80.0 25.0 2 assign (resid 32 and name O4') (resid 32 and name C1') (resid 32 and name N1 ) (resid 32 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 31 and name O3') (resid 32 and name P ) (resid 32 and name O5') (resid 32 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 32 and name P ) (resid 32 and name O5') (resid 32 and name C5') (resid 32 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 32 and name O5') (resid 32 and name C5') (resid 32 and name C4') (resid 32 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 32 and name C4') (resid 32 and name C3') (resid 32 and name O3') (resid 33 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 32 and name C3') (resid 32 and name O3') (resid 33 and name P ) (resid 33 and name O5') 1.0 -70.0 50.0 2 ! A33 assign (resid 33 and name O4') (resid 33 and name C1') (resid 33 and name C2') (resid 33 and name C3') 1.0 -20.0 10.0 2 assign (resid 33 and name C1') (resid 33 and name C2') (resid 33 and name C3') (resid 33 and name C4') 1.0 35.0 5.0 2 assign (resid 33 and name c5') (resid 33 and name c4') (resid 33 and name c3') (resid 33 and name o3') 1.0 80.0 25.0 2 assign (resid 33 and name O4') (resid 33 and name C1') (resid 33 and name N9 ) (resid 33 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 32 and name O3') (resid 33 and name P ) (resid 33 and name O5') (resid 33 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 33 and name P ) (resid 33 and name O5') (resid 33 and name C5') (resid 33 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 33 and name O5') (resid 33 and name C5') (resid 33 and name C4') (resid 33 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 33 and name C4') (resid 33 and name C3') (resid 33 and name O3') (resid 34 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 33 and name C3') (resid 33 and name O3') (resid 34 and name P ) (resid 34 and name O5') 1.0 -70.0 50.0 2 ! A34 assign (resid 34 and name O4') (resid 34 and name C1') (resid 34 and name C2') (resid 34 and name C3') 1.0 -20.0 10.0 2 assign (resid 34 and name C1') (resid 34 and name C2') (resid 34 and name C3') (resid 34 and name C4') 1.0 35.0 5.0 2 assign (resid 34 and name c5') (resid 34 and name c4') (resid 34 and name c3') (resid 34 and name o3') 1.0 80.0 25.0 2 assign (resid 34 and name O4') (resid 34 and name C1') (resid 34 and name N9 ) (resid 34 and name C4 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 33 and name O3') (resid 34 and name P ) (resid 34 and name O5') (resid 34 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 34 and name P ) (resid 34 and name O5') (resid 34 and name C5') (resid 34 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 34 and name O5') (resid 34 and name C5') (resid 34 and name C4') (resid 34 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 34 and name C4') (resid 34 and name C3') (resid 34 and name O3') (resid 35 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 34 and name C3') (resid 34 and name O3') (resid 35 and name P ) (resid 35 and name O5') 1.0 -70.0 50.0 2 ! C35 assign (resid 35 and name O4') (resid 35 and name C1') (resid 35 and name C2') (resid 35 and name C3') 1.0 -20.0 10.0 2 assign (resid 35 and name C1') (resid 35 and name C2') (resid 35 and name C3') (resid 35 and name C4') 1.0 35.0 5.0 2 assign (resid 35 and name c5') (resid 35 and name c4') (resid 35 and name c3') (resid 35 and name o3') 1.0 80.0 25.0 2 assign (resid 35 and name O4') (resid 35 and name C1') (resid 35 and name N1 ) (resid 35 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 34 and name O3') (resid 35 and name P ) (resid 35 and name O5') (resid 35 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 35 and name P ) (resid 35 and name O5') (resid 35 and name C5') (resid 35 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 35 and name O5') (resid 35 and name C5') (resid 35 and name C4') (resid 35 and name C3') 1.0 60.0 40.0 2 !backbone epsilon assign (resid 35 and name C4') (resid 35 and name C3') (resid 35 and name O3') (resid 36 and name P ) 1.0 -160.0 50.0 2 !backbone zeta assign (resid 35 and name C3') (resid 35 and name O3') (resid 36 and name P ) (resid 36 and name O5') 1.0 -70.0 50.0 2 ! C36 assign (resid 36 and name O4') (resid 36 and name C1') (resid 36 and name C2') (resid 36 and name C3') 1.0 -20.0 10.0 2 assign (resid 36 and name C1') (resid 36 and name C2') (resid 36 and name C3') (resid 36 and name C4') 1.0 35.0 5.0 2 assign (resid 36 and name c5') (resid 36 and name c4') (resid 36 and name c3') (resid 36 and name o3') 1.0 80.0 25.0 2 assign (resid 36 and name O4') (resid 36 and name C1') (resid 36 and name N1 ) (resid 36 and name C2 ) 1.0 -150.0 90.0 2 !backbone alpha assign (resid 35 and name O3') (resid 36 and name P ) (resid 36 and name O5') (resid 36 and name C5') 1.0 -60.0 40.0 2 !backbone beta assign (resid 36 and name P ) (resid 36 and name O5') (resid 36 and name C5') (resid 36 and name C4') 1.0 180.0 50.0 2 !backbone gama assign (resid 36 and name O5') (resid 36 and name C5') (resid 36 and name C4') (resid 36 and name C3') 1.0 60.0 40.0 2 # Restraints file 2: DenvSLA_planeSL.inp !Planarity restraints ! - DENV 5’ UTR SLA ! Sequence GGAGUGGUUAGUCUACGUUUCGACGUAGUUCUAACC ! Helical G6 G7 U8 U9 A10 G11 C13 U14 A15 C16 G17 U18 ! C36 C35 A34 A33 U32 C31 G28 A27 U26 G25 C24 A23 ! G6-C36 WC !-------------------------------------------------------------------- group select= ((resid 6 and (name N1 or name C6 or name C2)) or (resid 36 and (name N3))) weight=80 end group select= ((resid 6 and (name N1)) or (resid 36 and (name N3 or name C2 or name C4))) weight=80 end ! G7-C35 WC !-------------------------------------------------------------------- group select= ((resid 7 and (name N1 or name C6 or name C2)) or (resid 35 and (name N3))) weight=80 end group select= ((resid 7 and (name N1)) or (resid 35 and (name N3 or name C2 or name C4))) weight=80 end ! A34-U8 WC !-------------------------------------------------------------------- group select= ((resid 34 and (name N1 or name C2 or name C6)) or (resid 8 and (name N3))) weight=80 end group select= ((resid 34 and (name N1)) or (resid 8 and (name N3 or name C2 or name C4))) weight=80 end ! A33-U9 WC !-------------------------------------------------------------------- group select= ((resid 33 and (name N1 or name C2 or name C6)) or (resid 9 and (name N3))) weight=80 end group select= ((resid 33 and (name N1)) or (resid 9 and (name N3 or name C2 or name C4))) weight=80 end ! A10-U32 WC !-------------------------------------------------------------------- group select= ((resid 10 and (name N1 or name C2 or name C6)) or (resid 32 and (name N3))) weight=80 end group select= ((resid 10 and (name N1)) or (resid 32 and (name N3 or name C2 or name C4))) weight=80 end ! G11-C31 WC !-------------------------------------------------------------------- group select= ((resid 11 and (name N1 or name C6 or name C2)) or (resid 31 and (name N3))) weight=80 end group select= ((resid 11 and (name N1)) or (resid 31 and (name N3 or name C2 or name C4))) weight=80 end ! G28-C13 WC !-------------------------------------------------------------------- group select= ((resid 28 and (name N1 or name C6 or name C2)) or (resid 13 and (name N3))) weight=80 end group select= ((resid 28 and (name N1)) or (resid 13 and (name N3 or name C2 or name C4))) weight=80 end ! A27-U14 WC !-------------------------------------------------------------------- group select= ((resid 27 and (name N1 or name C2 or name C6)) or (resid 14 and (name N3))) weight=80 end group select= ((resid 27 and (name N1)) or (resid 14 and (name N3 or name C2 or name C4))) weight=80 end ! A15-U26 WC !-------------------------------------------------------------------- group select= ((resid 15 and (name N1 or name C2 or name C6)) or (resid 26 and (name N3))) weight=80 end group select= ((resid 15 and (name N1)) or (resid 26 and (name N3 or name C2 or name C4))) weight=80 end ! G25-C16 WC !-------------------------------------------------------------------- group select= ((resid 25 and (name N1 or name C6 or name C2)) or (resid 16 and (name N3))) weight=80 end group select= ((resid 25 and (name N1)) or (resid 16 and (name N3 or name C2 or name C4))) weight=80 end ! G17-C24 WC !-------------------------------------------------------------------- group select= ((resid 17 and (name N1 or name C6 or name C2)) or (resid 24 and (name N3))) weight=80 end group select= ((resid 17 and (name N1)) or (resid 24 and (name N3 or name C2 or name C4))) weight=80 end ! A23-U18 WC !-------------------------------------------------------------------- group select= ((resid 23 and (name N1 or name C2 or name C6)) or (resid 18 and (name N3))) weight=80 end group select= ((resid 23 and (name N1)) or (resid 18 and (name N3 or name C2 or name C4))) weight=80 end # Restraints file 3: DenvSLA_noe.tbl !!Cross-strand base pair (H2O NOESY) !U-A assign (residue 8 and name H3) (residue 34 and name H2) 2.5 0.7 0.7 assign (residue 9 and name H3) (residue 33 and name H2) 2.5 0.7 0.7 assign (residue 32 and name H3) (residue 10 and name H2) 2.5 0.7 0.7 assign (residue 14 and name H3) (residue 27 and name H2) 2.5 0.7 0.7 assign (residue 26 and name H3) (residue 15 and name H2) 2.5 0.7 0.7 assign (residue 18 and name H3) (residue 23 and name H2) 2.5 0.7 0.7 !G-C assign (residue 11 and name H1) (residue 31 and name H41) 2.5 0.7 0.7 assign (residue 28 and name H1) (residue 13 and name H41) 2.5 0.7 0.7 assign (residue 25 and name H1) (residue 16 and name H41) 2.5 0.7 0.7 assign (residue 17 and name H1) (residue 24 and name H41) 2.5 0.7 0.7 !!set constraint !base pair assign (residue 11 and name H1) (residue 31 and name N3) 2.0 0.5 0.5 assign (residue 32 and name H3) (residue 10 and name N1) 2.0 0.5 0.5 assign (residue 9 and name H3) (residue 33 and name N1) 2.0 0.5 0.5 assign (residue 8 and name H3) (residue 34 and name N1) 2.0 0.5 0.5 assign (residue 7 and name H1) (residue 35 and name N3) 2.0 0.5 0.5 assign (residue 6 and name H1) (residue 36 and name N3) 2.0 0.5 0.5 assign (residue 7 and name H1) (residue 35 and name H41) 2.5 0.7 0.7 assign (residue 6 and name H1) (residue 36 and name H41) 2.5 0.7 0.7 !UUCG tatra loop (U-G base pair) assign (residue 19 and name O2) (residue 22 and name H1) 2.0 0.5 0.5 assign (residue 19 and name H2') (residue 22 and name O6) 2.0 0.5 0.5 !!---------------------------------------------------------------------!! !!D2O NOESY !U5 assign (residue 5 and name H1') (residue 5 and name H6) 4.5 1.5 1.5 assign (residue 5 and name H2'') (residue 5 and name H1') 2.5 0.7 0.7 assign (residue 5 and name H2'') (residue 5 and name H6) 4.5 1.5 1.5 assign (residue 5 and name H2'') (residue 6 and name H8) 4.5 1.5 1.5 assign (residue 5 and name H5) (residue 5 and name H6) 2.5 0.7 0.7 assign (residue 5 and name H6) (residue 5 and name H1') 4.5 1.5 1.5 assign (residue 5 and name H6) (residue 5 and name H2'') 4.5 1.5 1.5 assign (residue 5 and name H6) (residue 5 and name H5) 2.5 0.7 0.7 !G6 assign (residue 6 and name H1') (residue 6 and name H8) 4.5 1.5 1.5 assign (residue 6 and name H1') (residue 7 and name H8) 4.5 1.5 1.5 assign (residue 6 and name H2'') (residue 6 and name H1') 2.5 0.7 0.7 assign (residue 6 and name H2'') (residue 6 and name H8) 3.5 1.2 1.2 assign (residue 6 and name H2'') (residue 7 and name H1') 4.5 1.5 1.5 assign (residue 6 and name H2'') (residue 7 and name H8) 2.5 0.7 0.7 assign (residue 6 and name H8) (residue 5 and name H1') 4.5 1.5 1.5 assign (residue 6 and name H8) (residue 6 and name H1') 3.5 1.2 1.2 !G7 assign (residue 7 and name H1') (residue 7 and name H8) 4.5 1.5 1.5 assign (residue 7 and name H2'') (residue 7 and name H1') 2.5 0.7 0.7 assign (residue 7 and name H2'') (residue 7 and name H1') 3.5 1.2 1.2 assign (residue 7 and name H2'') (residue 8 and name H6) 3.5 1.2 1.2 assign (residue 7 and name H8) (residue 6 and name H1') 4.5 1.5 1.5 assign (residue 7 and name H8) (residue 7 and name H1') 4.5 1.5 1.5 assign (residue 7 and name H8) (residue 6 and name H8) 4.5 1.5 1.5 !U8 assign (residue 8 and name H2'') (residue 8 and name H1') 2.5 0.7 0.7 assign (residue 8 and name H2'') (residue 9 and name H6) 3.5 1.2 1.2 assign (residue 8 and name H5) (residue 8 and name H6) 3.5 1.2 1.2 assign (residue 8 and name H5) (residue 9 and name H5) 4.5 1.5 1.5 assign (residue 8 and name H5) (residue 7 and name H1') 4.5 1.5 1.5 assign (residue 8 and name H6) (residue 8 and name H1') 4.5 1.5 1.5 assign (residue 8 and name H6) (residue 8 and name H5) 3.5 1.2 1.2 !U9 assign (residue 9 and name H1') (residue 10 and name H8) 4.5 1.5 1.5 !assign (residue 9 and name H1') (residue 36 and name H6) 3.5 1.2 1.2 assign (residue 9 and name H2'') (residue 10 and name H8) 2.5 0.7 0.7 assign (residue 9 and name H2'') (residue 9 and name H1') 3.5 1.2 1.2 assign (residue 9 and name H5) (residue 9 and name H6) 3.5 1.2 1.2 assign (residue 9 and name H6) (residue 9 and name H5) 3.5 1.2 1.2 assign (residue 9 and name H6) (residue 10 and name H8) 4.5 1.5 1.5 !A10 assign (residue 10 and name H1') (residue 10 and name H8) 4.5 1.5 1.5 assign (residue 10 and name H1') (residue 11 and name H8) 4.5 1.5 1.5 assign (residue 10 and name H2'') (residue 10 and name H1') 2.5 0.7 0.7 assign (residue 10 and name H2'') (residue 10 and name H8) 4.5 1.5 1.5 assign (residue 10 and name H2'') (residue 11 and name H1') 4.5 1.5 1.5 assign (residue 10 and name H2'') (residue 11 and name H8) 2.5 0.7 0.7 assign (residue 10 and name H8) (residue 10 and name H1') 4.5 1.5 1.5 assign (residue 10 and name H8) (residue 9 and name H1') 4.5 1.5 1.5 assign (residue 10 and name H8) (residue 9 and name H2'') 2.5 0.7 0.7 !G11 assign (residue 11 and name H1') (residue 11 and name H8) 4.5 1.5 1.5 !assign (residue 11 and name H1') (residue 29 and name H6) 3.5 1.2 1.2 assign (residue 11 and name H2'') (residue 12 and name H6) 3.5 1.2 1.2 assign (residue 11 and name H2'') (residue 11 and name H8) 3.5 1.2 1.2 assign (residue 11 and name H8) (residue 10 and name H1') 4.5 1.5 1.5 assign (residue 11 and name H8) (residue 11 and name H1') 4.5 1.5 1.5 assign (residue 11 and name H8) (residue 12 and name H6) 4.5 1.5 1.5 assign (residue 11 and name H8) (residue 10 and name H8) 4.5 1.5 1.5 assign (residue 11 and name H8) (residue 12 and name H5) 4.5 1.5 1.5 !U12 assign (residue 12 and name H1') (residue 12 and name H2'') 3.5 1.2 1.2 assign (residue 12 and name H1') (residue 12 and name H6) 4.5 1.5 1.5 assign (residue 12 and name H1') (residue 12 and name H3') 3.5 1.2 1.2 assign (residue 12 and name H2'') (residue 12 and name H1') 2.5 0.7 0.7 assign (residue 12 and name H2'') (residue 13 and name H6) 2.5 0.7 0.7 assign (residue 12 and name H2'') (residue 13 and name H5) 3.5 1.2 1.2 assign (residue 12 and name H3') (residue 12 and name H6) 3.5 1.2 1.2 assign (residue 12 and name H3') (residue 13 and name H5) 3.5 1.2 1.2 assign (residue 12 and name H4') (residue 12 and name H1') 3.5 1.2 1.2 assign (residue 12 and name H5) (residue 11 and name H8) 4.5 1.5 1.5 assign (residue 12 and name H5) (residue 12 and name H6) 3.5 1.2 1.2 assign (residue 12 and name H5) (residue 13 and name H5) 4.5 1.5 1.5 assign (residue 12 and name H6) (residue 12 and name H1') 4.5 1.5 1.5 assign (residue 12 and name H6) (residue 12 and name H5) 3.5 1.2 1.2 !C13 assign (residue 13 and name H1') (residue 13 and name H2'') 3.5 1.2 1.2 assign (residue 13 and name H1') (residue 13 and name H6) 4.5 1.5 1.5 !assign (residue 13 and name H1') (residue 30 and name H1') 3.5 1.2 1.2 assign (residue 13 and name H2'') (residue 13 and name H1') 3.5 1.2 1.2 assign (residue 13 and name H2'') (residue 14 and name H1') 4.5 1.5 1.5 assign (residue 13 and name H2'') (residue 14 and name H5) 4.5 1.5 1.5 assign (residue 13 and name H2'') (residue 14 and name H6) 2.5 0.7 0.7 assign (residue 13 and name H5) (residue 12 and name H6) 4.5 1.5 1.5 assign (residue 13 and name H6) (residue 12 and name H1') 4.5 1.5 1.5 assign (residue 13 and name H6) (residue 12 and name H2'') 2.5 0.7 0.7 assign (residue 13 and name H6) (residue 13 and name H1') 3.5 1.2 1.2 assign (residue 13 and name H6) (residue 14 and name H5) 4.5 1.5 1.5 !U14 assign (residue 14 and name H1') (residue 14 and name H6) 4.5 1.5 1.5 assign (residue 14 and name H1') (residue 15 and name H8) 4.5 1.5 1.5 assign (residue 14 and name H2'') (residue 14 and name H1') 2.5 0.7 0.7 assign (residue 14 and name H2'') (residue 15 and name H8) 2.5 0.7 0.7 assign (residue 14 and name H6) (residue 13 and name H2'') 3.5 1.2 1.2 assign (residue 14 and name H6) (residue 14 and name H1') 4.5 1.5 1.5 !A15 assign (residue 15 and name H1') (residue 15 and name H2'') 3.5 1.2 1.2 assign (residue 15 and name H1') (residue 15 and name H8) 4.5 1.5 1.5 assign (residue 15 and name H1') (residue 16 and name H6) 4.5 1.5 1.5 assign (residue 15 and name H2'') (residue 15 and name H1') 2.5 0.7 0.7 assign (residue 15 and name H2'') (residue 16 and name H6) 3.5 1.2 1.2 assign (residue 15 and name H8) (residue 14 and name H1') 4.5 1.5 1.5 assign (residue 15 and name H8) (residue 15 and name H1') 4.5 1.5 1.5 !C16 assign (residue 16 and name H1') (residue 16 and name H2'') 3.5 1.2 1.2 assign (residue 16 and name H1') (residue 17 and name H8) 4.5 1.5 1.5 assign (residue 16 and name H2'') (residue 16 and name H1') 2.5 0.7 0.7 assign (residue 16 and name H2'') (residue 17 and name H8) 2.5 0.7 0.7 assign (residue 16 and name H5) (residue 15 and name H8) 4.5 1.5 1.5 assign (residue 16 and name H5) (residue 15 and name H1') 4.5 1.5 1.5 assign (residue 16 and name H6) (residue 15 and name H1') 4.5 1.5 1.5 assign (residue 16 and name H6) (residue 16 and name H5) 3.5 1.2 1.2 assign (residue 16 and name H6) (residue 15 and name H8) 4.5 1.5 1.5 !G17 assign (residue 17 and name H1') (residue 17 and name H2'') 3.5 1.2 1.2 assign (residue 17 and name H1') (residue 17 and name H8) 4.5 1.5 1.5 assign (residue 17 and name H1') (residue 18 and name H6) 4.5 1.5 1.5 assign (residue 17 and name H2'') (residue 17 and name H1') 2.5 0.7 0.7 assign (residue 17 and name H2'') (residue 18 and name H6) 3.5 1.2 1.2 assign (residue 17 and name H8) (residue 16 and name H1') 4.5 1.5 1.5 assign (residue 17 and name H8) (residue 16 and name H2'') 3.5 1.2 1.2 assign (residue 17 and name H8) (residue 17 and name H1') 3.5 1.2 1.2 assign (residue 17 and name H8) (residue 18 and name H6) 4.5 1.5 1.5 !U18 assign (residue 18 and name H1') (residue 18 and name H6) 4.5 1.5 1.5 assign (residue 18 and name H2'') (residue 18 and name H1') 2.5 0.7 0.7 assign (residue 18 and name H2'') (residue 19 and name H6) 3.5 1.2 1.2 assign (residue 18 and name H3') (residue 18 and name H1') 3.5 1.2 1.2 assign (residue 18 and name H3') (residue 18 and name H6) 4.5 1.5 1.5 assign (residue 18 and name H3') (residue 19 and name H5) 4.5 1.5 1.5 assign (residue 18 and name H5) (residue 18 and name H1') 4.5 1.5 1.5 assign (residue 18 and name H5) (residue 17 and name H1') 4.5 1.5 1.5 assign (residue 18 and name H5) (residue 18 and name H6) 3.5 1.2 1.2 assign (residue 18 and name H5) (residue 19 and name H5) 4.5 1.5 1.5 assign (residue 18 and name H6) (residue 17 and name H1') 4.5 1.5 1.5 assign (residue 18 and name H6) (residue 18 and name H1') 4.5 1.5 1.5 assign (residue 18 and name H6) (residue 18 and name H5) 3.5 1.2 1.2 assign (residue 18 and name H6) (residue 19 and name H6) 4.5 1.5 1.5 !U19 assign (residue 19 and name H1') (residue 19 and name H2'') 2.5 0.7 0.7 assign (residue 19 and name H1') (residue 19 and name H6) 4.5 1.5 1.5 assign (residue 19 and name H2'') (residue 19 and name H1') 2.5 0.7 0.7 assign (residue 19 and name H2'') (residue 19 and name H6) 4.5 1.5 1.5 assign (residue 19 and name H2'') (residue 21 and name H5) 3.5 1.2 1.2 assign (residue 19 and name H3') (residue 19 and name H1') 4.5 1.5 1.5 assign (residue 19 and name H4') (residue 19 and name H1') 3.5 1.2 1.2 assign (residue 19 and name H5') (residue 19 and name H1') 4.5 1.5 1.5 assign (residue 19 and name H5') (residue 19 and name H6) 3.5 1.2 1.2 assign (residue 19 and name H5) (residue 19 and name H6) 3.5 1.2 1.2 assign (residue 19 and name H6) (residue 18 and name H1') 4.5 1.5 1.5 assign (residue 19 and name H6) (residue 19 and name H1') 4.5 1.5 1.5 assign (residue 19 and name H6) (residue 19 and name H5) 3.5 1.2 1.2 !U20 assign (residue 20 and name H3') (residue 20 and name H1') 4.5 1.5 1.5 assign (residue 20 and name H3') (residue 21 and name H5) 3.5 1.2 1.2 assign (residue 20 and name H1') (residue 20 and name H6) 4.5 1.5 1.5 assign (residue 20 and name H2'') (residue 20 and name H1') 4.5 1.5 1.5 assign (residue 20 and name H2'') (residue 20 and name H6) 3.5 1.2 1.2 assign (residue 20 and name H2'') (residue 21 and name H5) 4.5 1.5 1.5 assign (residue 20 and name H4') (residue 20 and name H1') 4.5 1.5 1.5 assign (residue 20 and name H4') (residue 21 and name H5) 4.5 1.5 1.5 assign (residue 20 and name H4') (residue 21 and name H6) 4.5 1.5 1.5 assign (residue 20 and name H5) (residue 20 and name H6) 3.5 1.2 1.2 assign (residue 20 and name H6) (residue 19 and name H1') 4.5 1.5 1.5 assign (residue 20 and name H6) (residue 20 and name H1') 4.5 1.5 1.5 assign (residue 20 and name H6) (residue 20 and name H5) 3.5 1.2 1.2 !C21 assign (residue 21 and name H1') (residue 21 and name H6) 4.5 1.5 1.5 assign (residue 21 and name H2'') (residue 21 and name H1') 4.5 1.5 1.5 assign (residue 21 and name H2'') (residue 21 and name H5) 4.5 1.5 1.5 assign (residue 21 and name H2'') (residue 21 and name H6) 3.5 1.2 1.2 assign (residue 21 and name H4') (residue 21 and name H1') 4.5 1.5 1.5 assign (residue 21 and name H5) (residue 21 and name H6) 3.5 1.2 1.2 assign (residue 21 and name H6) (residue 21 and name H1') 4.5 1.5 1.5 assign (residue 21 and name H6) (residue 21 and name H2'') 3.5 1.2 1.2 assign (residue 21 and name H6) (residue 21 and name H5) 3.5 1.2 1.2 !G22 assign (residue 22 and name H1') (residue 22 and name H8) 2.5 0.7 0.7 assign (residue 22 and name H2'') (residue 22 and name H1') 2.5 0.7 0.7 assign (residue 22 and name H2'') (residue 22 and name H3') 3.5 1.2 1.2 assign (residue 22 and name H2'') (residue 22 and name H8) 3.5 1.2 1.2 assign (residue 22 and name H2'') (residue 23 and name H8) 4.5 1.5 1.5 assign (residue 22 and name H3') (residue 22 and name H1') 4.5 1.5 1.5 assign (residue 22 and name H3') (residue 23 and name H8) 4.5 1.5 1.5 assign (residue 22 and name H4') (residue 22 and name H1') 3.5 1.2 1.2 !A23 assign (residue 23 and name H2'') (residue 24 and name H6) 3.5 1.2 1.2 assign (residue 23 and name H8) (residue 22 and name H3') 4.5 1.5 1.5 !C24 assign (residue 24 and name H1') (residue 24 and name H6) 4.5 1.5 1.5 assign (residue 24 and name H1') (residue 25 and name H8) 4.5 1.5 1.5 assign (residue 24 and name H2'') (residue 24 and name H1') 2.5 0.7 0.7 assign (residue 24 and name H2'') (residue 25 and name H8) 2.5 0.7 0.7 assign (residue 24 and name H5) (residue 24 and name H6) 3.5 1.2 1.2 assign (residue 24 and name H6) (residue 23 and name H8) 4.5 1.5 1.5 assign (residue 24 and name H6) (residue 24 and name H1') 3.5 1.2 1.2 assign (residue 24 and name H6) (residue 24 and name H5) 3.5 1.2 1.2 assign (residue 24 and name H6) (residue 25 and name H8) 4.5 1.5 1.5 !G25 assign (residue 25 and name H1') (residue 25 and name H8) 4.5 1.5 1.5 assign (residue 25 and name H1') (residue 26 and name H6) 4.5 1.5 1.5 assign (residue 25 and name H2'') (residue 25 and name H1') 2.5 0.7 0.7 assign (residue 25 and name H2'') (residue 26 and name H6) 3.5 1.2 1.2 assign (residue 25 and name H8) (residue 24 and name H1') 3.5 1.2 1.2 assign (residue 25 and name H8) (residue 24 and name H2'') 3.5 1.2 1.2 assign (residue 25 and name H8) (residue 25 and name H1') 3.5 1.2 1.2 !U26 assign (residue 26 and name H1') (residue 26 and name H6) 4.5 1.5 1.5 assign (residue 26 and name H1') (residue 27 and name H8) 4.5 1.5 1.5 assign (residue 26 and name H2'') (residue 26 and name H1') 2.5 0.7 0.7 assign (residue 26 and name H2'') (residue 26 and name H6) 4.5 1.5 1.5 assign (residue 26 and name H2'') (residue 27 and name H8) 2.5 0.7 0.7 assign (residue 26 and name H5) (residue 26 and name H6) 3.5 1.2 1.2 assign (residue 26 and name H5) (residue 26 and name H1') 4.5 1.5 1.5 assign (residue 26 and name H5) (residue 25 and name H1') 4.5 1.5 1.5 assign (residue 26 and name H6) (residue 25 and name H1') 4.5 1.5 1.5 assign (residue 26 and name H6) (residue 26 and name H1') 4.5 1.5 1.5 assign (residue 26 and name H6) (residue 26 and name H5) 3.5 1.2 1.2 assign (residue 26 and name H6) (residue 27 and name H8) 4.5 1.5 1.5 !A27 assign (residue 27 and name H1') (residue 27 and name H8) 4.5 1.5 1.5 assign (residue 27 and name H1') (residue 28 and name H8) 4.5 1.5 1.5 assign (residue 27 and name H2'') (residue 27 and name H1') 2.5 0.7 0.7 assign (residue 27 and name H2'') (residue 27 and name H8) 3.5 1.2 1.2 assign (residue 27 and name H2'') (residue 28 and name H8) 2.5 0.7 0.7 assign (residue 27 and name H8) (residue 26 and name H1') 3.5 1.2 1.2 assign (residue 27 and name H8) (residue 27 and name H1') 4.5 1.5 1.5 !G28 assign (residue 28 and name H1') (residue 28 and name H2'') 3.5 1.2 1.2 assign (residue 28 and name H1') (residue 28 and name H8) 4.5 1.5 1.5 assign (residue 28 and name H2'') (residue 28 and name H1') 2.5 0.7 0.7 assign (residue 28 and name H2'') (residue 28 and name H8) 3.5 1.2 1.2 assign (residue 28 and name H2'') (residue 29 and name H6) 3.5 1.2 1.2 assign (residue 28 and name H8) (residue 27 and name H1') 3.5 1.2 1.2 assign (residue 28 and name H8) (residue 28 and name H1') 4.5 1.5 1.5 assign (residue 28 and name H8) (residue 28 and name H2'') 4.5 1.5 1.5 assign (residue 28 and name H8) (residue 27 and name H8) 4.5 1.5 1.5 !U29 assign (residue 29 and name H1') (residue 29 and name H6) 4.5 1.5 1.5 assign (residue 29 and name H1') (residue 30 and name H5) 4.5 1.5 1.5 assign (residue 29 and name H2'') (residue 29 and name H1') 2.5 0.7 0.7 assign (residue 29 and name H2'') (residue 29 and name H6) 3.5 1.2 1.2 assign (residue 29 and name H2'') (residue 30 and name H5) 4.5 1.5 1.5 assign (residue 29 and name H5) (residue 29 and name H6) 4.5 1.5 1.5 assign (residue 29 and name H6) (residue 29 and name H1') 4.5 1.5 1.5 assign (residue 29 and name H6) (residue 29 and name H2'') 4.5 1.5 1.5 assign (residue 29 and name H6) (residue 29 and name H5) 4.5 1.5 1.5 assign (residue 29 and name H6) (residue 28 and name H1') 4.5 1.5 1.5 !U30 assign (residue 30 and name H1') (residue 30 and name H6) 4.5 1.5 1.5 assign (residue 30 and name H2'') (residue 30 and name H1') 2.5 0.7 0.7 assign (residue 30 and name H2'') (residue 30 and name H6) 4.5 1.5 1.5 assign (residue 30 and name H2'') (residue 31 and name H1') 3.5 1.2 1.2 assign (residue 30 and name H2'') (residue 31 and name H6) 3.5 1.2 1.2 assign (residue 30 and name H3') (residue 30 and name H1') 3.5 1.2 1.2 assign (residue 30 and name H3') (residue 30 and name H5) 4.5 1.5 1.5 assign (residue 30 and name H5) (residue 29 and name H1') 4.5 1.5 1.5 assign (residue 30 and name H5) (residue 31 and name H5) 4.5 1.5 1.5 assign (residue 30 and name H5) (residue 30 and name H1') 4.5 1.5 1.5 assign (residue 30 and name H6) (residue 30 and name H1') 3.5 1.2 1.2 assign (residue 30 and name H6) (residue 31 and name H5) 4.5 1.5 1.5 !C31 assign (residue 31 and name H1') (residue 31 and name H2'') 3.5 1.2 1.2 assign (residue 31 and name H1') (residue 31 and name H6) 4.5 1.5 1.5 assign (residue 31 and name H1') (residue 32 and name H6) 4.5 1.5 1.5 assign (residue 31 and name H2'') (residue 31 and name H1') 2.5 0.7 0.7 assign (residue 31 and name H2'') (residue 31 and name H6) 4.5 1.5 1.5 assign (residue 31 and name H2'') (residue 32 and name H6) 3.5 1.2 1.2 assign (residue 31 and name H5) (residue 31 and name H6) 3.5 1.2 1.2 assign (residue 31 and name H6) (residue 31 and name H1') 4.5 1.5 1.5 assign (residue 31 and name H6) (residue 31 and name H5) 3.5 1.2 1.2 !U32 assign (residue 32 and name H1') (residue 33 and name H8) 3.5 1.2 1.2 assign (residue 32 and name H2'') (residue 32 and name H1') 2.5 0.7 0.7 assign (residue 32 and name H2'') (residue 32 and name H6) 4.5 1.5 1.5 assign (residue 32 and name H2'') (residue 33 and name H8) 2.5 0.7 0.7 assign (residue 32 and name H5) (residue 32 and name H6) 3.5 1.2 1.2 assign (residue 32 and name H6) (residue 31 and name H1') 4.5 1.5 1.5 assign (residue 32 and name H6) (residue 31 and name H2'') 3.5 1.2 1.2 assign (residue 32 and name H6) (residue 32 and name H5) 3.5 1.2 1.2 assign (residue 32 and name H6) (residue 33 and name H8) 4.5 1.5 1.5 !A33 assign (residue 33 and name H1') (residue 33 and name H8) 4.5 1.5 1.5 assign (residue 33 and name H1') (residue 34 and name H8) 4.5 1.5 1.5 assign (residue 33 and name H2'') (residue 33 and name H1') 2.5 0.7 0.7 assign (residue 33 and name H2'') (residue 34 and name H8) 3.5 1.2 1.2 assign (residue 33 and name H8) (residue 32 and name H1') 3.5 1.2 1.2 assign (residue 33 and name H8) (residue 33 and name H1') 4.5 1.5 1.5 !A34 assign (residue 34 and name H1') (residue 34 and name H8) 4.5 1.5 1.5 assign (residue 34 and name H1') (residue 35 and name H6) 4.5 1.5 1.5 assign (residue 34 and name H2'') (residue 34 and name H1') 2.5 0.7 0.7 assign (residue 34 and name H2'') (residue 35 and name H6) 3.5 1.2 1.2 assign (residue 34 and name H8) (residue 33 and name H1') 4.5 1.5 1.5 assign (residue 34 and name H8) (residue 34 and name H1') 4.5 1.5 1.5 assign (residue 34 and name H8) (residue 33 and name H8) 4.5 1.5 1.5 !C35 assign (residue 35 and name H1') (residue 35 and name H2'') 3.5 1.2 1.2 assign (residue 35 and name H1') (residue 35 and name H6) 4.5 1.5 1.5 assign (residue 35 and name H2'') (residue 35 and name H1') 3.5 1.2 1.2 assign (residue 35 and name H2'') (residue 36 and name H6) 3.5 1.2 1.2 assign (residue 35 and name H5) (residue 35 and name H6) 3.5 1.2 1.2 assign (residue 35 and name H6) (residue 34 and name H1') 4.5 1.5 1.5 assign (residue 35 and name H6) (residue 34 and name H2'') 3.5 1.2 1.2 assign (residue 35 and name H6) (residue 35 and name H1') 4.5 1.5 1.5 assign (residue 35 and name H6) (residue 34 and name H8) 4.5 1.5 1.5 !C36 assign (residue 36 and name H5) (residue 36 and name H6) 3.5 1.2 1.2 assign (residue 36 and name H6) (residue 35 and name H1') 4.5 1.5 1.5 assign (residue 36 and name H6) (residue 35 and name H2'') 3.5 1.2 1.2 assign (residue 36 and name H6) (residue 36 and name H1') 4.5 1.5 1.5 assign (residue 36 and name H6) (residue 36 and name H5) 3.5 1.2 1.2 Entry H atom name Submitted Coord H atom name Start of MODEL 1 1 H5' G 1 H5' GUA 1 -5.753 4.311 18.843 2 H5'' G 1 H5'' GUA 1 -5.117 3.692 17.309 3 H4' G 1 H4' GUA 1 -6.737 5.855 17.601 4 H3' G 1 H3' GUA 1 -5.878 4.556 15.425 5 H2' G 1 H2'' GUA 1 -3.645 5.512 15.378 6 HO2' G 1 H2' GUA 1 -4.588 6.017 13.361 7 H1' G 1 H1' GUA 1 -4.925 8.239 15.987 8 H8 G 1 H8 GUA 1 -2.026 5.999 17.259 9 H1 G 1 H1 GUA 1 -0.537 12.098 15.909 10 H21 G 1 H21 GUA 1 -2.305 13.156 15.152 11 H22 G 1 H22 GUA 1 -3.860 12.376 14.973 12 HO5' G 1 H5T GUA 1 -3.209 4.203 17.969 13 H5' G 2 H5' GUA 2 -6.394 6.386 12.612 14 H5'' G 2 H5'' GUA 2 -7.977 6.279 11.817 15 H4' G 2 H4' GUA 2 -6.351 5.562 10.261 16 H3' G 2 H3' GUA 2 -7.928 3.246 11.369 17 H2' G 2 H2'' GUA 2 -6.692 1.821 9.888 18 HO2' G 2 H2' GUA 2 -6.178 2.620 7.992 19 H1' G 2 H1' GUA 2 -4.205 3.135 10.302 20 H8 G 2 H8 GUA 2 -5.863 2.746 13.603 21 H1 G 2 H1 GUA 2 -3.095 -2.662 11.521 22 H21 G 2 H21 GUA 2 -2.531 -2.457 9.412 23 H22 G 2 H22 GUA 2 -2.826 -0.995 8.498 24 H5' A 3 H5' ADE 3 -10.573 0.962 7.719 25 H5'' A 3 H5'' ADE 3 -9.792 0.500 9.246 26 H4' A 3 H4' ADE 3 -8.633 0.317 6.472 27 H3' A 3 H3' ADE 3 -9.661 -1.815 8.327 28 H2' A 3 H2'' ADE 3 -7.965 -3.274 7.437 29 HO2' A 3 H2' ADE 3 -7.561 -1.161 5.560 30 H1' A 3 H1' ADE 3 -5.919 -1.393 7.656 31 H8 A 3 H8 ADE 3 -8.081 -0.670 10.561 32 H61 A 3 H61 ADE 3 -5.306 -5.347 13.513 33 H62 A 3 H62 ADE 3 -6.359 -3.960 13.687 34 H2 A 3 H2 ADE 3 -4.185 -5.578 9.175 35 H5' G 4 H5' GUA 4 -9.091 -3.584 4.857 36 H5'' G 4 H5'' GUA 4 -10.453 -4.573 4.295 37 H4' G 4 H4' GUA 4 -8.525 -5.931 4.252 38 H3' G 4 H3' GUA 4 -10.332 -6.649 6.551 39 H2' G 4 H2'' GUA 4 -8.802 -8.461 7.022 40 HO2' G 4 H2' GUA 4 -7.577 -7.656 4.566 41 H1' G 4 H1' GUA 4 -6.528 -6.853 6.850 42 H8 G 4 H8 GUA 4 -9.126 -4.617 8.246 43 H1 G 4 H1 GUA 4 -6.734 -8.684 12.602 44 H21 G 4 H21 GUA 4 -5.556 -10.244 11.616 45 H22 G 4 H22 GUA 4 -5.341 -10.302 9.881 46 H5' U 5 H5' URI 5 -12.460 -9.755 7.394 47 H5'' U 5 H5'' URI 5 -10.767 -9.377 7.756 48 H4' U 5 H4' URI 5 -11.136 -11.547 8.552 49 H3' U 5 H3' URI 5 -9.628 -11.698 5.935 50 H2' U 5 H2'' URI 5 -9.509 -14.109 6.420 51 HO2' U 5 H2' URI 5 -10.626 -14.866 8.334 52 H1' U 5 H1' URI 5 -12.219 -14.313 6.779 53 H3 U 5 H3 URI 5 -11.294 -15.611 2.474 54 H5 U 5 H5 URI 5 -12.009 -11.479 2.315 55 H6 U 5 H6 URI 5 -11.961 -11.452 4.719 56 H5' G 6 H5' GUA 6 -7.556 -14.134 8.228 57 H5'' G 6 H5'' GUA 6 -5.825 -13.749 8.303 58 H4' G 6 H4' GUA 6 -6.037 -16.040 7.719 59 H3' G 6 H3' GUA 6 -5.218 -14.370 5.340 60 H2' G 6 H2'' GUA 6 -5.022 -16.445 4.121 61 HO2' G 6 H2' GUA 6 -5.617 -17.749 6.598 62 H1' G 6 H1' GUA 6 -7.477 -17.437 5.045 63 H8 G 6 H8 GUA 6 -7.798 -13.739 4.506 64 H1 G 6 H1 GUA 6 -8.126 -17.141 -0.914 65 H21 G 6 H21 GUA 6 -7.491 -19.211 -0.551 66 H22 G 6 H22 GUA 6 -6.995 -19.776 1.028 67 H5' G 7 H5' GUA 7 -2.762 -17.435 5.451 68 H5'' G 7 H5'' GUA 7 -1.053 -16.997 5.290 69 H4' G 7 H4' GUA 7 -1.493 -18.692 3.713 70 H3' G 7 H3' GUA 7 -1.255 -16.002 2.366 71 H2' G 7 H2'' GUA 7 -1.465 -17.204 0.278 72 HO2' G 7 H2' GUA 7 -1.337 -19.558 1.891 73 H1' G 7 H1' GUA 7 -3.610 -18.775 1.152 74 H8 G 7 H8 GUA 7 -4.208 -15.441 2.646 75 H1 G 7 H1 GUA 7 -5.602 -15.659 -3.622 76 H21 G 7 H21 GUA 7 -4.797 -17.497 -4.506 77 H22 G 7 H22 GUA 7 -3.914 -18.681 -3.570 78 H5' U 8 H5' URI 8 1.107 -18.459 0.382 79 H5'' U 8 H5'' URI 8 2.738 -17.829 0.098 80 H4' U 8 H4' URI 8 1.896 -18.591 -1.972 81 H3' U 8 H3' URI 8 1.882 -15.573 -1.863 82 H2' U 8 H2'' URI 8 1.155 -15.669 -4.176 83 HO2' U 8 H2' URI 8 0.886 -17.856 -5.110 84 H1' U 8 H1' URI 8 -0.781 -17.628 -3.698 85 H3 U 8 H3 URI 8 -2.969 -13.681 -4.386 86 H5 U 8 H5 URI 8 -1.925 -13.676 -0.323 87 H6 U 8 H6 URI 8 -0.555 -15.607 -0.755 88 H5' U 9 H5' URI 9 3.696 -16.577 -5.263 89 H5'' U 9 H5'' URI 9 5.213 -15.709 -5.553 90 H4' U 9 H4' URI 9 3.896 -15.510 -7.496 91 H3' U 9 H3' URI 9 3.931 -12.913 -5.966 92 H2' U 9 H2'' URI 9 2.650 -11.980 -7.785 93 HO2' U 9 H2' URI 9 2.184 -13.354 -9.637 94 H1' U 9 H1' URI 9 0.883 -14.161 -7.938 95 H3 U 9 H3 URI 9 -1.421 -10.671 -6.113 96 H5 U 9 H5 URI 9 0.631 -12.446 -2.910 97 H6 U 9 H6 URI 9 1.851 -13.752 -4.522 98 H5' A 10 H5' ADE 10 4.837 -12.105 -9.761 99 H5'' A 10 H5'' ADE 10 6.225 -11.021 -9.959 100 H4' A 10 H4' ADE 10 4.465 -10.157 -11.255 101 H3' A 10 H3' ADE 10 4.861 -8.509 -8.764 102 H2' A 10 H2'' ADE 10 3.153 -7.036 -9.620 103 HO2' A 10 H2' ADE 10 2.524 -7.065 -11.705 104 H1' A 10 H1' ADE 10 1.412 -9.116 -10.329 105 H8 A 10 H8 ADE 10 3.088 -10.182 -7.176 106 H61 A 10 H61 ADE 10 -0.999 -6.702 -4.095 107 H62 A 10 H62 ADE 10 0.262 -7.906 -3.947 108 H2 A 10 H2 ADE 10 -1.387 -5.761 -8.463 109 H5' G 11 H5' GUA 11 4.754 -6.001 -11.862 110 H5'' G 11 H5'' GUA 11 6.048 -4.790 -11.860 111 H4' G 11 H4' GUA 11 4.013 -3.648 -12.157 112 H3' G 11 H3' GUA 11 5.061 -3.248 -9.356 113 H2' G 11 H2'' GUA 11 3.192 -1.745 -9.034 114 HO2' G 11 H2' GUA 11 2.404 -0.725 -10.717 115 H1' G 11 H1' GUA 11 1.323 -3.495 -10.135 116 H8 G 11 H8 GUA 11 3.751 -5.678 -8.378 117 H1 G 11 H1 GUA 11 -0.266 -2.659 -4.383 118 H21 G 11 H21 GUA 11 -1.362 -1.090 -5.464 119 H22 G 11 H22 GUA 11 -1.112 -0.776 -7.165 120 H5' U 12 H5' URI 12 4.132 0.345 -10.672 121 H5'' U 12 H5'' URI 12 5.393 1.571 -10.466 122 H4' U 12 H4' URI 12 3.383 2.435 -9.562 123 H3' U 12 H3' URI 12 5.323 1.667 -7.384 124 H2' U 12 H2'' URI 12 3.717 2.570 -5.820 125 HO2' U 12 H2' URI 12 2.244 3.996 -6.431 126 H1' U 12 H1' URI 12 1.530 1.285 -6.997 127 H3 U 12 H3 URI 12 2.479 -0.896 -3.094 128 H5 U 12 H5 URI 12 4.993 -2.607 -5.989 129 H6 U 12 H6 URI 12 4.346 -0.837 -7.484 130 H5' C 13 H5' CYT 13 4.049 5.322 -6.532 131 H5'' C 13 H5'' CYT 13 5.340 6.498 -6.230 132 H4' C 13 H4' CYT 13 3.812 6.664 -4.450 133 H3' C 13 H3' CYT 13 6.333 5.259 -3.586 134 H2' C 13 H2'' CYT 13 5.391 5.230 -1.356 135 HO2' C 13 H2' CYT 13 3.274 6.780 -2.488 136 H1' C 13 H1' CYT 13 2.921 4.275 -2.180 137 H41 C 13 H41 CYT 13 6.443 -0.926 -1.101 138 H42 C 13 H42 CYT 13 6.842 -0.971 -2.804 139 H5 C 13 H5 CYT 13 6.203 0.771 -4.350 140 H6 C 13 H6 CYT 13 5.112 2.937 -4.572 141 H5' U 14 H5' URI 14 5.662 8.031 -0.813 142 H5'' U 14 H5'' URI 14 7.032 9.112 -0.503 143 H4' U 14 H4' URI 14 6.276 8.304 1.579 144 H3' U 14 H3' URI 14 8.879 7.013 0.788 145 H2' U 14 H2'' URI 14 8.849 5.900 2.930 146 HO2' U 14 H2' URI 14 7.833 6.830 4.546 147 H1' U 14 H1' URI 14 6.205 5.068 2.697 148 H3 U 14 H3 URI 14 8.880 1.455 1.822 149 H5 U 14 H5 URI 14 8.251 3.386 -1.853 150 H6 U 14 H6 URI 14 7.347 5.245 -0.631 151 H5' A 15 H5' ADE 15 9.300 8.180 4.539 152 H5'' A 15 H5'' ADE 15 10.758 9.134 4.869 153 H4' A 15 H4' ADE 15 10.684 7.377 6.442 154 H3' A 15 H3' ADE 15 12.785 6.891 4.338 155 H2' A 15 H2'' ADE 15 13.403 4.915 5.596 156 HO2' A 15 H2' ADE 15 11.536 5.917 7.510 157 H1' A 15 H1' ADE 15 10.799 4.003 5.834 158 H8 A 15 H8 ADE 15 10.730 5.652 2.549 159 H61 A 15 H61 ADE 15 13.334 0.580 0.146 160 H62 A 15 H62 ADE 15 12.503 2.075 -0.215 161 H2 A 15 H2 ADE 15 13.691 0.345 4.613 162 H5' C 16 H5' CYT 16 14.634 6.206 7.768 163 H5'' C 16 H5'' CYT 16 16.182 7.051 7.959 164 H4' C 16 H4' CYT 16 16.568 4.750 8.351 165 H3' C 16 H3' CYT 16 17.651 5.608 5.673 166 H2' C 16 H2'' CYT 16 18.538 3.363 5.465 167 HO2' C 16 H2' CYT 16 17.555 2.974 8.122 168 H1' C 16 H1' CYT 16 16.144 2.143 6.178 169 H41 C 16 H41 CYT 16 15.715 2.969 -0.124 170 H42 C 16 H42 CYT 16 14.960 4.517 0.149 171 H5 C 16 H5 CYT 16 14.785 5.526 2.324 172 H6 C 16 H6 CYT 16 15.271 5.248 4.689 173 H5' G 17 H5' GUA 17 20.612 3.568 7.299 174 H5'' G 17 H5'' GUA 17 22.160 4.436 7.299 175 H4' G 17 H4' GUA 17 22.541 2.315 6.325 176 H3' G 17 H3' GUA 17 22.496 4.493 4.235 177 H2' G 17 H2'' GUA 17 23.106 2.773 2.649 178 HO2' G 17 H2' GUA 17 23.766 0.749 3.301 179 H1' G 17 H1' GUA 17 21.254 0.904 3.633 180 H8 G 17 H8 GUA 17 19.578 4.217 3.750 181 H1 G 17 H1 GUA 17 19.733 1.701 -2.151 182 H21 G 17 H21 GUA 17 21.124 0.001 -2.214 183 H22 G 17 H22 GUA 17 22.019 -0.528 -0.807 184 H5' U 18 H5' URI 18 25.787 2.466 3.418 185 H5'' U 18 H5'' URI 18 27.235 3.481 3.251 186 H4' U 18 H4' URI 18 27.054 2.162 1.291 187 H3' U 18 H3' URI 18 26.277 5.032 0.782 188 H2' U 18 H2'' URI 18 25.971 4.438 -1.516 189 HO2' U 18 H2' URI 18 26.707 2.398 -2.302 190 H1' U 18 H1' URI 18 24.833 1.873 -0.961 191 H3 U 18 H3 URI 18 21.701 4.364 -3.160 192 H5 U 18 H5 URI 18 21.550 5.664 0.830 193 H6 U 18 H6 URI 18 23.509 4.343 1.254 194 H5' U 19 H5' URI 19 29.041 7.724 -2.098 195 H5'' U 19 H5'' URI 19 27.389 7.691 -1.449 196 H4' U 19 H4' URI 19 28.338 6.543 -4.071 197 H3' U 19 H3' URI 19 26.689 8.988 -3.449 198 H2' U 19 H2'' URI 19 25.468 8.576 -5.461 199 HO2' U 19 H2' URI 19 26.330 7.536 -7.123 200 H1' U 19 H1' URI 19 25.389 5.749 -5.141 201 H3 U 19 H3 URI 19 21.140 7.406 -4.934 202 H5 U 19 H5 URI 19 22.761 7.997 -1.104 203 H6 U 19 H6 URI 19 24.889 7.301 -1.980 204 H5' U 20 H5' URI 20 27.472 12.939 -5.753 205 H5'' U 20 H5'' URI 20 25.791 12.383 -5.682 206 H4' U 20 H4' URI 20 26.165 13.517 -7.750 207 H3' U 20 H3' URI 20 24.857 11.191 -7.777 208 H2' U 20 H2'' URI 20 26.843 9.794 -8.085 209 HO2' U 20 H2' URI 20 26.553 8.977 -10.095 210 H1' U 20 H1' URI 20 27.707 11.818 -10.236 211 H3 U 20 H3 URI 20 31.571 9.807 -11.168 212 H5 U 20 H5 URI 20 31.044 8.905 -7.101 213 H6 U 20 H6 URI 20 28.948 10.083 -7.188 214 H5' C 21 H5' CYT 21 22.155 10.746 -10.602 215 H5'' C 21 H5'' CYT 21 21.792 12.434 -11.008 216 H4' C 21 H4' CYT 21 19.864 10.781 -10.515 217 H3' C 21 H3' CYT 21 19.768 13.453 -10.573 218 H2' C 21 H2'' CYT 21 20.524 13.781 -8.274 219 HO2' C 21 H2' CYT 21 18.629 14.351 -7.121 220 H1' C 21 H1' CYT 21 18.551 11.545 -7.520 221 H41 C 21 H41 CYT 21 21.250 11.998 -1.803 222 H42 C 21 H42 CYT 21 22.803 12.409 -2.499 223 H5 C 21 H5 CYT 21 23.159 12.631 -4.878 224 H6 C 21 H6 CYT 21 22.105 12.527 -7.068 225 H5' G 22 H5' GUA 22 16.652 9.743 -12.334 226 H5'' G 22 H5'' GUA 22 17.655 9.862 -10.873 227 H4' G 22 H4' GUA 22 18.376 8.773 -13.576 228 H3' G 22 H3' GUA 22 18.255 7.538 -10.835 229 H2' G 22 H2'' GUA 22 20.196 6.272 -11.356 230 HO2' G 22 H2' GUA 22 20.583 5.531 -13.355 231 H1' G 22 H1' GUA 22 21.263 8.171 -13.306 232 H8 G 22 H8 GUA 22 23.613 8.371 -12.494 233 H1 G 22 H1 GUA 22 21.778 8.416 -6.347 234 H21 G 22 H21 GUA 22 19.601 8.194 -6.203 235 H22 G 22 H22 GUA 22 18.580 8.036 -7.615 236 H5' A 23 H5' ADE 23 18.608 4.371 -13.139 237 H5'' A 23 H5'' ADE 23 17.454 3.067 -12.814 238 H4' A 23 H4' ADE 23 19.756 2.304 -12.604 239 H3' A 23 H3' ADE 23 18.166 2.290 -10.040 240 H2' A 23 H2'' ADE 23 20.106 1.260 -9.004 241 HO2' A 23 H2' ADE 23 20.637 0.264 -11.299 242 H1' A 23 H1' ADE 23 21.857 3.163 -9.999 243 H8 A 23 H8 ADE 23 18.527 4.841 -9.445 244 H61 A 23 H61 ADE 23 20.028 5.337 -3.458 245 H62 A 23 H62 ADE 23 18.878 5.802 -4.692 246 H2 A 23 H2 ADE 23 23.104 2.758 -5.459 247 H5' C 24 H5' CYT 24 19.874 -1.264 -10.403 248 H5'' C 24 H5'' CYT 24 18.830 -2.659 -10.093 249 H4' C 24 H4' CYT 24 20.786 -2.870 -8.767 250 H3' C 24 H3' CYT 24 18.385 -2.173 -7.083 251 H2' C 24 H2'' CYT 24 19.851 -2.401 -5.164 252 HO2' C 24 H2' CYT 24 21.836 -3.303 -5.309 253 H1' C 24 H1' CYT 24 21.837 -0.799 -6.251 254 H41 C 24 H41 CYT 24 17.807 3.107 -3.212 255 H42 C 24 H42 CYT 24 16.858 3.257 -4.668 256 H5 C 24 H5 CYT 24 17.309 1.981 -6.665 257 H6 C 24 H6 CYT 24 18.745 0.287 -7.660 258 H5' G 25 H5' GUA 25 20.180 -5.234 -5.349 259 H5'' G 25 H5'' GUA 25 19.114 -6.574 -4.897 260 H4' G 25 H4' GUA 25 20.417 -6.013 -3.010 261 H3' G 25 H3' GUA 25 17.569 -5.079 -2.664 262 H2' G 25 H2'' GUA 25 18.225 -4.405 -0.430 263 HO2' G 25 H2' GUA 25 20.759 -5.576 -1.042 264 H1' G 25 H1' GUA 25 20.532 -3.105 -1.280 265 H8 G 25 H8 GUA 25 18.073 -2.587 -4.003 266 H1 G 25 H1 GUA 25 16.940 1.142 1.088 267 H21 G 25 H21 GUA 25 18.142 0.476 2.802 268 H22 G 25 H22 GUA 25 19.233 -0.887 2.707 269 H5' U 26 H5' URI 26 18.564 -6.985 0.610 270 H5'' U 26 H5'' URI 26 17.396 -8.178 1.201 271 H4' U 26 H4' URI 26 17.951 -6.710 2.986 272 H3' U 26 H3' URI 26 15.150 -6.206 1.977 273 H2' U 26 H2'' URI 26 14.941 -4.607 3.779 274 HO2' U 26 H2' URI 26 17.454 -5.682 4.614 275 H1' U 26 H1' URI 26 17.417 -3.409 3.273 276 H3 U 26 H3 URI 26 14.146 -0.552 1.842 277 H5 U 26 H5 URI 26 14.843 -3.178 -1.355 278 H6 U 26 H6 URI 26 16.170 -4.520 0.134 279 H5' A 27 H5' ADE 27 15.041 -6.477 5.876 280 H5'' A 27 H5'' ADE 27 13.749 -7.482 6.552 281 H4' A 27 H4' ADE 27 13.676 -5.361 7.610 282 H3' A 27 H3' ADE 27 11.381 -5.722 5.690 283 H2' A 27 H2'' ADE 27 10.571 -3.580 6.470 284 HO2' A 27 H2' ADE 27 12.643 -3.853 8.419 285 H1' A 27 H1' ADE 27 13.078 -2.339 6.315 286 H8 A 27 H8 ADE 27 12.933 -4.627 3.400 287 H61 A 27 H61 ADE 27 9.750 -0.244 0.407 288 H62 A 27 H62 ADE 27 10.636 -1.744 0.240 289 H2 A 27 H2 ADE 27 9.906 0.876 4.748 290 H5' G 28 H5' GUA 28 9.935 -4.404 9.051 291 H5'' G 28 H5'' GUA 28 8.530 -5.276 9.685 292 H4' G 28 H4' GUA 28 7.994 -2.967 9.616 293 H3' G 28 H3' GUA 28 6.579 -4.527 7.464 294 H2' G 28 H2'' GUA 28 5.482 -2.492 6.836 295 HO2' G 28 H2' GUA 28 4.895 -1.446 8.633 296 H1' G 28 H1' GUA 28 7.785 -0.847 7.214 297 H8 G 28 H8 GUA 28 8.809 -3.897 5.345 298 H1 G 28 H1 GUA 28 5.918 0.469 1.623 299 H21 G 28 H21 GUA 28 4.962 2.003 2.865 300 H22 G 28 H22 GUA 28 5.028 1.970 4.612 301 H5' U 29 H5' URI 29 1.551 -3.989 8.278 302 H5'' U 29 H5'' URI 29 2.640 -4.033 6.876 303 H4' U 29 H4' URI 29 1.559 -1.607 8.294 304 H3' U 29 H3' URI 29 0.941 -2.766 5.588 305 H2' U 29 H2'' URI 29 0.564 -0.491 4.847 306 HO2' U 29 H2' URI 29 0.553 1.220 6.279 307 H1' U 29 H1' URI 29 2.951 0.448 5.892 308 H3 U 29 H3 URI 29 3.565 -0.173 1.401 309 H5 U 29 H5 URI 29 4.579 -3.842 3.176 310 H6 U 29 H6 URI 29 3.617 -2.947 5.316 311 H5' U 30 H5' URI 30 -1.786 -0.047 6.219 312 H5'' U 30 H5'' URI 30 -3.446 -0.566 5.869 313 H4' U 30 H4' URI 30 -3.042 1.422 4.656 314 H3' U 30 H3' URI 30 -3.037 -0.990 2.841 315 H2' U 30 H2'' URI 30 -2.801 0.589 1.010 316 HO2' U 30 H2' URI 30 -3.547 2.557 1.271 317 H1' U 30 H1' URI 30 -0.715 1.964 2.220 318 H3 U 30 H3 URI 30 1.114 -0.731 -0.998 319 H5 U 30 H5 URI 30 0.833 -3.114 2.448 320 H6 U 30 H6 URI 30 -0.476 -1.363 3.458 321 H5' C 31 H5' CYT 31 -5.462 1.638 1.138 322 H5'' C 31 H5'' CYT 31 -7.017 0.967 0.612 323 H4' C 31 H4' CYT 31 -6.061 2.090 -1.229 324 H3' C 31 H3' CYT 31 -5.861 -0.902 -1.569 325 H2' C 31 H2'' CYT 31 -4.940 -0.426 -3.765 326 HO2' C 31 H2' CYT 31 -5.428 2.322 -3.160 327 H1' C 31 H1' CYT 31 -3.125 1.448 -2.809 328 H41 C 31 H41 CYT 31 -0.105 -4.146 -2.450 329 H42 C 31 H42 CYT 31 -0.734 -4.379 -0.838 330 H5 C 31 H5 CYT 31 -2.351 -2.896 0.167 331 H6 C 31 H6 CYT 31 -3.704 -0.899 -0.174 332 H5' U 32 H5' URI 32 -7.355 0.435 -4.977 333 H5'' U 32 H5'' URI 32 -8.809 -0.419 -5.520 334 H4' U 32 H4' URI 32 -7.283 -0.368 -7.324 335 H3' U 32 H3' URI 32 -7.426 -3.126 -6.110 336 H2' U 32 H2'' URI 32 -5.943 -3.834 -7.881 337 HO2' U 32 H2' URI 32 -6.275 -1.185 -8.912 338 H1' U 32 H1' URI 32 -4.205 -1.655 -7.572 339 H3 U 32 H3 URI 32 -2.089 -5.338 -5.898 340 H5 U 32 H5 URI 32 -4.497 -3.907 -2.772 341 H6 U 32 H6 URI 32 -5.546 -2.437 -4.359 342 H5' A 33 H5' ADE 33 -7.877 -3.500 -10.035 343 H5'' A 33 H5'' ADE 33 -9.206 -4.565 -10.523 344 H4' A 33 H4' ADE 33 -7.278 -5.257 -11.686 345 H3' A 33 H3' ADE 33 -7.938 -7.192 -9.469 346 H2' A 33 H2'' ADE 33 -6.107 -8.539 -10.300 347 HO2' A 33 H2' ADE 33 -6.116 -6.666 -12.455 348 H1' A 33 H1' ADE 33 -4.342 -6.384 -10.507 349 H8 A 33 H8 ADE 33 -6.397 -5.693 -7.483 350 H61 A 33 H61 ADE 33 -2.680 -9.543 -4.367 351 H62 A 33 H62 ADE 33 -3.947 -8.344 -4.225 352 H2 A 33 H2 ADE 33 -1.795 -9.990 -8.737 353 H5' A 34 H5' ADE 34 -7.403 -9.332 -12.754 354 H5'' A 34 H5'' ADE 34 -8.660 -10.542 -13.065 355 H4' A 34 H4' ADE 34 -6.562 -11.621 -13.196 356 H3' A 34 H3' ADE 34 -7.998 -12.374 -10.648 357 H2' A 34 H2'' ADE 34 -6.149 -13.893 -10.252 358 HO2' A 34 H2' ADE 34 -4.424 -13.925 -11.898 359 H1' A 34 H1' ADE 34 -4.198 -11.990 -10.836 360 H8 A 34 H8 ADE 34 -7.004 -10.167 -9.162 361 H61 A 34 H61 ADE 34 -4.600 -11.966 -3.749 362 H62 A 34 H62 ADE 34 -5.751 -10.901 -4.523 363 H2 A 34 H2 ADE 34 -2.553 -14.258 -7.012 364 H5' C 35 H5' CYT 35 -6.813 -15.746 -12.321 365 H5'' C 35 H5'' CYT 35 -8.038 -17.023 -12.397 366 H4' C 35 H4' CYT 35 -6.085 -17.920 -11.393 367 H3' C 35 H3' CYT 35 -8.269 -17.507 -9.345 368 H2' C 35 H2'' CYT 35 -6.755 -18.564 -7.771 369 HO2' C 35 H2' CYT 35 -4.944 -19.629 -8.423 370 H1' C 35 H1' CYT 35 -4.554 -17.028 -8.552 371 H41 C 35 H41 CYT 35 -7.208 -13.759 -3.785 372 H42 C 35 H42 CYT 35 -8.241 -12.931 -4.928 373 H5 C 35 H5 CYT 35 -8.373 -13.541 -7.266 374 H6 C 35 H6 CYT 35 -7.513 -15.047 -8.984 375 H5' C 36 H5' CYT 36 -6.963 -21.207 -8.782 376 H5'' C 36 H5'' CYT 36 -8.241 -22.433 -8.714 377 H4' C 36 H4' CYT 36 -6.871 -22.702 -6.799 378 H3' C 36 H3' CYT 36 -9.521 -21.455 -6.082 379 HO3' C 36 H3T CYT 36 -8.360 -24.006 -6.093 380 H2' C 36 H2'' CYT 36 -8.809 -21.548 -3.789 381 HO2' C 36 H2' CYT 36 -7.857 -23.659 -3.911 382 H1' C 36 H1' CYT 36 -6.140 -20.737 -4.341 383 H41 C 36 H41 CYT 36 -9.246 -15.542 -2.364 384 H42 C 36 H42 CYT 36 -9.797 -15.255 -3.996 385 H5 C 36 H5 CYT 36 -9.415 -16.808 -5.802 386 H6 C 36 H6 CYT 36 -8.444 -18.955 -6.408 Start of MODEL 2 1 H5' G 1 H5' GUA 1 -29.714 -10.214 8.484 2 H5'' G 1 H5'' GUA 1 -31.077 -10.125 7.356 3 H4' G 1 H4' GUA 1 -28.524 -11.269 6.370 4 H3' G 1 H3' GUA 1 -28.820 -8.338 6.997 5 H2' G 1 H2'' GUA 1 -27.680 -7.870 4.952 6 HO2' G 1 H2' GUA 1 -26.537 -9.481 3.836 7 H1' G 1 H1' GUA 1 -28.890 -10.002 3.482 8 H8 G 1 H8 GUA 1 -31.612 -8.277 5.254 9 H1 G 1 H1 GUA 1 -29.578 -5.090 0.065 10 H21 G 1 H21 GUA 1 -27.662 -5.913 -0.621 11 H22 G 1 H22 GUA 1 -26.871 -7.247 0.189 12 HO5' G 1 H5T GUA 1 -30.422 -12.442 6.904 13 H5' G 2 H5' GUA 2 -25.058 -8.684 5.808 14 H5'' G 2 H5'' GUA 2 -23.902 -8.156 7.044 15 H4' G 2 H4' GUA 2 -23.372 -7.184 4.902 16 H3' G 2 H3' GUA 2 -23.323 -5.694 7.165 17 H2' G 2 H2'' GUA 2 -25.577 -4.789 6.906 18 HO2' G 2 H2' GUA 2 -23.723 -3.106 5.533 19 H1' G 2 H1' GUA 2 -24.851 -4.458 3.930 20 H8 G 2 H8 GUA 2 -27.837 -5.716 6.065 21 H1 G 2 H1 GUA 2 -29.222 -1.427 1.488 22 H21 G 2 H21 GUA 2 -27.387 -0.800 0.461 23 H22 G 2 H22 GUA 2 -25.811 -1.428 0.889 24 H5' A 3 H5' ADE 3 -20.786 -3.019 7.051 25 H5'' A 3 H5'' ADE 3 -19.238 -3.648 6.453 26 H4' A 3 H4' ADE 3 -18.823 -2.718 8.577 27 H3' A 3 H3' ADE 3 -18.877 -5.728 8.676 28 H2' A 3 H2'' ADE 3 -18.457 -5.597 11.000 29 HO2' A 3 H2' ADE 3 -17.461 -3.781 11.929 30 H1' A 3 H1' ADE 3 -19.718 -2.970 11.330 31 H8 A 3 H8 ADE 3 -22.152 -5.497 10.136 32 H61 A 3 H61 ADE 3 -23.008 -7.096 16.056 33 H62 A 3 H62 ADE 3 -23.614 -7.259 14.423 34 H2 A 3 H2 ADE 3 -19.391 -4.454 15.839 35 H5' G 4 H5' GUA 4 -15.522 -5.008 10.748 36 H5'' G 4 H5'' GUA 4 -14.140 -5.744 9.914 37 H4' G 4 H4' GUA 4 -14.017 -6.413 12.169 38 H3' G 4 H3' GUA 4 -13.970 -8.334 10.260 39 H2' G 4 H2'' GUA 4 -16.336 -8.891 10.407 40 HO2' G 4 H2' GUA 4 -16.348 -10.875 11.348 41 H1' G 4 H1' GUA 4 -15.964 -8.666 13.457 42 H8 G 4 H8 GUA 4 -18.511 -7.624 10.719 43 H1 G 4 H1 GUA 4 -20.946 -10.413 15.967 44 H21 G 4 H21 GUA 4 -19.330 -10.969 17.343 45 H22 G 4 H22 GUA 4 -17.645 -10.660 16.985 46 H5' U 5 H5' URI 5 -10.012 -10.135 9.846 47 H5'' U 5 H5'' URI 5 -10.761 -8.665 9.194 48 H4' U 5 H4' URI 5 -11.474 -11.504 8.472 49 H3' U 5 H3' URI 5 -9.788 -9.492 7.004 50 H2' U 5 H2'' URI 5 -10.680 -10.370 4.946 51 HO2' U 5 H2' URI 5 -10.748 -12.588 5.528 52 H1' U 5 H1' URI 5 -13.325 -10.345 5.819 53 H3 U 5 H3 URI 5 -12.746 -6.817 2.967 54 H5 U 5 H5 URI 5 -11.604 -5.416 6.762 55 H6 U 5 H6 URI 5 -11.754 -7.684 7.559 56 H5' G 6 H5' GUA 6 -8.121 -13.781 7.933 57 H5'' G 6 H5'' GUA 6 -6.412 -13.313 8.017 58 H4' G 6 H4' GUA 6 -6.464 -15.632 7.664 59 H3' G 6 H3' GUA 6 -5.718 -14.166 5.143 60 H2' G 6 H2'' GUA 6 -5.384 -16.323 4.122 61 HO2' G 6 H2' GUA 6 -5.340 -18.192 5.307 62 H1' G 6 H1' GUA 6 -7.789 -17.373 5.062 63 H8 G 6 H8 GUA 6 -8.627 -13.852 4.430 64 H1 G 6 H1 GUA 6 -8.044 -17.264 -0.977 65 H21 G 6 H21 GUA 6 -7.091 -19.197 -0.551 66 H22 G 6 H22 GUA 6 -6.591 -19.661 1.060 67 H5' G 7 H5' GUA 7 -3.089 -17.041 5.517 68 H5'' G 7 H5'' GUA 7 -1.403 -16.507 5.394 69 H4' G 7 H4' GUA 7 -1.677 -18.322 3.914 70 H3' G 7 H3' GUA 7 -1.522 -15.706 2.421 71 H2' G 7 H2'' GUA 7 -1.569 -17.030 0.395 72 HO2' G 7 H2' GUA 7 -1.077 -19.123 0.389 73 H1' G 7 H1' GUA 7 -3.689 -18.630 1.240 74 H8 G 7 H8 GUA 7 -4.485 -15.290 2.600 75 H1 G 7 H1 GUA 7 -5.552 -15.706 -3.721 76 H21 G 7 H21 GUA 7 -4.632 -17.532 -4.520 77 H22 G 7 H22 GUA 7 -3.753 -18.658 -3.511 78 H5' U 8 H5' URI 8 1.058 -18.131 0.676 79 H5'' U 8 H5'' URI 8 2.672 -17.437 0.441 80 H4' U 8 H4' URI 8 1.973 -18.334 -1.625 81 H3' U 8 H3' URI 8 1.827 -15.320 -1.655 82 H2' U 8 H2'' URI 8 1.214 -15.531 -3.990 83 HO2' U 8 H2' URI 8 1.408 -17.431 -5.087 84 H1' U 8 H1' URI 8 -0.684 -17.514 -3.521 85 H3 U 8 H3 URI 8 -2.942 -13.634 -4.364 86 H5 U 8 H5 URI 8 -2.092 -13.573 -0.253 87 H6 U 8 H6 URI 8 -0.634 -15.456 -0.609 88 H5' U 9 H5' URI 9 3.829 -16.375 -4.926 89 H5'' U 9 H5'' URI 9 5.330 -15.469 -5.178 90 H4' U 9 H4' URI 9 4.096 -15.377 -7.184 91 H3' U 9 H3' URI 9 3.992 -12.737 -5.737 92 H2' U 9 H2'' URI 9 2.761 -11.891 -7.633 93 HO2' U 9 H2' URI 9 3.160 -12.749 -9.533 94 H1' U 9 H1' URI 9 1.045 -14.104 -7.769 95 H3 U 9 H3 URI 9 -1.370 -10.625 -6.071 96 H5 U 9 H5 URI 9 0.604 -12.330 -2.781 97 H6 U 9 H6 URI 9 1.906 -13.624 -4.337 98 H5' A 10 H5' ADE 10 5.014 -12.003 -9.506 99 H5'' A 10 H5'' ADE 10 6.383 -10.892 -9.685 100 H4' A 10 H4' ADE 10 4.645 -10.099 -11.060 101 H3' A 10 H3' ADE 10 4.938 -8.393 -8.596 102 H2' A 10 H2'' ADE 10 3.228 -6.966 -9.531 103 HO2' A 10 H2' ADE 10 4.122 -7.674 -11.836 104 H1' A 10 H1' ADE 10 1.539 -9.091 -10.216 105 H8 A 10 H8 ADE 10 3.171 -10.089 -7.023 106 H61 A 10 H61 ADE 10 -1.037 -6.630 -4.069 107 H62 A 10 H62 ADE 10 0.228 -7.823 -3.877 108 H2 A 10 H2 ADE 10 -1.323 -5.731 -8.450 109 H5' G 11 H5' GUA 11 4.888 -5.904 -11.728 110 H5'' G 11 H5'' GUA 11 6.163 -4.675 -11.692 111 H4' G 11 H4' GUA 11 4.118 -3.565 -12.045 112 H3' G 11 H3' GUA 11 5.102 -3.143 -9.226 113 H2' G 11 H2'' GUA 11 3.207 -1.667 -8.942 114 HO2' G 11 H2' GUA 11 2.464 -0.648 -10.644 115 H1' G 11 H1' GUA 11 1.383 -3.437 -10.084 116 H8 G 11 H8 GUA 11 3.799 -5.586 -8.272 117 H1 G 11 H1 GUA 11 -0.349 -2.640 -4.357 118 H21 G 11 H21 GUA 11 -1.448 -1.085 -5.458 119 H22 G 11 H22 GUA 11 -1.167 -0.763 -7.155 120 H5' U 12 H5' URI 12 4.147 0.441 -10.558 121 H5'' U 12 H5'' URI 12 5.397 1.678 -10.336 122 H4' U 12 H4' URI 12 3.370 2.525 -9.459 123 H3' U 12 H3' URI 12 5.291 1.773 -7.262 124 H2' U 12 H2'' URI 12 3.669 2.655 -5.712 125 HO2' U 12 H2' URI 12 2.259 3.523 -8.044 126 H1' U 12 H1' URI 12 1.491 1.382 -6.928 127 H3 U 12 H3 URI 12 2.350 -0.785 -3.002 128 H5 U 12 H5 URI 12 4.905 -2.528 -5.842 129 H6 U 12 H6 URI 12 4.303 -0.758 -7.355 130 H5' C 13 H5' CYT 13 3.994 5.414 -6.397 131 H5'' C 13 H5'' CYT 13 5.279 6.598 -6.098 132 H4' C 13 H4' CYT 13 3.755 6.755 -4.314 133 H3' C 13 H3' CYT 13 6.287 5.359 -3.462 134 H2' C 13 H2'' CYT 13 5.353 5.325 -1.229 135 HO2' C 13 H2' CYT 13 3.951 6.815 -0.671 136 H1' C 13 H1' CYT 13 2.881 4.369 -2.043 137 H41 C 13 H41 CYT 13 6.369 -0.839 -0.942 138 H42 C 13 H42 CYT 13 6.758 -0.904 -2.646 139 H5 C 13 H5 CYT 13 6.123 0.831 -4.205 140 H6 C 13 H6 CYT 13 5.048 3.005 -4.438 141 H5' U 14 H5' URI 14 5.648 8.107 -0.655 142 H5'' U 14 H5'' URI 14 7.024 9.188 -0.363 143 H4' U 14 H4' URI 14 6.319 8.354 1.725 144 H3' U 14 H3' URI 14 8.902 7.081 0.851 145 H2' U 14 H2'' URI 14 8.933 5.936 2.972 146 HO2' U 14 H2' URI 14 7.946 6.808 4.638 147 H1' U 14 H1' URI 14 6.281 5.111 2.807 148 H3 U 14 H3 URI 14 8.914 1.500 1.828 149 H5 U 14 H5 URI 14 8.151 3.444 -1.814 150 H6 U 14 H6 URI 14 7.310 5.306 -0.553 151 H5' A 15 H5' ADE 15 9.429 8.209 4.603 152 H5'' A 15 H5'' ADE 15 10.906 9.143 4.906 153 H4' A 15 H4' ADE 15 10.861 7.356 6.447 154 H3' A 15 H3' ADE 15 12.900 6.899 4.279 155 H2' A 15 H2'' ADE 15 13.535 4.895 5.473 156 HO2' A 15 H2' ADE 15 11.644 5.719 7.451 157 H1' A 15 H1' ADE 15 10.930 3.997 5.773 158 H8 A 15 H8 ADE 15 10.787 5.703 2.516 159 H61 A 15 H61 ADE 15 13.240 0.625 -0.033 160 H62 A 15 H62 ADE 15 12.413 2.134 -0.349 161 H2 A 15 H2 ADE 15 13.736 0.327 4.415 162 H5' C 16 H5' CYT 16 14.802 6.133 7.652 163 H5'' C 16 H5'' CYT 16 16.365 6.954 7.827 164 H4' C 16 H4' CYT 16 16.721 4.642 8.186 165 H3' C 16 H3' CYT 16 17.781 5.518 5.505 166 H2' C 16 H2'' CYT 16 18.636 3.262 5.265 167 HO2' C 16 H2' CYT 16 18.919 1.983 6.962 168 H1' C 16 H1' CYT 16 16.232 2.068 5.998 169 H41 C 16 H41 CYT 16 15.712 2.922 -0.288 170 H42 C 16 H42 CYT 16 14.984 4.481 0.000 171 H5 C 16 H5 CYT 16 14.879 5.495 2.180 172 H6 C 16 H6 CYT 16 15.394 5.198 4.537 173 H5' G 17 H5' GUA 17 20.728 3.413 7.074 174 H5'' G 17 H5'' GUA 17 22.283 4.268 7.076 175 H4' G 17 H4' GUA 17 22.644 2.161 6.072 176 H3' G 17 H3' GUA 17 22.589 4.370 4.019 177 H2' G 17 H2'' GUA 17 23.159 2.680 2.391 178 HO2' G 17 H2' GUA 17 24.216 0.926 2.969 179 H1' G 17 H1' GUA 17 21.345 0.773 3.401 180 H8 G 17 H8 GUA 17 19.645 4.075 3.525 181 H1 G 17 H1 GUA 17 19.718 1.528 -2.364 182 H21 G 17 H21 GUA 17 21.122 -0.159 -2.443 183 H22 G 17 H22 GUA 17 22.045 -0.677 -1.050 184 H5' U 18 H5' URI 18 25.888 2.360 3.130 185 H5'' U 18 H5'' URI 18 27.326 3.389 2.986 186 H4' U 18 H4' URI 18 27.151 2.126 0.989 187 H3' U 18 H3' URI 18 26.334 4.996 0.575 188 H2' U 18 H2'' URI 18 25.991 4.481 -1.727 189 HO2' U 18 H2' URI 18 27.639 3.310 -2.451 190 H1' U 18 H1' URI 18 25.001 1.815 -1.240 191 H3 U 18 H3 URI 18 21.743 4.099 -3.476 192 H5 U 18 H5 URI 18 21.464 5.389 0.515 193 H6 U 18 H6 URI 18 23.514 4.213 0.953 194 H5' U 19 H5' URI 19 28.955 8.049 -1.872 195 H5'' U 19 H5'' URI 19 27.300 7.799 -1.287 196 H4' U 19 H4' URI 19 28.410 7.126 -4.003 197 H3' U 19 H3' URI 19 26.479 9.252 -3.102 198 H2' U 19 H2'' URI 19 25.376 9.013 -5.221 199 HO2' U 19 H2' URI 19 26.281 7.818 -6.899 200 H1' U 19 H1' URI 19 25.434 6.197 -5.197 201 H3 U 19 H3 URI 19 21.126 7.577 -4.539 202 H5 U 19 H5 URI 19 22.933 7.669 -0.750 203 H6 U 19 H6 URI 19 25.042 7.253 -1.831 204 H5' U 20 H5' URI 20 26.832 13.521 -5.009 205 H5'' U 20 H5'' URI 20 25.239 12.751 -5.116 206 H4' U 20 H4' URI 20 25.587 14.127 -7.035 207 H3' U 20 H3' URI 20 24.607 11.669 -7.374 208 H2' U 20 H2'' URI 20 26.785 10.576 -7.623 209 HO2' U 20 H2' URI 20 26.761 9.916 -9.713 210 H1' U 20 H1' URI 20 27.513 12.880 -9.533 211 H3 U 20 H3 URI 20 31.694 11.539 -10.284 212 H5 U 20 H5 URI 20 30.979 10.123 -6.397 213 H6 U 20 H6 URI 20 28.752 11.018 -6.563 214 H5' C 21 H5' CYT 21 22.422 10.928 -9.842 215 H5'' C 21 H5'' CYT 21 21.424 12.300 -10.361 216 H4' C 21 H4' CYT 21 20.116 10.293 -9.777 217 H3' C 21 H3' CYT 21 19.280 12.793 -9.277 218 H2' C 21 H2'' CYT 21 20.272 12.951 -7.057 219 HO2' C 21 H2' CYT 21 18.478 12.619 -5.601 220 H1' C 21 H1' CYT 21 19.135 10.133 -6.581 221 H41 C 21 H41 CYT 21 22.386 10.507 -1.159 222 H42 C 21 H42 CYT 21 23.727 11.304 -1.951 223 H5 C 21 H5 CYT 21 23.713 11.880 -4.299 224 H6 C 21 H6 CYT 21 22.408 11.833 -6.358 225 H5' G 22 H5' GUA 22 17.739 10.615 -13.015 226 H5'' G 22 H5'' GUA 22 16.509 9.424 -12.547 227 H4' G 22 H4' GUA 22 18.148 8.416 -13.996 228 H3' G 22 H3' GUA 22 18.196 7.381 -11.165 229 H2' G 22 H2'' GUA 22 19.994 5.954 -11.801 230 HO2' G 22 H2' GUA 22 19.129 6.441 -14.478 231 H1' G 22 H1' GUA 22 21.039 7.745 -13.847 232 H8 G 22 H8 GUA 22 23.407 8.127 -13.122 233 H1 G 22 H1 GUA 22 21.821 7.739 -6.918 234 H21 G 22 H21 GUA 22 19.655 7.471 -6.707 235 H22 G 22 H22 GUA 22 18.582 7.383 -8.086 236 H5' A 23 H5' ADE 23 18.232 4.109 -13.331 237 H5'' A 23 H5'' ADE 23 17.032 2.873 -12.921 238 H4' A 23 H4' ADE 23 19.300 1.985 -12.853 239 H3' A 23 H3' ADE 23 17.867 2.060 -10.201 240 H2' A 23 H2'' ADE 23 19.802 0.930 -9.269 241 HO2' A 23 H2' ADE 23 21.602 0.479 -10.732 242 H1' A 23 H1' ADE 23 21.600 2.727 -10.370 243 H8 A 23 H8 ADE 23 18.408 4.588 -9.665 244 H61 A 23 H61 ADE 23 20.171 5.003 -3.747 245 H62 A 23 H62 ADE 23 18.995 5.522 -4.934 246 H2 A 23 H2 ADE 23 23.039 2.287 -5.863 247 H5' C 24 H5' CYT 24 19.370 -1.560 -10.649 248 H5'' C 24 H5'' CYT 24 18.278 -2.909 -10.287 249 H4' C 24 H4' CYT 24 20.281 -3.210 -9.051 250 H3' C 24 H3' CYT 24 17.994 -2.398 -7.263 251 H2' C 24 H2'' CYT 24 19.530 -2.690 -5.409 252 HO2' C 24 H2' CYT 24 21.347 -3.639 -7.402 253 H1' C 24 H1' CYT 24 21.541 -1.187 -6.589 254 H41 C 24 H41 CYT 24 17.846 2.952 -3.430 255 H42 C 24 H42 CYT 24 16.857 3.145 -4.856 256 H5 C 24 H5 CYT 24 17.166 1.834 -6.853 257 H6 C 24 H6 CYT 24 18.461 0.050 -7.877 258 H5' G 25 H5' GUA 25 19.714 -5.522 -5.586 259 H5'' G 25 H5'' GUA 25 18.611 -6.809 -5.071 260 H4' G 25 H4' GUA 25 20.012 -6.275 -3.247 261 H3' G 25 H3' GUA 25 17.219 -5.228 -2.799 262 H2' G 25 H2'' GUA 25 17.992 -4.549 -0.607 263 HO2' G 25 H2' GUA 25 20.455 -5.822 -1.297 264 H1' G 25 H1' GUA 25 20.311 -3.355 -1.565 265 H8 G 25 H8 GUA 25 17.775 -2.756 -4.197 266 H1 G 25 H1 GUA 25 16.963 1.034 0.909 267 H21 G 25 H21 GUA 25 18.188 0.323 2.588 268 H22 G 25 H22 GUA 25 19.219 -1.085 2.466 269 H5' U 26 H5' URI 26 18.280 -7.104 0.456 270 H5'' U 26 H5'' URI 26 17.096 -8.238 1.131 271 H4' U 26 H4' URI 26 17.777 -6.730 2.839 272 H3' U 26 H3' URI 26 14.948 -6.191 1.947 273 H2' U 26 H2'' URI 26 14.858 -4.522 3.692 274 HO2' U 26 H2' URI 26 16.809 -4.240 5.020 275 H1' U 26 H1' URI 26 17.322 -3.394 3.022 276 H3 U 26 H3 URI 26 14.041 -0.549 1.616 277 H5 U 26 H5 URI 26 14.603 -3.285 -1.515 278 H6 U 26 H6 URI 26 15.949 -4.601 -0.022 279 H5' A 27 H5' ADE 27 15.032 -6.314 5.846 280 H5'' A 27 H5'' ADE 27 13.750 -7.248 6.637 281 H4' A 27 H4' ADE 27 13.806 -5.065 7.582 282 H3' A 27 H3' ADE 27 11.375 -5.469 5.845 283 H2' A 27 H2'' ADE 27 10.675 -3.268 6.570 284 HO2' A 27 H2' ADE 27 12.973 -3.309 8.275 285 H1' A 27 H1' ADE 27 13.192 -2.110 6.165 286 H8 A 27 H8 ADE 27 12.794 -4.518 3.384 287 H61 A 27 H61 ADE 27 9.515 -0.181 0.418 288 H62 A 27 H62 ADE 27 10.377 -1.694 0.251 289 H2 A 27 H2 ADE 27 9.957 1.094 4.695 290 H5' G 28 H5' GUA 28 10.193 -3.910 9.177 291 H5'' G 28 H5'' GUA 28 8.805 -4.679 9.966 292 H4' G 28 H4' GUA 28 8.359 -2.351 9.732 293 H3' G 28 H3' GUA 28 6.710 -4.046 7.870 294 H2' G 28 H2'' GUA 28 5.640 -2.038 7.125 295 HO2' G 28 H2' GUA 28 6.070 -0.031 8.282 296 H1' G 28 H1' GUA 28 8.017 -0.444 7.211 297 H8 G 28 H8 GUA 28 8.801 -3.628 5.468 298 H1 G 28 H1 GUA 28 5.766 0.611 1.712 299 H21 G 28 H21 GUA 28 4.931 2.235 2.932 300 H22 G 28 H22 GUA 28 5.116 2.291 4.671 301 H5' U 29 H5' URI 29 1.790 -3.092 9.193 302 H5'' U 29 H5'' URI 29 2.635 -3.544 7.698 303 H4' U 29 H4' URI 29 2.058 -0.747 8.667 304 H3' U 29 H3' URI 29 0.731 -2.410 6.546 305 H2' U 29 H2'' URI 29 0.435 -0.411 5.264 306 HO2' U 29 H2' URI 29 0.051 1.385 6.321 307 H1' U 29 H1' URI 29 2.989 0.675 5.898 308 H3 U 29 H3 URI 29 3.016 -0.173 1.412 309 H5 U 29 H5 URI 29 4.136 -3.790 3.228 310 H6 U 29 H6 URI 29 3.449 -2.774 5.422 311 H5' U 30 H5' URI 30 -3.918 -1.293 5.612 312 H5'' U 30 H5'' URI 30 -2.490 -1.962 4.800 313 H4' U 30 H4' URI 30 -3.488 0.874 4.741 314 H3' U 30 H3' URI 30 -3.407 -1.289 2.653 315 H2' U 30 H2'' URI 30 -3.098 0.475 1.018 316 HO2' U 30 H2' URI 30 -3.896 2.389 1.462 317 H1' U 30 H1' URI 30 -1.074 1.724 2.444 318 H3 U 30 H3 URI 30 0.891 -0.681 -0.940 319 H5 U 30 H5 URI 30 0.689 -3.243 2.380 320 H6 U 30 H6 URI 30 -0.736 -1.627 3.447 321 H5' C 31 H5' CYT 31 -5.780 1.459 1.065 322 H5'' C 31 H5'' CYT 31 -7.319 0.806 0.471 323 H4' C 31 H4' CYT 31 -6.329 1.997 -1.308 324 H3' C 31 H3' CYT 31 -6.075 -0.979 -1.725 325 H2' C 31 H2'' CYT 31 -5.096 -0.435 -3.881 326 HO2' C 31 H2' CYT 31 -6.552 1.577 -3.981 327 H1' C 31 H1' CYT 31 -3.330 1.429 -2.821 328 H41 C 31 H41 CYT 31 -0.247 -4.132 -2.466 329 H42 C 31 H42 CYT 31 -0.913 -4.395 -0.874 330 H5 C 31 H5 CYT 31 -2.577 -2.946 0.107 331 H6 C 31 H6 CYT 31 -3.950 -0.965 -0.248 332 H5' U 32 H5' URI 32 -7.504 0.376 -5.177 333 H5'' U 32 H5'' URI 32 -8.929 -0.507 -5.752 334 H4' U 32 H4' URI 32 -7.370 -0.426 -7.525 335 H3' U 32 H3' URI 32 -7.473 -3.186 -6.314 336 H2' U 32 H2'' URI 32 -5.935 -3.861 -8.049 337 HO2' U 32 H2' URI 32 -5.546 -2.625 -9.816 338 H1' U 32 H1' URI 32 -4.250 -1.649 -7.699 339 H3 U 32 H3 URI 32 -2.112 -5.283 -5.949 340 H5 U 32 H5 URI 32 -4.635 -3.888 -2.897 341 H6 U 32 H6 URI 32 -5.666 -2.443 -4.519 342 H5' A 33 H5' ADE 33 -7.823 -3.590 -10.247 343 H5'' A 33 H5'' ADE 33 -9.114 -4.690 -10.760 344 H4' A 33 H4' ADE 33 -7.142 -5.341 -11.870 345 H3' A 33 H3' ADE 33 -7.818 -7.281 -9.665 346 H2' A 33 H2'' ADE 33 -5.934 -8.591 -10.433 347 HO2' A 33 H2' ADE 33 -4.749 -7.872 -12.301 348 H1' A 33 H1' ADE 33 -4.209 -6.403 -10.591 349 H8 A 33 H8 ADE 33 -6.375 -5.721 -7.649 350 H61 A 33 H61 ADE 33 -2.708 -9.496 -4.372 351 H62 A 33 H62 ADE 33 -3.996 -8.316 -4.280 352 H2 A 33 H2 ADE 33 -1.670 -9.961 -8.704 353 H5' A 34 H5' ADE 34 -7.134 -9.429 -12.925 354 H5'' A 34 H5'' ADE 34 -8.346 -10.676 -13.262 355 H4' A 34 H4' ADE 34 -6.214 -11.693 -13.330 356 H3' A 34 H3' ADE 34 -7.700 -12.481 -10.825 357 H2' A 34 H2'' ADE 34 -5.820 -13.946 -10.369 358 HO2' A 34 H2' ADE 34 -4.033 -13.885 -11.966 359 H1' A 34 H1' ADE 34 -3.912 -11.989 -10.882 360 H8 A 34 H8 ADE 34 -6.821 -10.234 -9.332 361 H61 A 34 H61 ADE 34 -4.606 -11.977 -3.817 362 H62 A 34 H62 ADE 34 -5.748 -10.937 -4.638 363 H2 A 34 H2 ADE 34 -2.376 -14.224 -6.987 364 H5' C 35 H5' CYT 35 -6.349 -15.822 -12.417 365 H5'' C 35 H5'' CYT 35 -7.531 -17.138 -12.527 366 H4' C 35 H4' CYT 35 -5.591 -17.968 -11.444 367 H3' C 35 H3' CYT 35 -7.858 -17.606 -9.484 368 H2' C 35 H2'' CYT 35 -6.374 -18.602 -7.840 369 HO2' C 35 H2' CYT 35 -4.708 -19.809 -8.428 370 H1' C 35 H1' CYT 35 -4.206 -16.991 -8.534 371 H41 C 35 H41 CYT 35 -7.248 -13.755 -3.980 372 H42 C 35 H42 CYT 35 -8.244 -12.984 -5.192 373 H5 C 35 H5 CYT 35 -8.211 -13.631 -7.523 374 H6 C 35 H6 CYT 35 -7.202 -15.128 -9.161 375 H5' C 36 H5' CYT 36 -6.464 -21.262 -8.829 376 H5'' C 36 H5'' CYT 36 -7.706 -22.526 -8.801 377 H4' C 36 H4' CYT 36 -6.411 -22.740 -6.830 378 H3' C 36 H3' CYT 36 -9.127 -21.570 -6.241 379 HO3' C 36 H3T CYT 36 -9.600 -23.585 -5.847 380 H2' C 36 H2'' CYT 36 -8.516 -21.620 -3.918 381 HO2' C 36 H2' CYT 36 -6.220 -23.107 -4.752 382 H1' C 36 H1' CYT 36 -5.857 -20.719 -4.355 383 H41 C 36 H41 CYT 36 -9.243 -15.618 -2.615 384 H42 C 36 H42 CYT 36 -9.722 -15.375 -4.276 385 H5 C 36 H5 CYT 36 -9.190 -16.934 -6.037 386 H6 C 36 H6 CYT 36 -8.108 -19.049 -6.562 Start of MODEL 3 1 H5' G 1 H5' GUA 1 -19.085 7.096 13.672 2 H5'' G 1 H5'' GUA 1 -18.742 8.829 13.797 3 H4' G 1 H4' GUA 1 -16.549 7.705 14.986 4 H3' G 1 H3' GUA 1 -18.033 5.475 15.020 5 H2' G 1 H2'' GUA 1 -19.999 6.456 16.060 6 HO2' G 1 H2' GUA 1 -18.236 5.544 18.112 7 H1' G 1 H1' GUA 1 -18.103 7.906 17.998 8 H8 G 1 H8 GUA 1 -21.147 8.635 15.705 9 H1 G 1 H1 GUA 1 -21.516 10.844 21.725 10 H21 G 1 H21 GUA 1 -19.713 10.287 22.846 11 H22 G 1 H22 GUA 1 -18.408 9.371 22.125 12 HO5' G 1 H5T GUA 1 -16.505 8.008 13.059 13 H5' G 2 H5' GUA 2 -17.503 3.382 17.378 14 H5'' G 2 H5'' GUA 2 -15.984 2.469 17.443 15 H4' G 2 H4' GUA 2 -17.734 0.900 17.237 16 H3' G 2 H3' GUA 2 -16.229 1.233 14.650 17 H2' G 2 H2'' GUA 2 -17.655 -0.396 13.683 18 HO2' G 2 H2' GUA 2 -17.602 -2.044 15.131 19 H1' G 2 H1' GUA 2 -19.963 0.294 15.309 20 H8 G 2 H8 GUA 2 -18.784 3.291 13.504 21 H1 G 2 H1 GUA 2 -22.255 -0.667 9.823 22 H21 G 2 H21 GUA 2 -22.490 -2.610 10.818 23 H22 G 2 H22 GUA 2 -21.800 -2.949 12.388 24 H5' A 3 H5' ADE 3 -13.876 -2.951 13.250 25 H5'' A 3 H5'' ADE 3 -14.573 -1.515 12.474 26 H4' A 3 H4' ADE 3 -15.923 -4.174 12.923 27 H3' A 3 H3' ADE 3 -14.813 -2.908 10.425 28 H2' A 3 H2'' ADE 3 -16.635 -3.857 9.225 29 HO2' A 3 H2' ADE 3 -17.954 -5.513 10.294 30 H1' A 3 H1' ADE 3 -18.526 -3.664 11.406 31 H8 A 3 H8 ADE 3 -17.013 -0.343 10.781 32 H61 A 3 H61 ADE 3 -21.202 0.449 6.291 33 H62 A 3 H62 ADE 3 -19.984 1.233 7.273 34 H2 A 3 H2 ADE 3 -21.314 -3.852 7.553 35 H5' G 4 H5' GUA 4 -15.622 -6.600 9.177 36 H5'' G 4 H5'' GUA 4 -14.154 -7.431 8.629 37 H4' G 4 H4' GUA 4 -15.835 -7.696 6.965 38 H3' G 4 H3' GUA 4 -13.379 -6.878 6.233 39 H2' G 4 H2'' GUA 4 -13.857 -4.496 6.283 40 HO2' G 4 H2' GUA 4 -13.192 -4.466 4.241 41 H1' G 4 H1' GUA 4 -16.511 -5.171 4.878 42 H8 G 4 H8 GUA 4 -15.205 -3.012 7.829 43 H1 G 4 H1 GUA 4 -19.025 -0.046 3.603 44 H21 G 4 H21 GUA 4 -19.604 -1.433 2.005 45 H22 G 4 H22 GUA 4 -19.060 -3.095 1.963 46 H5' U 5 H5' URI 5 -10.923 -9.687 4.239 47 H5'' U 5 H5'' URI 5 -12.174 -10.658 5.039 48 H4' U 5 H4' URI 5 -10.416 -8.661 6.446 49 H3' U 5 H3' URI 5 -9.259 -10.878 5.512 50 H2' U 5 H2'' URI 5 -10.698 -12.543 6.446 51 HO2' U 5 H2' URI 5 -9.023 -11.831 8.646 52 H1' U 5 H1' URI 5 -11.022 -11.011 9.054 53 H3 U 5 H3 URI 5 -14.036 -14.086 10.222 54 H5 U 5 H5 URI 5 -15.410 -12.761 6.479 55 H6 U 5 H6 URI 5 -13.411 -11.440 6.295 56 H5' G 6 H5' GUA 6 -7.100 -11.992 8.316 57 H5'' G 6 H5'' GUA 6 -5.436 -11.381 8.263 58 H4' G 6 H4' GUA 6 -5.300 -13.721 8.332 59 H3' G 6 H3' GUA 6 -4.706 -12.670 5.578 60 H2' G 6 H2'' GUA 6 -4.211 -14.935 4.928 61 HO2' G 6 H2' GUA 6 -4.483 -15.474 7.722 62 H1' G 6 H1' GUA 6 -6.521 -15.989 6.063 63 H8 G 6 H8 GUA 6 -7.638 -12.673 4.982 64 H1 G 6 H1 GUA 6 -6.899 -16.728 0.065 65 H21 G 6 H21 GUA 6 -5.781 -18.504 0.709 66 H22 G 6 H22 GUA 6 -5.207 -18.707 2.349 67 H5' G 7 H5' GUA 7 -1.841 -15.230 6.329 68 H5'' G 7 H5'' GUA 7 -0.205 -14.599 6.067 69 H4' G 7 H4' GUA 7 -0.376 -16.635 4.888 70 H3' G 7 H3' GUA 7 -0.446 -14.275 3.012 71 H2' G 7 H2'' GUA 7 -0.448 -15.891 1.209 72 HO2' G 7 H2' GUA 7 0.361 -17.830 1.518 73 H1' G 7 H1' GUA 7 -2.454 -17.450 2.333 74 H8 G 7 H8 GUA 7 -3.405 -14.031 3.315 75 H1 G 7 H1 GUA 7 -4.608 -15.231 -2.880 76 H21 G 7 H21 GUA 7 -3.597 -17.076 -3.502 77 H22 G 7 H22 GUA 7 -2.620 -18.026 -2.406 78 H5' U 8 H5' URI 8 2.232 -16.756 1.511 79 H5'' U 8 H5'' URI 8 3.789 -16.011 1.109 80 H4' U 8 H4' URI 8 3.050 -17.211 -0.787 81 H3' U 8 H3' URI 8 2.752 -14.237 -1.206 82 H2' U 8 H2'' URI 8 2.056 -14.789 -3.463 83 HO2' U 8 H2' URI 8 2.319 -16.798 -4.308 84 H1' U 8 H1' URI 8 0.272 -16.761 -2.643 85 H3 U 8 H3 URI 8 -2.181 -13.101 -3.860 86 H5 U 8 H5 URI 8 -1.192 -12.520 0.175 87 H6 U 8 H6 URI 8 0.338 -14.366 -0.015 88 H5' U 9 H5' URI 9 4.605 -15.615 -4.415 89 H5'' U 9 H5'' URI 9 6.040 -14.696 -4.905 90 H4' U 9 H4' URI 9 4.621 -14.901 -6.786 91 H3' U 9 H3' URI 9 4.577 -12.095 -5.691 92 H2' U 9 H2'' URI 9 3.147 -11.524 -7.546 93 HO2' U 9 H2' URI 9 2.868 -12.875 -9.275 94 H1' U 9 H1' URI 9 1.505 -13.780 -7.254 95 H3 U 9 H3 URI 9 -0.887 -10.165 -5.829 96 H5 U 9 H5 URI 9 1.352 -11.424 -2.509 97 H6 U 9 H6 URI 9 2.589 -12.860 -3.992 98 H5' A 10 H5' ADE 10 5.146 -11.846 -9.594 99 H5'' A 10 H5'' ADE 10 6.438 -10.740 -10.101 100 H4' A 10 H4' ADE 10 4.478 -10.158 -11.286 101 H3' A 10 H3' ADE 10 5.110 -8.143 -9.139 102 H2' A 10 H2'' ADE 10 3.233 -6.869 -9.932 103 HO2' A 10 H2' ADE 10 3.087 -8.770 -12.067 104 H1' A 10 H1' ADE 10 1.532 -9.098 -10.191 105 H8 A 10 H8 ADE 10 3.466 -9.660 -7.075 106 H61 A 10 H61 ADE 10 -0.588 -5.955 -4.214 107 H62 A 10 H62 ADE 10 0.705 -7.111 -3.988 108 H2 A 10 H2 ADE 10 -1.208 -5.549 -8.636 109 H5' G 11 H5' GUA 11 4.376 -6.081 -12.400 110 H5'' G 11 H5'' GUA 11 5.594 -4.856 -12.810 111 H4' G 11 H4' GUA 11 3.480 -3.790 -12.770 112 H3' G 11 H3' GUA 11 5.160 -3.075 -10.378 113 H2' G 11 H2'' GUA 11 3.400 -1.627 -9.666 114 HO2' G 11 H2' GUA 11 1.575 -1.277 -11.148 115 H1' G 11 H1' GUA 11 1.288 -3.374 -10.472 116 H8 G 11 H8 GUA 11 3.826 -5.380 -8.657 117 H1 G 11 H1 GUA 11 -0.022 -2.037 -4.754 118 H21 G 11 H21 GUA 11 -1.162 -0.559 -5.911 119 H22 G 11 H22 GUA 11 -0.986 -0.386 -7.643 120 H5' U 12 H5' URI 12 6.448 1.779 -10.356 121 H5'' U 12 H5'' URI 12 6.188 0.486 -9.172 122 H4' U 12 H4' URI 12 4.282 2.654 -10.008 123 H3' U 12 H3' URI 12 5.750 2.103 -7.445 124 H2' U 12 H2'' URI 12 3.880 3.048 -6.263 125 HO2' U 12 H2' URI 12 3.550 4.639 -8.125 126 H1' U 12 H1' URI 12 1.959 1.632 -7.702 127 H3 U 12 H3 URI 12 2.427 -0.305 -3.568 128 H5 U 12 H5 URI 12 5.108 -2.272 -6.134 129 H6 U 12 H6 URI 12 4.682 -0.561 -7.767 130 H5' C 13 H5' CYT 13 4.345 5.789 -6.776 131 H5'' C 13 H5'' CYT 13 5.653 6.930 -6.403 132 H4' C 13 H4' CYT 13 4.053 7.146 -4.693 133 H3' C 13 H3' CYT 13 6.471 5.616 -3.760 134 H2' C 13 H2'' CYT 13 5.467 5.585 -1.564 135 HO2' C 13 H2' CYT 13 3.780 6.858 -1.031 136 H1' C 13 H1' CYT 13 2.998 4.725 -2.476 137 H41 C 13 H41 CYT 13 6.387 -0.582 -1.506 138 H42 C 13 H42 CYT 13 6.802 -0.591 -3.205 139 H5 C 13 H5 CYT 13 6.225 1.213 -4.707 140 H6 C 13 H6 CYT 13 5.171 3.403 -4.878 141 H5' U 14 H5' URI 14 5.914 8.253 -0.850 142 H5'' U 14 H5'' URI 14 7.345 9.240 -0.497 143 H4' U 14 H4' URI 14 6.586 8.340 1.546 144 H3' U 14 H3' URI 14 9.090 6.954 0.609 145 H2' U 14 H2'' URI 14 9.047 5.712 2.674 146 HO2' U 14 H2' URI 14 7.617 6.217 4.320 147 H1' U 14 H1' URI 14 6.355 5.043 2.454 148 H3 U 14 H3 URI 14 8.847 1.376 1.303 149 H5 U 14 H5 URI 14 8.297 3.581 -2.227 150 H6 U 14 H6 URI 14 7.457 5.381 -0.880 151 H5' A 15 H5' ADE 15 9.679 7.836 4.414 152 H5'' A 15 H5'' ADE 15 11.213 8.657 4.757 153 H4' A 15 H4' ADE 15 11.052 6.807 6.214 154 H3' A 15 H3' ADE 15 13.057 6.305 4.023 155 H2' A 15 H2'' ADE 15 13.558 4.217 5.144 156 HO2' A 15 H2' ADE 15 13.000 5.354 7.318 157 H1' A 15 H1' ADE 15 10.900 3.480 5.384 158 H8 A 15 H8 ADE 15 10.910 5.365 2.220 159 H61 A 15 H61 ADE 15 13.090 0.294 -0.576 160 H62 A 15 H62 ADE 15 12.372 1.871 -0.817 161 H2 A 15 H2 ADE 15 13.461 -0.295 3.857 162 H5' C 16 H5' CYT 16 14.934 5.271 7.349 163 H5'' C 16 H5'' CYT 16 16.551 5.972 7.536 164 H4' C 16 H4' CYT 16 16.745 3.628 7.795 165 H3' C 16 H3' CYT 16 17.849 4.531 5.142 166 H2' C 16 H2'' CYT 16 18.535 2.232 4.801 167 HO2' C 16 H2' CYT 16 18.982 1.098 6.539 168 H1' C 16 H1' CYT 16 16.054 1.187 5.496 169 H41 C 16 H41 CYT 16 15.630 2.415 -0.742 170 H42 C 16 H42 CYT 16 15.026 4.008 -0.370 171 H5 C 16 H5 CYT 16 14.973 4.900 1.860 172 H6 C 16 H6 CYT 16 15.444 4.439 4.197 173 H5' G 17 H5' GUA 17 20.631 2.153 6.602 174 H5'' G 17 H5'' GUA 17 22.255 2.867 6.610 175 H4' G 17 H4' GUA 17 22.412 0.764 5.539 176 H3' G 17 H3' GUA 17 22.558 3.025 3.543 177 H2' G 17 H2'' GUA 17 22.978 1.321 1.875 178 HO2' G 17 H2' GUA 17 24.189 0.021 3.663 179 H1' G 17 H1' GUA 17 20.949 -0.385 2.801 180 H8 G 17 H8 GUA 17 19.634 3.072 3.112 181 H1 G 17 H1 GUA 17 19.440 0.864 -2.909 182 H21 G 17 H21 GUA 17 20.648 -0.963 -3.086 183 H22 G 17 H22 GUA 17 21.505 -1.656 -1.726 184 H5' U 18 H5' URI 18 25.618 0.726 2.560 185 H5'' U 18 H5'' URI 18 27.157 1.600 2.430 186 H4' U 18 H4' URI 18 26.828 0.417 0.401 187 H3' U 18 H3' URI 18 26.337 3.374 0.064 188 H2' U 18 H2'' URI 18 25.957 2.936 -2.262 189 HO2' U 18 H2' URI 18 26.627 1.050 -3.242 190 H1' U 18 H1' URI 18 24.590 0.451 -1.823 191 H3 U 18 H3 URI 18 21.691 3.308 -3.896 192 H5 U 18 H5 URI 18 21.680 4.460 0.143 193 H6 U 18 H6 URI 18 23.504 2.940 0.502 194 H5' U 19 H5' URI 19 29.284 6.292 -2.126 195 H5'' U 19 H5'' URI 19 27.675 6.238 -1.377 196 H4' U 19 H4' URI 19 28.396 5.675 -4.248 197 H3' U 19 H3' URI 19 26.880 7.944 -2.972 198 H2' U 19 H2'' URI 19 25.577 8.059 -4.996 199 HO2' U 19 H2' URI 19 26.207 7.114 -6.840 200 H1' U 19 H1' URI 19 25.109 5.328 -5.088 201 H3 U 19 H3 URI 19 21.288 7.334 -3.646 202 H5 U 19 H5 URI 19 23.597 6.680 -0.199 203 H6 U 19 H6 URI 19 25.427 6.064 -1.635 204 H5' U 20 H5' URI 20 25.732 10.425 -5.824 205 H5'' U 20 H5'' URI 20 25.699 11.735 -4.626 206 H4' U 20 H4' URI 20 23.959 9.357 -4.919 207 H3' U 20 H3' URI 20 23.259 11.862 -5.290 208 H2' U 20 H2'' URI 20 24.067 12.747 -3.177 209 HO2' U 20 H2' URI 20 22.116 12.800 -1.776 210 H1' U 20 H1' URI 20 22.766 10.415 -1.690 211 H3 U 20 H3 URI 20 24.460 12.632 1.893 212 H5 U 20 H5 URI 20 27.805 11.305 -0.277 213 H6 U 20 H6 URI 20 26.299 10.632 -2.035 214 H5' C 21 H5' CYT 21 19.641 12.499 -5.681 215 H5'' C 21 H5'' CYT 21 18.938 11.277 -6.763 216 H4' C 21 H4' CYT 21 18.557 13.484 -7.639 217 H3' C 21 H3' CYT 21 19.393 11.485 -9.225 218 H2' C 21 H2'' CYT 21 21.757 11.937 -9.130 219 HO2' C 21 H2' CYT 21 21.008 12.205 -11.349 220 H1' C 21 H1' CYT 21 21.172 14.939 -9.327 221 H41 C 21 H41 CYT 21 27.206 15.481 -7.446 222 H42 C 21 H42 CYT 21 27.118 14.008 -6.506 223 H5 C 21 H5 CYT 21 25.122 12.629 -6.399 224 H6 C 21 H6 CYT 21 22.818 12.410 -7.155 225 H5' G 22 H5' GUA 22 16.226 9.984 -11.406 226 H5'' G 22 H5'' GUA 22 17.413 9.800 -10.098 227 H4' G 22 H4' GUA 22 17.738 9.167 -13.022 228 H3' G 22 H3' GUA 22 17.730 7.443 -10.553 229 H2' G 22 H2'' GUA 22 19.447 6.121 -11.532 230 HO2' G 22 H2' GUA 22 19.590 5.810 -13.688 231 H1' G 22 H1' GUA 22 20.534 8.269 -13.191 232 H8 G 22 H8 GUA 22 22.963 8.048 -12.631 233 H1 G 22 H1 GUA 22 21.690 6.864 -6.455 234 H21 G 22 H21 GUA 22 19.529 6.913 -6.107 235 H22 G 22 H22 GUA 22 18.379 7.235 -7.386 236 H5' A 23 H5' ADE 23 17.556 4.711 -13.337 237 H5'' A 23 H5'' ADE 23 16.295 3.485 -13.122 238 H4' A 23 H4' ADE 23 18.479 2.450 -13.236 239 H3' A 23 H3' ADE 23 17.179 2.250 -10.523 240 H2' A 23 H2'' ADE 23 19.082 0.899 -9.860 241 HO2' A 23 H2' ADE 23 20.600 0.215 -11.330 242 H1' A 23 H1' ADE 23 20.934 2.724 -10.819 243 H8 A 23 H8 ADE 23 17.860 4.593 -9.672 244 H61 A 23 H61 ADE 23 20.074 4.268 -3.903 245 H62 A 23 H62 ADE 23 18.844 4.967 -4.931 246 H2 A 23 H2 ADE 23 22.651 1.701 -6.528 247 H5' C 24 H5' CYT 24 18.437 -1.368 -11.461 248 H5'' C 24 H5'' CYT 24 17.279 -2.682 -11.186 249 H4' C 24 H4' CYT 24 19.309 -3.241 -10.098 250 H3' C 24 H3' CYT 24 17.182 -2.473 -8.107 251 H2' C 24 H2'' CYT 24 18.778 -3.054 -6.382 252 HO2' C 24 H2' CYT 24 20.446 -3.897 -8.548 253 H1' C 24 H1' CYT 24 20.832 -1.570 -7.515 254 H41 C 24 H41 CYT 24 17.576 2.457 -3.784 255 H42 C 24 H42 CYT 24 16.533 2.847 -5.128 256 H5 C 24 H5 CYT 24 16.659 1.722 -7.251 257 H6 C 24 H6 CYT 24 17.780 -0.029 -8.506 258 H5' G 25 H5' GUA 25 18.764 -5.837 -6.814 259 H5'' G 25 H5'' GUA 25 17.596 -7.093 -6.370 260 H4' G 25 H4' GUA 25 19.102 -6.832 -4.568 261 H3' G 25 H3' GUA 25 16.413 -5.634 -3.908 262 H2' G 25 H2'' GUA 25 17.316 -5.230 -1.691 263 HO2' G 25 H2' GUA 25 18.755 -7.310 -2.056 264 H1' G 25 H1' GUA 25 19.677 -4.113 -2.639 265 H8 G 25 H8 GUA 25 17.091 -3.097 -5.086 266 H1 G 25 H1 GUA 25 16.789 0.278 0.357 267 H21 G 25 H21 GUA 25 18.013 -0.671 1.911 268 H22 G 25 H22 GUA 25 18.921 -2.140 1.621 269 H5' U 26 H5' URI 26 17.377 -7.894 -0.841 270 H5'' U 26 H5'' URI 26 16.109 -8.993 -0.271 271 H4' U 26 H4' URI 26 16.904 -7.729 1.575 272 H3' U 26 H3' URI 26 14.138 -6.858 0.750 273 H2' U 26 H2'' URI 26 14.179 -5.375 2.654 274 HO2' U 26 H2' URI 26 16.572 -6.789 3.309 275 H1' U 26 H1' URI 26 16.757 -4.422 2.117 276 H3 U 26 H3 URI 26 13.786 -1.114 1.049 277 H5 U 26 H5 URI 26 14.054 -3.556 -2.354 278 H6 U 26 H6 URI 26 15.270 -5.145 -1.026 279 H5' A 27 H5' ADE 27 14.157 -7.387 4.630 280 H5'' A 27 H5'' ADE 27 12.794 -8.306 5.291 281 H4' A 27 H4' ADE 27 12.971 -6.280 6.499 282 H3' A 27 H3' ADE 27 10.593 -6.262 4.654 283 H2' A 27 H2'' ADE 27 10.032 -4.114 5.592 284 HO2' A 27 H2' ADE 27 12.115 -4.705 7.456 285 H1' A 27 H1' ADE 27 12.654 -3.121 5.466 286 H8 A 27 H8 ADE 27 12.229 -5.124 2.382 287 H61 A 27 H61 ADE 27 9.443 -0.214 -0.153 288 H62 A 27 H62 ADE 27 10.173 -1.773 -0.467 289 H2 A 27 H2 ADE 27 9.778 0.507 4.261 290 H5' G 28 H5' GUA 28 9.387 -5.069 8.175 291 H5'' G 28 H5'' GUA 28 7.907 -5.836 8.781 292 H4' G 28 H4' GUA 28 7.618 -3.488 8.903 293 H3' G 28 H3' GUA 28 6.009 -4.712 6.673 294 H2' G 28 H2'' GUA 28 5.135 -2.533 6.216 295 HO2' G 28 H2' GUA 28 4.704 -1.421 7.980 296 H1' G 28 H1' GUA 28 7.604 -1.172 6.681 297 H8 G 28 H8 GUA 28 8.309 -4.146 4.579 298 H1 G 28 H1 GUA 28 5.878 0.765 1.233 299 H21 G 28 H21 GUA 28 5.077 2.285 2.599 300 H22 G 28 H22 GUA 28 5.132 2.104 4.339 301 H5' U 29 H5' URI 29 1.078 -3.762 7.618 302 H5'' U 29 H5'' URI 29 2.137 -3.799 6.195 303 H4' U 29 H4' URI 29 1.236 -1.405 7.779 304 H3' U 29 H3' URI 29 0.616 -2.324 4.984 305 H2' U 29 H2'' URI 29 0.408 0.013 4.392 306 HO2' U 29 H2' URI 29 0.853 0.509 7.173 307 H1' U 29 H1' URI 29 2.830 0.709 5.535 308 H3 U 29 H3 URI 29 3.473 0.301 1.023 309 H5 U 29 H5 URI 29 4.201 -3.526 2.595 310 H6 U 29 H6 URI 29 3.270 -2.687 4.772 311 H5' U 30 H5' URI 30 -2.003 0.552 5.646 312 H5'' U 30 H5'' URI 30 -3.669 0.073 5.270 313 H4' U 30 H4' URI 30 -3.250 2.077 4.103 314 H3' U 30 H3' URI 30 -3.194 -0.299 2.244 315 H2' U 30 H2'' URI 30 -2.935 1.317 0.448 316 HO2' U 30 H2' URI 30 -3.805 3.227 0.766 317 H1' U 30 H1' URI 30 -0.888 2.689 1.728 318 H3 U 30 H3 URI 30 1.050 0.086 -1.504 319 H5 U 30 H5 URI 30 0.781 -2.336 1.915 320 H6 U 30 H6 URI 30 -0.610 -0.644 2.911 321 H5' C 31 H5' CYT 31 -5.633 2.280 0.396 322 H5'' C 31 H5'' CYT 31 -7.163 1.525 -0.088 323 H4' C 31 H4' CYT 31 -6.268 2.569 -2.000 324 H3' C 31 H3' CYT 31 -5.901 -0.423 -2.140 325 H2' C 31 H2'' CYT 31 -5.001 -0.046 -4.363 326 HO2' C 31 H2' CYT 31 -4.988 2.066 -5.250 327 H1' C 31 H1' CYT 31 -3.304 1.998 -3.543 328 H41 C 31 H41 CYT 31 0.069 -3.358 -2.810 329 H42 C 31 H42 CYT 31 -0.543 -3.517 -1.180 330 H5 C 31 H5 CYT 31 -2.247 -2.060 -0.270 331 H6 C 31 H6 CYT 31 -3.732 -0.187 -0.752 332 H5' U 32 H5' URI 32 -7.496 0.537 -5.661 333 H5'' U 32 H5'' URI 32 -8.897 -0.458 -6.094 334 H4' U 32 H4' URI 32 -7.405 -0.486 -7.925 335 H3' U 32 H3' URI 32 -7.334 -3.114 -6.448 336 H2' U 32 H2'' URI 32 -5.827 -3.885 -8.172 337 HO2' U 32 H2' URI 32 -5.360 -2.514 -9.974 338 H1' U 32 H1' URI 32 -4.244 -1.569 -8.109 339 H3 U 32 H3 URI 32 -1.851 -4.908 -6.108 340 H5 U 32 H5 URI 32 -4.329 -3.345 -3.102 341 H6 U 32 H6 URI 32 -5.493 -2.119 -4.813 342 H5' A 33 H5' ADE 33 -7.856 -3.916 -10.326 343 H5'' A 33 H5'' ADE 33 -9.112 -5.118 -10.656 344 H4' A 33 H4' ADE 33 -7.175 -5.778 -11.814 345 H3' A 33 H3' ADE 33 -7.621 -7.533 -9.405 346 H2' A 33 H2'' ADE 33 -5.711 -8.811 -10.169 347 HO2' A 33 H2' ADE 33 -5.376 -8.869 -12.264 348 H1' A 33 H1' ADE 33 -4.123 -6.563 -10.615 349 H8 A 33 H8 ADE 33 -6.182 -5.717 -7.637 350 H61 A 33 H61 ADE 33 -2.162 -8.958 -4.224 351 H62 A 33 H62 ADE 33 -3.509 -7.844 -4.181 352 H2 A 33 H2 ADE 33 -1.307 -9.794 -8.544 353 H5' A 34 H5' ADE 34 -7.011 -9.923 -12.512 354 H5'' A 34 H5'' ADE 34 -8.160 -11.264 -12.663 355 H4' A 34 H4' ADE 34 -5.973 -12.153 -12.777 356 H3' A 34 H3' ADE 34 -7.262 -12.814 -10.130 357 H2' A 34 H2'' ADE 34 -5.264 -14.115 -9.675 358 HO2' A 34 H2' ADE 34 -3.641 -14.308 -11.296 359 H1' A 34 H1' ADE 34 -3.527 -12.089 -10.452 360 H8 A 34 H8 ADE 34 -6.469 -10.394 -8.890 361 H61 A 34 H61 ADE 34 -3.865 -11.512 -3.388 362 H62 A 34 H62 ADE 34 -5.113 -10.621 -4.232 363 H2 A 34 H2 ADE 34 -1.660 -13.894 -6.484 364 H5' C 35 H5' CYT 35 -5.786 -16.196 -11.551 365 H5'' C 35 H5'' CYT 35 -6.884 -17.586 -11.479 366 H4' C 35 H4' CYT 35 -4.834 -18.209 -10.470 367 H3' C 35 H3' CYT 35 -6.991 -17.826 -8.395 368 H2' C 35 H2'' CYT 35 -5.347 -18.599 -6.785 369 HO2' C 35 H2' CYT 35 -3.707 -19.805 -7.412 370 H1' C 35 H1' CYT 35 -3.346 -16.908 -7.725 371 H41 C 35 H41 CYT 35 -6.409 -13.512 -3.295 372 H42 C 35 H42 CYT 35 -7.514 -12.922 -4.515 373 H5 C 35 H5 CYT 35 -7.536 -13.763 -6.781 374 H6 C 35 H6 CYT 35 -6.496 -15.324 -8.338 375 H5' C 36 H5' CYT 36 -5.324 -21.323 -7.550 376 H5'' C 36 H5'' CYT 36 -6.475 -22.655 -7.348 377 H4' C 36 H4' CYT 36 -5.060 -22.634 -5.451 378 H3' C 36 H3' CYT 36 -7.802 -21.578 -4.777 379 HO3' C 36 H3T CYT 36 -7.741 -23.678 -5.324 380 H2' C 36 H2'' CYT 36 -7.050 -21.419 -2.498 381 HO2' C 36 H2' CYT 36 -5.823 -23.476 -2.680 382 H1' C 36 H1' CYT 36 -4.516 -20.349 -3.164 383 H41 C 36 H41 CYT 36 -8.236 -15.380 -1.746 384 H42 C 36 H42 CYT 36 -8.798 -15.338 -3.397 385 H5 C 36 H5 CYT 36 -8.206 -17.009 -5.029 386 H6 C 36 H6 CYT 36 -6.986 -19.080 -5.403 Start of MODEL 4 1 H5' G 1 H5' GUA 1 -32.323 -25.980 13.239 2 H5'' G 1 H5'' GUA 1 -33.074 -25.671 14.812 3 H4' G 1 H4' GUA 1 -32.159 -23.757 12.724 4 H3' G 1 H3' GUA 1 -30.918 -24.347 15.010 5 H2' G 1 H2'' GUA 1 -32.747 -23.843 16.513 6 HO2' G 1 H2' GUA 1 -32.132 -21.995 17.526 7 H1' G 1 H1' GUA 1 -33.339 -21.312 14.883 8 H8 G 1 H8 GUA 1 -35.155 -24.465 16.222 9 H1 G 1 H1 GUA 1 -37.877 -18.812 17.583 10 H21 G 1 H21 GUA 1 -36.663 -17.173 16.771 11 H22 G 1 H22 GUA 1 -35.179 -17.455 15.892 12 HO5' G 1 H5T GUA 1 -34.739 -26.310 13.602 13 H5' G 2 H5' GUA 2 -26.732 -22.261 13.923 14 H5'' G 2 H5'' GUA 2 -26.472 -23.202 15.404 15 H4' G 2 H4' GUA 2 -27.975 -20.642 15.020 16 H3' G 2 H3' GUA 2 -25.438 -20.867 15.871 17 H2' G 2 H2'' GUA 2 -25.917 -22.369 17.728 18 HO2' G 2 H2' GUA 2 -25.513 -21.127 19.474 19 H1' G 2 H1' GUA 2 -28.334 -20.564 18.339 20 H8 G 2 H8 GUA 2 -27.444 -24.328 18.033 21 H1 G 2 H1 GUA 2 -30.760 -22.593 23.252 22 H21 G 2 H21 GUA 2 -31.107 -20.426 23.239 23 H22 G 2 H22 GUA 2 -30.528 -19.390 21.953 24 H5' A 3 H5' ADE 3 -23.205 -17.113 14.763 25 H5'' A 3 H5'' ADE 3 -23.496 -18.644 13.917 26 H4' A 3 H4' ADE 3 -21.667 -18.232 16.280 27 H3' A 3 H3' ADE 3 -21.045 -18.479 13.343 28 H2' A 3 H2'' ADE 3 -19.079 -19.692 13.936 29 HO2' A 3 H2' ADE 3 -19.572 -18.920 16.642 30 H1' A 3 H1' ADE 3 -20.284 -21.087 16.128 31 H8 A 3 H8 ADE 3 -22.545 -21.361 13.198 32 H61 A 3 H61 ADE 3 -19.045 -26.082 11.244 33 H62 A 3 H62 ADE 3 -20.551 -25.223 11.016 34 H2 A 3 H2 ADE 3 -16.873 -24.030 14.587 35 H5' G 4 H5' GUA 4 -16.759 -16.148 12.128 36 H5'' G 4 H5'' GUA 4 -17.761 -17.450 11.463 37 H4' G 4 H4' GUA 4 -15.404 -17.731 13.319 38 H3' G 4 H3' GUA 4 -15.703 -18.298 10.382 39 H2' G 4 H2'' GUA 4 -14.288 -20.198 10.651 40 HO2' G 4 H2' GUA 4 -13.203 -20.489 12.754 41 H1' G 4 H1' GUA 4 -15.308 -20.950 13.213 42 H8 G 4 H8 GUA 4 -18.208 -20.254 11.039 43 H1 G 4 H1 GUA 4 -15.559 -25.992 9.912 44 H21 G 4 H21 GUA 4 -13.600 -26.124 10.892 45 H22 G 4 H22 GUA 4 -12.929 -24.808 11.829 46 H5' U 5 H5' URI 5 -14.347 -16.740 8.143 47 H5'' U 5 H5'' URI 5 -12.603 -16.963 8.390 48 H4' U 5 H4' URI 5 -12.939 -15.895 6.296 49 H3' U 5 H3' URI 5 -11.771 -14.054 8.366 50 H2' U 5 H2'' URI 5 -11.710 -12.325 6.709 51 HO2' U 5 H2' URI 5 -11.834 -12.742 4.574 52 H1' U 5 H1' URI 5 -14.265 -12.843 5.696 53 H3 U 5 H3 URI 5 -14.421 -8.915 8.042 54 H5 U 5 H5 URI 5 -15.040 -11.964 10.866 55 H6 U 5 H6 URI 5 -14.451 -13.561 9.158 56 H5' G 6 H5' GUA 6 -8.627 -16.641 7.838 57 H5'' G 6 H5'' GUA 6 -7.017 -15.891 7.797 58 H4' G 6 H4' GUA 6 -6.900 -18.201 7.127 59 H3' G 6 H3' GUA 6 -6.299 -16.230 4.928 60 H2' G 6 H2'' GUA 6 -5.777 -18.130 3.535 61 HO2' G 6 H2' GUA 6 -6.211 -19.698 5.890 62 H1' G 6 H1' GUA 6 -8.091 -19.516 4.213 63 H8 G 6 H8 GUA 6 -9.162 -15.971 4.260 64 H1 G 6 H1 GUA 6 -8.362 -18.284 -1.679 65 H21 G 6 H21 GUA 6 -7.324 -20.219 -1.605 66 H22 G 6 H22 GUA 6 -6.819 -20.954 -0.100 67 H5' G 7 H5' GUA 7 -3.452 -18.880 4.826 68 H5'' G 7 H5'' GUA 7 -1.806 -18.229 4.765 69 H4' G 7 H4' GUA 7 -2.039 -19.814 3.022 70 H3' G 7 H3' GUA 7 -1.985 -16.999 1.932 71 H2' G 7 H2'' GUA 7 -2.009 -18.023 -0.265 72 HO2' G 7 H2' GUA 7 -1.861 -20.279 -0.492 73 H1' G 7 H1' GUA 7 -4.085 -19.769 0.351 74 H8 G 7 H8 GUA 7 -4.876 -16.641 2.187 75 H1 G 7 H1 GUA 7 -5.987 -16.195 -4.124 76 H21 G 7 H21 GUA 7 -5.104 -17.907 -5.169 77 H22 G 7 H22 GUA 7 -4.234 -19.173 -4.329 78 H5' U 8 H5' URI 8 0.603 -19.123 -0.132 79 H5'' U 8 H5'' URI 8 2.195 -18.384 -0.360 80 H4' U 8 H4' URI 8 1.378 -19.080 -2.473 81 H3' U 8 H3' URI 8 1.307 -16.073 -2.205 82 H2' U 8 H2'' URI 8 0.579 -16.046 -4.516 83 HO2' U 8 H2' URI 8 0.662 -17.840 -5.799 84 H1' U 8 H1' URI 8 -1.342 -18.025 -4.152 85 H3 U 8 H3 URI 8 -3.478 -14.009 -4.548 86 H5 U 8 H5 URI 8 -2.451 -14.339 -0.491 87 H6 U 8 H6 URI 8 -1.107 -16.254 -1.066 88 H5' U 9 H5' URI 9 3.075 -16.944 -5.624 89 H5'' U 9 H5'' URI 9 4.576 -16.066 -5.966 90 H4' U 9 H4' URI 9 3.125 -15.833 -7.829 91 H3' U 9 H3' URI 9 3.352 -13.263 -6.271 92 H2' U 9 H2'' URI 9 1.958 -12.253 -7.952 93 HO2' U 9 H2' URI 9 2.133 -14.739 -9.355 94 H1' U 9 H1' URI 9 0.125 -14.380 -8.026 95 H3 U 9 H3 URI 9 -1.911 -10.844 -5.986 96 H5 U 9 H5 URI 9 0.219 -12.821 -2.956 97 H6 U 9 H6 URI 9 1.306 -14.110 -4.674 98 H5' A 10 H5' ADE 10 3.913 -12.490 -10.101 99 H5'' A 10 H5'' ADE 10 5.284 -11.435 -10.491 100 H4' A 10 H4' ADE 10 3.346 -10.559 -11.536 101 H3' A 10 H3' ADE 10 4.207 -8.870 -9.194 102 H2' A 10 H2'' ADE 10 2.424 -7.364 -9.767 103 HO2' A 10 H2' ADE 10 2.028 -8.987 -12.089 104 H1' A 10 H1' ADE 10 0.532 -9.398 -10.206 105 H8 A 10 H8 ADE 10 2.531 -10.457 -7.255 106 H61 A 10 H61 ADE 10 -1.091 -6.779 -3.835 107 H62 A 10 H62 ADE 10 0.111 -8.049 -3.795 108 H2 A 10 H2 ADE 10 -1.853 -5.855 -8.156 109 H5' G 11 H5' GUA 11 3.560 -6.437 -12.198 110 H5'' G 11 H5'' GUA 11 4.846 -5.260 -12.529 111 H4' G 11 H4' GUA 11 2.797 -4.080 -12.321 112 H3' G 11 H3' GUA 11 4.598 -3.667 -9.940 113 H2' G 11 H2'' GUA 11 2.944 -2.184 -9.056 114 HO2' G 11 H2' GUA 11 1.132 -1.560 -10.407 115 H1' G 11 H1' GUA 11 0.713 -3.747 -9.917 116 H8 G 11 H8 GUA 11 3.220 -6.003 -8.345 117 H1 G 11 H1 GUA 11 -0.324 -2.769 -4.073 118 H21 G 11 H21 GUA 11 -1.450 -1.179 -5.082 119 H22 G 11 H22 GUA 11 -1.341 -0.902 -6.806 120 H5' U 12 H5' URI 12 5.995 1.252 -9.735 121 H5'' U 12 H5'' URI 12 5.813 -0.078 -8.580 122 H4' U 12 H4' URI 12 3.826 2.072 -9.253 123 H3' U 12 H3' URI 12 5.494 1.564 -6.811 124 H2' U 12 H2'' URI 12 3.693 2.404 -5.472 125 HO2' U 12 H2' URI 12 2.077 3.614 -6.304 126 H1' U 12 H1' URI 12 1.679 1.013 -6.842 127 H3 U 12 H3 URI 12 2.303 -1.032 -2.788 128 H5 U 12 H5 URI 12 4.863 -2.940 -5.517 129 H6 U 12 H6 URI 12 4.389 -1.174 -7.077 130 H5' C 13 H5' CYT 13 3.991 5.186 -6.124 131 H5'' C 13 H5'' CYT 13 5.224 6.440 -5.886 132 H4' C 13 H4' CYT 13 3.709 6.596 -4.086 133 H3' C 13 H3' CYT 13 6.323 5.366 -3.245 134 H2' C 13 H2'' CYT 13 5.474 5.336 -0.989 135 HO2' C 13 H2' CYT 13 3.434 6.255 -0.511 136 H1' C 13 H1' CYT 13 3.059 4.181 -1.689 137 H41 C 13 H41 CYT 13 7.049 -0.705 -0.803 138 H42 C 13 H42 CYT 13 7.293 -0.771 -2.531 139 H5 C 13 H5 CYT 13 6.385 0.876 -4.048 140 H6 C 13 H6 CYT 13 5.109 2.944 -4.213 141 H5' U 14 H5' URI 14 5.593 8.135 -0.498 142 H5'' U 14 H5'' URI 14 6.904 9.304 -0.250 143 H4' U 14 H4' URI 14 6.270 8.453 1.866 144 H3' U 14 H3' URI 14 8.937 7.359 0.990 145 H2' U 14 H2'' URI 14 9.071 6.270 3.135 146 HO2' U 14 H2' URI 14 6.651 7.676 3.730 147 H1' U 14 H1' URI 14 6.503 5.221 2.987 148 H3 U 14 H3 URI 14 9.513 1.895 2.065 149 H5 U 14 H5 URI 14 8.643 3.743 -1.605 150 H6 U 14 H6 URI 14 7.530 5.480 -0.378 151 H5' A 15 H5' ADE 15 9.367 8.617 4.718 152 H5'' A 15 H5'' ADE 15 10.780 9.646 5.008 153 H4' A 15 H4' ADE 15 10.814 7.914 6.610 154 H3' A 15 H3' ADE 15 12.918 7.502 4.495 155 H2' A 15 H2'' ADE 15 13.646 5.583 5.778 156 HO2' A 15 H2' ADE 15 11.665 6.350 7.690 157 H1' A 15 H1' ADE 15 11.092 4.543 6.062 158 H8 A 15 H8 ADE 15 10.972 6.146 2.739 159 H61 A 15 H61 ADE 15 13.803 1.137 0.454 160 H62 A 15 H62 ADE 15 12.922 2.595 0.055 161 H2 A 15 H2 ADE 15 14.090 0.980 4.929 162 H5' C 16 H5' CYT 16 14.792 6.984 7.938 163 H5'' C 16 H5'' CYT 16 16.298 7.906 8.108 164 H4' C 16 H4' CYT 16 16.792 5.640 8.565 165 H3' C 16 H3' CYT 16 17.839 6.465 5.862 166 H2' C 16 H2'' CYT 16 18.827 4.257 5.725 167 HO2' C 16 H2' CYT 16 17.869 3.918 8.398 168 H1' C 16 H1' CYT 16 16.489 2.950 6.484 169 H41 C 16 H41 CYT 16 16.040 3.509 0.157 170 H42 C 16 H42 CYT 16 15.226 5.037 0.363 171 H5 C 16 H5 CYT 16 15.005 6.126 2.497 172 H6 C 16 H6 CYT 16 15.498 5.965 4.873 173 H5' G 17 H5' GUA 17 20.888 4.618 7.562 174 H5'' G 17 H5'' GUA 17 22.393 5.557 7.534 175 H4' G 17 H4' GUA 17 22.875 3.426 6.635 176 H3' G 17 H3' GUA 17 22.731 5.525 4.470 177 H2' G 17 H2'' GUA 17 23.411 3.784 2.939 178 HO2' G 17 H2' GUA 17 24.014 1.716 3.735 179 H1' G 17 H1' GUA 17 21.665 1.854 4.006 180 H8 G 17 H8 GUA 17 19.815 5.076 3.981 181 H1 G 17 H1 GUA 17 20.115 2.324 -1.807 182 H21 G 17 H21 GUA 17 21.596 0.699 -1.797 183 H22 G 17 H22 GUA 17 22.516 0.278 -0.369 184 H5' U 18 H5' URI 18 26.119 3.631 3.743 185 H5'' U 18 H5'' URI 18 27.516 4.704 3.519 186 H4' U 18 H4' URI 18 27.389 3.272 1.630 187 H3' U 18 H3' URI 18 26.487 6.075 0.958 188 H2' U 18 H2'' URI 18 26.212 5.327 -1.299 189 HO2' U 18 H2' URI 18 27.937 4.112 -1.797 190 H1' U 18 H1' URI 18 25.198 2.744 -0.577 191 H3 U 18 H3 URI 18 21.966 4.913 -2.960 192 H5 U 18 H5 URI 18 21.713 6.484 0.925 193 H6 U 18 H6 URI 18 23.732 5.298 1.454 194 H5' U 19 H5' URI 19 29.231 8.448 -2.358 195 H5'' U 19 H5'' URI 19 27.564 8.443 -1.746 196 H4' U 19 H4' URI 19 28.646 6.938 -4.122 197 H3' U 19 H3' URI 19 26.841 9.340 -3.953 198 H2' U 19 H2'' URI 19 25.718 8.527 -5.901 199 HO2' U 19 H2' URI 19 26.655 7.193 -7.302 200 H1' U 19 H1' URI 19 25.695 5.825 -5.068 201 H3 U 19 H3 URI 19 21.414 7.414 -5.079 202 H5 U 19 H5 URI 19 23.044 8.576 -1.388 203 H6 U 19 H6 URI 19 25.186 7.825 -2.185 204 H5' U 20 H5' URI 20 26.925 9.226 -8.038 205 H5'' U 20 H5'' URI 20 28.635 9.675 -7.909 206 H4' U 20 H4' URI 20 27.419 11.977 -8.825 207 H3' U 20 H3' URI 20 25.399 10.368 -9.435 208 H2' U 20 H2'' URI 20 26.718 8.640 -10.517 209 HO2' U 20 H2' URI 20 26.191 8.810 -12.664 210 H1' U 20 H1' URI 20 28.228 10.844 -12.030 211 H3 U 20 H3 URI 20 31.126 8.031 -13.909 212 H5 U 20 H5 URI 20 30.278 6.142 -10.257 213 H6 U 20 H6 URI 20 28.760 7.943 -9.762 214 H5' C 21 H5' CYT 21 22.650 11.120 -11.653 215 H5'' C 21 H5'' CYT 21 22.267 12.823 -11.338 216 H4' C 21 H4' CYT 21 20.526 10.851 -10.956 217 H3' C 21 H3' CYT 21 20.300 13.463 -10.422 218 H2' C 21 H2'' CYT 21 21.556 13.394 -8.326 219 HO2' C 21 H2' CYT 21 18.843 12.842 -7.603 220 H1' C 21 H1' CYT 21 19.887 10.896 -7.662 221 H41 C 21 H41 CYT 21 23.746 10.518 -2.648 222 H42 C 21 H42 CYT 21 25.110 11.093 -3.580 223 H5 C 21 H5 CYT 21 24.941 11.721 -5.900 224 H6 C 21 H6 CYT 21 23.435 11.961 -7.795 225 H5' G 22 H5' GUA 22 16.848 9.729 -11.842 226 H5'' G 22 H5'' GUA 22 18.147 9.730 -10.632 227 H4' G 22 H4' GUA 22 18.236 8.809 -13.492 228 H3' G 22 H3' GUA 22 18.525 7.402 -10.867 229 H2' G 22 H2'' GUA 22 20.353 6.128 -11.677 230 HO2' G 22 H2' GUA 22 20.689 5.950 -13.997 231 H1' G 22 H1' GUA 22 21.318 8.060 -13.595 232 H8 G 22 H8 GUA 22 23.699 8.208 -12.878 233 H1 G 22 H1 GUA 22 22.127 8.127 -6.659 234 H21 G 22 H21 GUA 22 19.947 7.993 -6.429 235 H22 G 22 H22 GUA 22 18.863 7.920 -7.801 236 H5' A 23 H5' ADE 23 18.736 4.368 -12.899 237 H5'' A 23 H5'' ADE 23 17.637 3.041 -12.499 238 H4' A 23 H4' ADE 23 19.968 2.383 -12.260 239 H3' A 23 H3' ADE 23 18.403 2.435 -9.682 240 H2' A 23 H2'' ADE 23 20.398 1.540 -8.622 241 HO2' A 23 H2' ADE 23 21.496 1.489 -11.264 242 H1' A 23 H1' ADE 23 22.061 3.459 -9.736 243 H8 A 23 H8 ADE 23 18.640 4.958 -9.209 244 H61 A 23 H61 ADE 23 20.167 5.830 -3.270 245 H62 A 23 H62 ADE 23 18.970 6.147 -4.505 246 H2 A 23 H2 ADE 23 23.407 3.404 -5.202 247 H5' C 24 H5' CYT 24 20.291 -1.008 -9.907 248 H5'' C 24 H5'' CYT 24 19.331 -2.448 -9.525 249 H4' C 24 H4' CYT 24 21.312 -2.501 -8.222 250 H3' C 24 H3' CYT 24 18.900 -1.849 -6.535 251 H2' C 24 H2'' CYT 24 20.404 -1.938 -4.627 252 HO2' C 24 H2' CYT 24 21.759 -3.647 -5.905 253 H1' C 24 H1' CYT 24 22.283 -0.272 -5.808 254 H41 C 24 H41 CYT 24 18.095 3.577 -2.905 255 H42 C 24 H42 CYT 24 17.128 3.616 -4.359 256 H5 C 24 H5 CYT 24 17.624 2.271 -6.297 257 H6 C 24 H6 CYT 24 19.122 0.591 -7.220 258 H5' G 25 H5' GUA 25 20.826 -4.777 -4.653 259 H5'' G 25 H5'' GUA 25 19.786 -6.128 -4.175 260 H4' G 25 H4' GUA 25 21.035 -5.495 -2.283 261 H3' G 25 H3' GUA 25 18.168 -4.584 -2.043 262 H2' G 25 H2'' GUA 25 18.755 -3.837 0.188 263 HO2' G 25 H2' GUA 25 20.350 -4.792 1.211 264 H1' G 25 H1' GUA 25 21.069 -2.534 -0.641 265 H8 G 25 H8 GUA 25 18.653 -2.151 -3.435 266 H1 G 25 H1 GUA 25 17.384 1.759 1.483 267 H21 G 25 H21 GUA 25 18.559 1.168 3.246 268 H22 G 25 H22 GUA 25 19.668 -0.184 3.221 269 H5' U 26 H5' URI 26 19.028 -6.437 1.350 270 H5'' U 26 H5'' URI 26 17.829 -7.644 1.846 271 H4' U 26 H4' URI 26 18.229 -6.220 3.688 272 H3' U 26 H3' URI 26 15.543 -5.652 2.443 273 H2' U 26 H2'' URI 26 15.188 -4.088 4.251 274 HO2' U 26 H2' URI 26 16.446 -4.072 6.043 275 H1' U 26 H1' URI 26 17.712 -2.908 3.989 276 H3 U 26 H3 URI 26 14.611 -0.003 2.304 277 H5 U 26 H5 URI 26 15.507 -2.641 -0.836 278 H6 U 26 H6 URI 26 16.714 -3.990 0.745 279 H5' A 27 H5' ADE 27 15.026 -6.063 6.325 280 H5'' A 27 H5'' ADE 27 13.652 -7.080 6.786 281 H4' A 27 H4' ADE 27 13.471 -5.062 7.980 282 H3' A 27 H3' ADE 27 11.447 -5.178 5.756 283 H2' A 27 H2'' ADE 27 10.592 -3.084 6.601 284 HO2' A 27 H2' ADE 27 10.925 -2.496 8.627 285 H1' A 27 H1' ADE 27 13.113 -1.905 6.821 286 H8 A 27 H8 ADE 27 13.254 -4.095 3.812 287 H61 A 27 H61 ADE 27 10.433 0.420 0.659 288 H62 A 27 H62 ADE 27 11.278 -1.106 0.537 289 H2 A 27 H2 ADE 27 10.270 1.460 5.023 290 H5' G 28 H5' GUA 28 9.619 -4.195 9.100 291 H5'' G 28 H5'' GUA 28 8.116 -5.071 9.421 292 H4' G 28 H4' GUA 28 7.673 -2.779 9.692 293 H3' G 28 H3' GUA 28 6.472 -3.791 7.122 294 H2' G 28 H2'' GUA 28 5.526 -1.582 6.859 295 HO2' G 28 H2' GUA 28 5.481 -0.123 8.491 296 H1' G 28 H1' GUA 28 7.904 -0.264 7.432 297 H8 G 28 H8 GUA 28 8.944 -3.332 5.638 298 H1 G 28 H1 GUA 28 6.467 1.099 1.711 299 H21 G 28 H21 GUA 28 5.473 2.671 2.870 300 H22 G 28 H22 GUA 28 5.409 2.651 4.618 301 H5' U 29 H5' URI 29 3.718 -1.842 9.192 302 H5'' U 29 H5'' URI 29 2.115 -2.586 9.225 303 H4' U 29 H4' URI 29 1.884 -0.313 8.584 304 H3' U 29 H3' URI 29 1.408 -2.154 6.239 305 H2' U 29 H2'' URI 29 0.798 -0.134 5.026 306 HO2' U 29 H2' URI 29 0.189 1.623 6.067 307 H1' U 29 H1' URI 29 3.077 1.240 5.827 308 H3 U 29 H3 URI 29 3.687 -0.045 1.494 309 H5 U 29 H5 URI 29 4.833 -3.398 3.749 310 H6 U 29 H6 URI 29 3.876 -2.233 5.760 311 H5' U 30 H5' URI 30 -1.539 0.405 6.525 312 H5'' U 30 H5'' URI 30 -3.162 -0.255 6.274 313 H4' U 30 H4' URI 30 -2.892 1.624 4.856 314 H3' U 30 H3' URI 30 -2.847 -0.951 3.282 315 H2' U 30 H2'' URI 30 -2.753 0.469 1.308 316 HO2' U 30 H2' URI 30 -3.060 2.617 3.167 317 H1' U 30 H1' URI 30 -0.691 2.035 2.305 318 H3 U 30 H3 URI 30 1.107 -0.846 -0.768 319 H5 U 30 H5 URI 30 1.028 -2.971 2.851 320 H6 U 30 H6 URI 30 -0.277 -1.178 3.789 321 H5' C 31 H5' CYT 31 -5.484 1.510 1.592 322 H5'' C 31 H5'' CYT 31 -7.035 0.770 1.159 323 H4' C 31 H4' CYT 31 -6.200 1.888 -0.748 324 H3' C 31 H3' CYT 31 -5.946 -1.102 -1.045 325 H2' C 31 H2'' CYT 31 -5.133 -0.643 -3.288 326 HO2' C 31 H2' CYT 31 -5.717 2.089 -2.702 327 H1' C 31 H1' CYT 31 -3.328 1.294 -2.454 328 H41 C 31 H41 CYT 31 -0.138 -4.208 -2.150 329 H42 C 31 H42 CYT 31 -0.690 -4.436 -0.506 330 H5 C 31 H5 CYT 31 -2.300 -2.978 0.552 331 H6 C 31 H6 CYT 31 -3.727 -1.029 0.241 332 H5' U 32 H5' URI 32 -7.710 0.230 -4.357 333 H5'' U 32 H5'' URI 32 -9.166 -0.660 -4.828 334 H4' U 32 H4' URI 32 -7.751 -0.526 -6.716 335 H3' U 32 H3' URI 32 -7.763 -3.310 -5.563 336 H2' U 32 H2'' URI 32 -6.356 -3.948 -7.418 337 HO2' U 32 H2' URI 32 -6.215 -2.761 -9.214 338 H1' U 32 H1' URI 32 -4.654 -1.738 -7.162 339 H3 U 32 H3 URI 32 -2.383 -5.400 -5.659 340 H5 U 32 H5 URI 32 -4.631 -4.040 -2.385 341 H6 U 32 H6 URI 32 -5.813 -2.595 -3.899 342 H5' A 33 H5' ADE 33 -8.438 -3.522 -9.470 343 H5'' A 33 H5'' ADE 33 -9.754 -4.604 -9.951 344 H4' A 33 H4' ADE 33 -7.859 -5.150 -11.241 345 H3' A 33 H3' ADE 33 -8.380 -7.250 -9.143 346 H2' A 33 H2'' ADE 33 -6.546 -8.485 -10.136 347 HO2' A 33 H2' ADE 33 -7.207 -7.350 -12.353 348 H1' A 33 H1' ADE 33 -4.840 -6.285 -10.210 349 H8 A 33 H8 ADE 33 -6.828 -5.803 -7.109 350 H61 A 33 H61 ADE 33 -3.016 -9.822 -4.334 351 H62 A 33 H62 ADE 33 -4.276 -8.633 -4.084 352 H2 A 33 H2 ADE 33 -2.274 -10.014 -8.753 353 H5' A 34 H5' ADE 34 -7.917 -9.119 -12.611 354 H5'' A 34 H5'' ADE 34 -9.145 -10.341 -12.976 355 H4' A 34 H4' ADE 34 -7.015 -11.324 -13.268 356 H3' A 34 H3' ADE 34 -8.362 -12.347 -10.771 357 H2' A 34 H2'' ADE 34 -6.455 -13.830 -10.540 358 HO2' A 34 H2' ADE 34 -5.183 -14.300 -12.199 359 H1' A 34 H1' ADE 34 -4.582 -11.825 -10.960 360 H8 A 34 H8 ADE 34 -7.409 -10.200 -9.147 361 H61 A 34 H61 ADE 34 -5.007 -12.424 -3.897 362 H62 A 34 H62 ADE 34 -6.162 -11.307 -4.589 363 H2 A 34 H2 ADE 34 -2.931 -14.425 -7.335 364 H5' C 35 H5' CYT 35 -7.116 -15.513 -12.810 365 H5'' C 35 H5'' CYT 35 -8.311 -16.810 -12.995 366 H4' C 35 H4' CYT 35 -6.316 -17.753 -12.124 367 H3' C 35 H3' CYT 35 -8.475 -17.610 -10.023 368 H2' C 35 H2'' CYT 35 -6.914 -18.769 -8.569 369 HO2' C 35 H2' CYT 35 -5.407 -20.001 -9.415 370 H1' C 35 H1' CYT 35 -4.777 -17.095 -9.193 371 H41 C 35 H41 CYT 35 -7.557 -14.329 -4.190 372 H42 C 35 H42 CYT 35 -8.593 -13.425 -5.269 373 H5 C 35 H5 CYT 35 -8.675 -13.822 -7.652 374 H6 C 35 H6 CYT 35 -7.784 -15.171 -9.477 375 H5' C 36 H5' CYT 36 -7.069 -21.331 -9.865 376 H5'' C 36 H5'' CYT 36 -8.320 -22.588 -9.929 377 H4' C 36 H4' CYT 36 -6.944 -23.035 -8.056 378 H3' C 36 H3' CYT 36 -9.617 -21.924 -7.217 379 HO3' C 36 H3T CYT 36 -8.905 -24.446 -6.598 380 H2' C 36 H2'' CYT 36 -8.912 -22.249 -4.944 381 HO2' C 36 H2' CYT 36 -7.789 -24.049 -4.694 382 H1' C 36 H1' CYT 36 -6.279 -21.292 -5.377 383 H41 C 36 H41 CYT 36 -9.568 -16.384 -3.013 384 H42 C 36 H42 CYT 36 -10.089 -15.961 -4.625 385 H5 C 36 H5 CYT 36 -9.617 -17.329 -6.556 386 H6 C 36 H6 CYT 36 -8.594 -19.398 -7.326 Start of MODEL 5 1 H5' G 1 H5' GUA 1 -27.389 -14.793 -1.468 2 H5'' G 1 H5'' GUA 1 -28.841 -15.645 -0.922 3 H4' G 1 H4' GUA 1 -29.021 -15.701 -3.684 4 H3' G 1 H3' GUA 1 -27.870 -13.043 -2.860 5 H2' G 1 H2'' GUA 1 -29.378 -12.011 -4.411 6 HO2' G 1 H2' GUA 1 -30.579 -13.274 -5.893 7 H1' G 1 H1' GUA 1 -31.580 -13.666 -3.745 8 H8 G 1 H8 GUA 1 -29.906 -12.753 -0.567 9 H1 G 1 H1 GUA 1 -33.537 -8.021 -2.947 10 H21 G 1 H21 GUA 1 -34.118 -8.482 -5.013 11 H22 G 1 H22 GUA 1 -33.619 -9.950 -5.822 12 HO5' G 1 H5T GUA 1 -26.886 -16.934 -1.448 13 H5' G 2 H5' GUA 2 -24.376 -10.947 -3.919 14 H5'' G 2 H5'' GUA 2 -23.593 -12.511 -3.627 15 H4' G 2 H4' GUA 2 -24.975 -10.819 -1.542 16 H3' G 2 H3' GUA 2 -22.039 -11.082 -2.189 17 H2' G 2 H2'' GUA 2 -21.601 -10.912 0.153 18 HO2' G 2 H2' GUA 2 -23.092 -9.132 0.464 19 H1' G 2 H1' GUA 2 -23.942 -12.382 0.950 20 H8 G 2 H8 GUA 2 -22.109 -14.293 -1.654 21 H1 G 2 H1 GUA 2 -19.469 -14.799 4.182 22 H21 G 2 H21 GUA 2 -20.350 -13.314 5.536 23 H22 G 2 H22 GUA 2 -21.587 -12.189 5.020 24 H5' A 3 H5' ADE 3 -19.545 -6.956 -0.661 25 H5'' A 3 H5'' ADE 3 -19.166 -8.669 -0.930 26 H4' A 3 H4' ADE 3 -20.054 -7.408 1.662 27 H3' A 3 H3' ADE 3 -17.335 -8.302 0.736 28 H2' A 3 H2'' ADE 3 -16.890 -9.044 2.950 29 HO2' A 3 H2' ADE 3 -17.506 -7.523 4.335 30 H1' A 3 H1' ADE 3 -19.593 -9.886 3.495 31 H8 A 3 H8 ADE 3 -18.452 -11.381 0.295 32 H61 A 3 H61 ADE 3 -15.789 -15.874 3.624 33 H62 A 3 H62 ADE 3 -16.264 -15.367 2.017 34 H2 A 3 H2 ADE 3 -17.014 -12.600 6.432 35 H5' G 4 H5' GUA 4 -13.668 -5.832 3.085 36 H5'' G 4 H5'' GUA 4 -13.948 -7.448 2.411 37 H4' G 4 H4' GUA 4 -14.165 -6.572 5.278 38 H3' G 4 H3' GUA 4 -12.225 -8.375 3.859 39 H2' G 4 H2'' GUA 4 -12.044 -9.626 5.913 40 HO2' G 4 H2' GUA 4 -13.630 -7.511 7.000 41 H1' G 4 H1' GUA 4 -14.790 -9.790 6.301 42 H8 G 4 H8 GUA 4 -14.515 -9.860 2.641 43 H1 G 4 H1 GUA 4 -12.781 -15.418 5.346 44 H21 G 4 H21 GUA 4 -12.493 -15.148 7.506 45 H22 G 4 H22 GUA 4 -12.723 -13.606 8.298 46 H5' U 5 H5' URI 5 -10.608 -7.813 7.367 47 H5'' U 5 H5'' URI 5 -8.902 -7.324 7.322 48 H4' U 5 H4' URI 5 -9.057 -9.225 8.719 49 H3' U 5 H3' URI 5 -7.847 -9.945 6.043 50 H2' U 5 H2'' URI 5 -7.489 -12.158 7.046 51 HO2' U 5 H2' URI 5 -8.705 -11.071 9.389 52 H1' U 5 H1' URI 5 -10.112 -12.400 7.799 53 H3 U 5 H3 URI 5 -9.579 -14.644 3.824 54 H5 U 5 H5 URI 5 -10.726 -10.729 2.823 55 H6 U 5 H6 URI 5 -10.370 -10.125 5.118 56 H5' G 6 H5' GUA 6 -5.375 -11.670 8.508 57 H5'' G 6 H5'' GUA 6 -3.679 -11.188 8.299 58 H4' G 6 H4' GUA 6 -3.779 -13.560 8.241 59 H3' G 6 H3' GUA 6 -3.310 -12.384 5.503 60 H2' G 6 H2'' GUA 6 -3.076 -14.647 4.704 61 HO2' G 6 H2' GUA 6 -3.031 -16.395 6.133 62 H1' G 6 H1' GUA 6 -5.356 -15.559 6.037 63 H8 G 6 H8 GUA 6 -6.083 -12.083 4.896 64 H1 G 6 H1 GUA 6 -6.529 -16.411 0.203 65 H21 G 6 H21 GUA 6 -5.582 -18.297 0.816 66 H22 G 6 H22 GUA 6 -4.853 -18.512 2.390 67 H5' G 7 H5' GUA 7 -0.642 -15.223 5.926 68 H5'' G 7 H5'' GUA 7 1.015 -14.731 5.533 69 H4' G 7 H4' GUA 7 0.559 -16.701 4.317 70 H3' G 7 H3' GUA 7 0.519 -14.270 2.531 71 H2' G 7 H2'' GUA 7 0.209 -15.809 0.691 72 HO2' G 7 H2' GUA 7 0.534 -17.886 2.626 73 H1' G 7 H1' GUA 7 -1.763 -17.302 1.992 74 H8 G 7 H8 GUA 7 -2.469 -13.840 3.039 75 H1 G 7 H1 GUA 7 -4.331 -15.037 -2.992 76 H21 G 7 H21 GUA 7 -3.442 -16.918 -3.694 77 H22 G 7 H22 GUA 7 -2.388 -17.888 -2.689 78 H5' U 8 H5' URI 8 2.882 -16.894 0.708 79 H5'' U 8 H5'' URI 8 4.445 -16.229 0.208 80 H4' U 8 H4' URI 8 3.489 -17.289 -1.670 81 H3' U 8 H3' URI 8 3.312 -14.286 -1.925 82 H2' U 8 H2'' URI 8 2.398 -14.695 -4.135 83 HO2' U 8 H2' URI 8 3.161 -17.389 -3.601 84 H1' U 8 H1' URI 8 0.616 -16.659 -3.259 85 H3 U 8 H3 URI 8 -1.868 -12.934 -4.132 86 H5 U 8 H5 URI 8 -0.487 -12.466 -0.196 87 H6 U 8 H6 URI 8 0.984 -14.331 -0.577 88 H5' U 9 H5' URI 9 4.857 -15.558 -5.351 89 H5'' U 9 H5'' URI 9 6.292 -14.663 -5.884 90 H4' U 9 H4' URI 9 4.742 -14.686 -7.670 91 H3' U 9 H3' URI 9 4.868 -11.965 -6.379 92 H2' U 9 H2'' URI 9 3.330 -11.224 -8.078 93 HO2' U 9 H2' URI 9 2.972 -12.366 -9.913 94 H1' U 9 H1' URI 9 1.668 -13.494 -7.877 95 H3 U 9 H3 URI 9 -0.650 -9.978 -6.129 96 H5 U 9 H5 URI 9 1.786 -11.373 -3.006 97 H6 U 9 H6 URI 9 2.927 -12.746 -4.622 98 H5' A 10 H5' ADE 10 5.230 -11.439 -10.288 99 H5'' A 10 H5'' ADE 10 6.519 -10.323 -10.776 100 H4' A 10 H4' ADE 10 4.517 -9.615 -11.806 101 H3' A 10 H3' ADE 10 5.296 -7.783 -9.547 102 H2' A 10 H2'' ADE 10 3.398 -6.432 -10.128 103 HO2' A 10 H2' ADE 10 3.211 -8.098 -12.444 104 H1' A 10 H1' ADE 10 1.661 -8.624 -10.547 105 H8 A 10 H8 ADE 10 3.676 -9.385 -7.512 106 H61 A 10 H61 ADE 10 -0.356 -5.933 -4.318 107 H62 A 10 H62 ADE 10 0.958 -7.080 -4.195 108 H2 A 10 H2 ADE 10 -1.105 -5.266 -8.683 109 H5' G 11 H5' GUA 11 4.469 -5.481 -12.635 110 H5'' G 11 H5'' GUA 11 5.684 -4.238 -12.991 111 H4' G 11 H4' GUA 11 3.579 -3.168 -12.815 112 H3' G 11 H3' GUA 11 5.319 -2.633 -10.417 113 H2' G 11 H2'' GUA 11 3.577 -1.244 -9.563 114 HO2' G 11 H2' GUA 11 3.133 -0.132 -11.521 115 H1' G 11 H1' GUA 11 1.438 -2.902 -10.525 116 H8 G 11 H8 GUA 11 3.937 -5.016 -8.768 117 H1 G 11 H1 GUA 11 -0.009 -1.886 -4.784 118 H21 G 11 H21 GUA 11 -1.124 -0.350 -5.894 119 H22 G 11 H22 GUA 11 -0.904 -0.089 -7.609 120 H5' U 12 H5' URI 12 6.551 2.194 -10.007 121 H5'' U 12 H5'' URI 12 6.257 0.813 -8.933 122 H4' U 12 H4' URI 12 4.361 3.032 -9.660 123 H3' U 12 H3' URI 12 5.781 2.342 -7.105 124 H2' U 12 H2'' URI 12 3.879 3.212 -5.916 125 HO2' U 12 H2' URI 12 2.240 4.320 -6.970 126 H1' U 12 H1' URI 12 2.001 1.871 -7.480 127 H3 U 12 H3 URI 12 2.359 -0.265 -3.432 128 H5 U 12 H5 URI 12 5.153 -2.076 -5.991 129 H6 U 12 H6 URI 12 4.755 -0.298 -7.560 130 H5' C 13 H5' CYT 13 4.314 5.984 -6.348 131 H5'' C 13 H5'' CYT 13 5.581 7.122 -5.848 132 H4' C 13 H4' CYT 13 3.879 7.251 -4.233 133 H3' C 13 H3' CYT 13 6.248 5.699 -3.210 134 H2' C 13 H2'' CYT 13 5.097 5.581 -1.086 135 HO2' C 13 H2' CYT 13 3.383 6.837 -0.617 136 H1' C 13 H1' CYT 13 2.695 4.754 -2.195 137 H41 C 13 H41 CYT 13 6.006 -0.587 -1.137 138 H42 C 13 H42 CYT 13 6.583 -0.526 -2.787 139 H5 C 13 H5 CYT 13 6.135 1.333 -4.268 140 H6 C 13 H6 CYT 13 5.089 3.523 -4.455 141 H5' U 14 H5' URI 14 5.502 8.208 -0.238 142 H5'' U 14 H5'' URI 14 6.908 9.174 0.250 143 H4' U 14 H4' URI 14 6.036 8.162 2.196 144 H3' U 14 H3' URI 14 8.589 6.826 1.316 145 H2' U 14 H2'' URI 14 8.436 5.469 3.302 146 HO2' U 14 H2' URI 14 7.008 5.918 4.926 147 H1' U 14 H1' URI 14 5.758 4.823 2.902 148 H3 U 14 H3 URI 14 8.277 1.203 1.686 149 H5 U 14 H5 URI 14 7.961 3.609 -1.742 150 H6 U 14 H6 URI 14 7.057 5.342 -0.346 151 H5' A 15 H5' ADE 15 9.012 7.462 5.189 152 H5'' A 15 H5'' ADE 15 10.519 8.284 5.641 153 H4' A 15 H4' ADE 15 10.340 6.345 6.976 154 H3' A 15 H3' ADE 15 12.419 6.016 4.822 155 H2' A 15 H2'' ADE 15 12.926 3.868 5.819 156 HO2' A 15 H2' ADE 15 12.303 4.836 8.045 157 H1' A 15 H1' ADE 15 10.276 3.075 5.927 158 H8 A 15 H8 ADE 15 10.326 5.150 2.890 159 H61 A 15 H61 ADE 15 12.680 0.291 -0.141 160 H62 A 15 H62 ADE 15 11.928 1.862 -0.311 161 H2 A 15 H2 ADE 15 12.966 -0.538 4.258 162 H5' C 16 H5' CYT 16 14.237 4.794 8.123 163 H5'' C 16 H5'' CYT 16 15.832 5.522 8.390 164 H4' C 16 H4' CYT 16 16.084 3.169 8.494 165 H3' C 16 H3' CYT 16 17.202 4.285 5.927 166 H2' C 16 H2'' CYT 16 17.957 2.035 5.440 167 HO2' C 16 H2' CYT 16 17.760 0.385 6.962 168 H1' C 16 H1' CYT 16 15.495 0.878 6.032 169 H41 C 16 H41 CYT 16 15.157 2.447 -0.131 170 H42 C 16 H42 CYT 16 14.522 4.012 0.311 171 H5 C 16 H5 CYT 16 14.416 4.786 2.591 172 H6 C 16 H6 CYT 16 14.838 4.196 4.912 173 H5' G 17 H5' GUA 17 20.082 1.889 7.235 174 H5'' G 17 H5'' GUA 17 21.663 2.690 7.313 175 H4' G 17 H4' GUA 17 21.946 0.697 6.073 176 H3' G 17 H3' GUA 17 21.942 3.122 4.273 177 H2' G 17 H2'' GUA 17 22.451 1.598 2.468 178 HO2' G 17 H2' GUA 17 23.197 -0.425 2.816 179 H1' G 17 H1' GUA 17 20.571 -0.337 3.281 180 H8 G 17 H8 GUA 17 19.010 3.005 3.780 181 H1 G 17 H1 GUA 17 18.960 1.102 -2.351 182 H21 G 17 H21 GUA 17 20.271 -0.638 -2.615 183 H22 G 17 H22 GUA 17 21.166 -1.348 -1.289 184 H5' U 18 H5' URI 18 25.166 1.144 3.104 185 H5'' U 18 H5'' URI 18 26.623 2.155 3.034 186 H4' U 18 H4' URI 18 26.379 1.111 0.922 187 H3' U 18 H3' URI 18 25.603 4.026 0.804 188 H2' U 18 H2'' URI 18 25.230 3.722 -1.539 189 HO2' U 18 H2' URI 18 25.923 1.717 -2.554 190 H1' U 18 H1' URI 18 24.145 1.074 -1.275 191 H3 U 18 H3 URI 18 20.927 3.713 -3.153 192 H5 U 18 H5 URI 18 20.826 4.602 0.951 193 H6 U 18 H6 URI 18 22.818 3.283 1.203 194 H5' U 19 H5' URI 19 28.340 6.955 -1.935 195 H5'' U 19 H5'' URI 19 26.686 6.853 -1.297 196 H4' U 19 H4' URI 19 27.655 5.903 -3.990 197 H3' U 19 H3' URI 19 25.992 8.294 -3.208 198 H2' U 19 H2'' URI 19 24.778 8.000 -5.254 199 HO2' U 19 H2' URI 19 25.605 6.940 -6.966 200 H1' U 19 H1' URI 19 24.764 5.145 -5.133 201 H3 U 19 H3 URI 19 20.443 6.604 -4.892 202 H5 U 19 H5 URI 19 21.984 7.039 -1.011 203 H6 U 19 H6 URI 19 24.155 6.491 -1.895 204 H5' U 20 H5' URI 20 27.128 12.467 -5.051 205 H5'' U 20 H5'' URI 20 25.397 12.089 -5.085 206 H4' U 20 H4' URI 20 25.996 13.371 -7.020 207 H3' U 20 H3' URI 20 24.403 11.254 -7.303 208 H2' U 20 H2'' URI 20 26.208 9.645 -7.675 209 HO2' U 20 H2' URI 20 25.433 10.686 -10.227 210 H1' U 20 H1' URI 20 27.377 11.728 -9.619 211 H3 U 20 H3 URI 20 30.975 9.341 -10.707 212 H5 U 20 H5 URI 20 30.302 8.196 -6.724 213 H6 U 20 H6 URI 20 28.358 9.612 -6.723 214 H5' C 21 H5' CYT 21 22.138 11.337 -10.110 215 H5'' C 21 H5'' CYT 21 21.343 12.913 -10.292 216 H4' C 21 H4' CYT 21 19.736 11.096 -10.046 217 H3' C 21 H3' CYT 21 19.343 13.468 -8.905 218 H2' C 21 H2'' CYT 21 20.518 12.970 -6.829 219 HO2' C 21 H2' CYT 21 17.785 12.200 -6.468 220 H1' C 21 H1' CYT 21 19.003 10.297 -6.787 221 H41 C 21 H41 CYT 21 22.914 9.143 -1.942 222 H42 C 21 H42 CYT 21 24.294 9.708 -2.853 223 H5 C 21 H5 CYT 21 24.106 10.630 -5.084 224 H6 C 21 H6 CYT 21 22.554 11.210 -6.875 225 H5' G 22 H5' GUA 22 15.927 10.031 -11.199 226 H5'' G 22 H5'' GUA 22 17.156 9.773 -9.946 227 H4' G 22 H4' GUA 22 17.327 9.302 -12.903 228 H3' G 22 H3' GUA 22 17.571 7.547 -10.497 229 H2' G 22 H2'' GUA 22 19.426 6.404 -11.417 230 HO2' G 22 H2' GUA 22 19.356 5.841 -13.456 231 H1' G 22 H1' GUA 22 20.408 8.563 -13.077 232 H8 G 22 H8 GUA 22 22.780 8.709 -12.310 233 H1 G 22 H1 GUA 22 21.137 7.706 -6.194 234 H21 G 22 H21 GUA 22 18.966 7.448 -6.024 235 H22 G 22 H22 GUA 22 17.903 7.529 -7.412 236 H5' A 23 H5' ADE 23 17.770 4.791 -12.995 237 H5'' A 23 H5'' ADE 23 16.564 3.499 -12.872 238 H4' A 23 H4' ADE 23 18.784 2.581 -12.711 239 H3' A 23 H3' ADE 23 17.244 2.427 -10.125 240 H2' A 23 H2'' ADE 23 19.140 1.209 -9.225 241 HO2' A 23 H2' ADE 23 20.362 0.120 -10.579 242 H1' A 23 H1' ADE 23 20.982 3.090 -10.087 243 H8 A 23 H8 ADE 23 17.736 4.843 -9.349 244 H61 A 23 H61 ADE 23 19.314 4.822 -3.362 245 H62 A 23 H62 ADE 23 18.170 5.424 -4.540 246 H2 A 23 H2 ADE 23 22.277 2.302 -5.598 247 H5' C 24 H5' CYT 24 18.770 -1.143 -10.833 248 H5'' C 24 H5'' CYT 24 17.661 -2.513 -10.635 249 H4' C 24 H4' CYT 24 19.620 -2.946 -9.370 250 H3' C 24 H3' CYT 24 17.285 -2.278 -7.582 251 H2' C 24 H2'' CYT 24 18.764 -2.755 -5.722 252 HO2' C 24 H2' CYT 24 20.379 -4.098 -6.019 253 H1' C 24 H1' CYT 24 20.823 -1.174 -6.703 254 H41 C 24 H41 CYT 24 17.116 2.697 -3.241 255 H42 C 24 H42 CYT 24 16.152 3.038 -4.657 256 H5 C 24 H5 CYT 24 16.484 1.918 -6.770 257 H6 C 24 H6 CYT 24 17.775 0.216 -7.937 258 H5' G 25 H5' GUA 25 18.940 -5.577 -6.155 259 H5'' G 25 H5'' GUA 25 17.804 -6.891 -5.804 260 H4' G 25 H4' GUA 25 19.159 -6.573 -3.895 261 H3' G 25 H3' GUA 25 16.371 -5.514 -3.429 262 H2' G 25 H2'' GUA 25 17.084 -5.071 -1.157 263 HO2' G 25 H2' GUA 25 19.468 -6.445 -1.924 264 H1' G 25 H1' GUA 25 19.470 -3.857 -1.920 265 H8 G 25 H8 GUA 25 17.003 -2.921 -4.530 266 H1 G 25 H1 GUA 25 16.233 0.390 0.907 267 H21 G 25 H21 GUA 25 17.402 -0.525 2.527 268 H22 G 25 H22 GUA 25 18.385 -1.951 2.283 269 H5' U 26 H5' URI 26 17.277 -7.772 -0.352 270 H5'' U 26 H5'' URI 26 16.036 -8.931 0.152 271 H4' U 26 H4' URI 26 16.713 -7.649 2.040 272 H3' U 26 H3' URI 26 13.931 -6.905 1.140 273 H2' U 26 H2'' URI 26 13.852 -5.440 3.060 274 HO2' U 26 H2' URI 26 15.562 -5.438 4.581 275 H1' U 26 H1' URI 26 16.391 -4.360 2.599 276 H3 U 26 H3 URI 26 13.313 -1.181 1.482 277 H5 U 26 H5 URI 26 13.758 -3.578 -1.935 278 H6 U 26 H6 URI 26 15.010 -5.128 -0.592 279 H5' A 27 H5' ADE 27 13.905 -7.503 5.008 280 H5'' A 27 H5'' ADE 27 12.554 -8.452 5.651 281 H4' A 27 H4' ADE 27 12.697 -6.416 6.859 282 H3' A 27 H3' ADE 27 10.296 -6.467 5.039 283 H2' A 27 H2'' ADE 27 9.697 -4.326 5.981 284 HO2' A 27 H2' ADE 27 10.490 -3.645 7.870 285 H1' A 27 H1' ADE 27 12.285 -3.272 5.793 286 H8 A 27 H8 ADE 27 11.899 -5.317 2.741 287 H61 A 27 H61 ADE 27 8.917 -0.525 0.197 288 H62 A 27 H62 ADE 27 9.715 -2.050 -0.115 289 H2 A 27 H2 ADE 27 9.256 0.231 4.603 290 H5' G 28 H5' GUA 28 9.138 -5.280 8.552 291 H5'' G 28 H5'' GUA 28 7.677 -6.036 9.208 292 H4' G 28 H4' GUA 28 7.425 -3.662 9.267 293 H3' G 28 H3' GUA 28 5.671 -4.981 7.204 294 H2' G 28 H2'' GUA 28 4.791 -2.824 6.684 295 HO2' G 28 H2' GUA 28 4.549 -2.186 8.915 296 H1' G 28 H1' GUA 28 7.285 -1.442 7.035 297 H8 G 28 H8 GUA 28 7.858 -4.396 4.864 298 H1 G 28 H1 GUA 28 5.270 0.572 1.714 299 H21 G 28 H21 GUA 28 4.573 2.086 3.142 300 H22 G 28 H22 GUA 28 4.729 1.885 4.874 301 H5' U 29 H5' URI 29 0.857 -3.594 8.680 302 H5'' U 29 H5'' URI 29 1.660 -3.927 7.132 303 H4' U 29 H4' URI 29 1.370 -1.257 8.503 304 H3' U 29 H3' URI 29 0.012 -2.424 6.090 305 H2' U 29 H2'' URI 29 -0.002 -0.243 5.121 306 HO2' U 29 H2' URI 29 -0.636 1.024 6.837 307 H1' U 29 H1' URI 29 2.591 0.478 6.068 308 H3 U 29 H3 URI 29 2.805 0.394 1.508 309 H5 U 29 H5 URI 29 3.488 -3.569 2.723 310 H6 U 29 H6 URI 29 2.771 -2.869 5.026 311 H5' U 30 H5' URI 30 -4.393 -1.075 5.002 312 H5'' U 30 H5'' URI 30 -2.931 -1.736 4.251 313 H4' U 30 H4' URI 30 -3.837 1.135 4.302 314 H3' U 30 H3' URI 30 -3.663 -0.899 2.085 315 H2' U 30 H2'' URI 30 -3.235 0.977 0.601 316 HO2' U 30 H2' URI 30 -3.772 2.971 1.153 317 H1' U 30 H1' URI 30 -1.275 2.063 2.234 318 H3 U 30 H3 URI 30 0.831 -0.093 -1.228 319 H5 U 30 H5 URI 30 0.341 -2.952 1.806 320 H6 U 30 H6 URI 30 -1.093 -1.390 2.945 321 H5' C 31 H5' CYT 31 -5.914 1.983 0.376 322 H5'' C 31 H5'' CYT 31 -7.421 1.297 -0.267 323 H4' C 31 H4' CYT 31 -6.412 2.504 -2.021 324 H3' C 31 H3' CYT 31 -6.044 -0.467 -2.398 325 H2' C 31 H2'' CYT 31 -5.018 0.086 -4.526 326 HO2' C 31 H2' CYT 31 -5.725 1.843 -5.482 327 H1' C 31 H1' CYT 31 -3.364 2.044 -3.443 328 H41 C 31 H41 CYT 31 -0.014 -3.351 -2.960 329 H42 C 31 H42 CYT 31 -0.710 -3.636 -1.382 330 H5 C 31 H5 CYT 31 -2.473 -2.262 -0.457 331 H6 C 31 H6 CYT 31 -3.938 -0.356 -0.868 332 H5' U 32 H5' URI 32 -7.387 0.707 -5.977 333 H5'' U 32 H5'' URI 32 -8.780 -0.247 -6.514 334 H4' U 32 H4' URI 32 -7.197 -0.259 -8.267 335 H3' U 32 H3' URI 32 -7.236 -2.914 -6.834 336 H2' U 32 H2'' URI 32 -5.652 -3.682 -8.485 337 HO2' U 32 H2' URI 32 -6.278 -1.214 -9.776 338 H1' U 32 H1' URI 32 -4.053 -1.376 -8.324 339 H3 U 32 H3 URI 32 -1.754 -4.762 -6.305 340 H5 U 32 H5 URI 32 -4.356 -3.279 -3.363 341 H6 U 32 H6 URI 32 -5.439 -1.991 -5.086 342 H5' A 33 H5' ADE 33 -7.561 -3.709 -10.732 343 H5'' A 33 H5'' ADE 33 -8.822 -4.893 -11.114 344 H4' A 33 H4' ADE 33 -6.843 -5.610 -12.159 345 H3' A 33 H3' ADE 33 -7.443 -7.309 -9.741 346 H2' A 33 H2'' ADE 33 -5.521 -8.633 -10.377 347 HO2' A 33 H2' ADE 33 -4.574 -8.451 -12.353 348 H1' A 33 H1' ADE 33 -3.875 -6.418 -10.828 349 H8 A 33 H8 ADE 33 -6.019 -5.512 -7.917 350 H61 A 33 H61 ADE 33 -2.086 -8.724 -4.362 351 H62 A 33 H62 ADE 33 -3.432 -7.605 -4.359 352 H2 A 33 H2 ADE 33 -1.128 -9.606 -8.645 353 H5' A 34 H5' ADE 34 -6.770 -9.782 -12.775 354 H5'' A 34 H5'' ADE 34 -7.937 -11.104 -12.933 355 H4' A 34 H4' ADE 34 -5.761 -12.032 -12.939 356 H3' A 34 H3' ADE 34 -7.156 -12.602 -10.321 357 H2' A 34 H2'' ADE 34 -5.195 -13.916 -9.761 358 HO2' A 34 H2' ADE 34 -3.461 -13.972 -11.420 359 H1' A 34 H1' ADE 34 -3.393 -11.950 -10.590 360 H8 A 34 H8 ADE 34 -6.324 -10.193 -9.064 361 H61 A 34 H61 ADE 34 -3.702 -11.230 -3.552 362 H62 A 34 H62 ADE 34 -4.951 -10.348 -4.400 363 H2 A 34 H2 ADE 34 -1.511 -13.655 -6.615 364 H5' C 35 H5' CYT 35 -5.683 -16.011 -11.613 365 H5'' C 35 H5'' CYT 35 -6.778 -17.403 -11.530 366 H4' C 35 H4' CYT 35 -4.733 -17.967 -10.448 367 H3' C 35 H3' CYT 35 -6.965 -17.587 -8.447 368 H2' C 35 H2'' CYT 35 -5.354 -18.294 -6.777 369 HO2' C 35 H2' CYT 35 -3.654 -18.829 -9.010 370 H1' C 35 H1' CYT 35 -3.308 -16.649 -7.762 371 H41 C 35 H41 CYT 35 -6.181 -13.222 -3.242 372 H42 C 35 H42 CYT 35 -7.325 -12.620 -4.419 373 H5 C 35 H5 CYT 35 -7.455 -13.472 -6.688 374 H6 C 35 H6 CYT 35 -6.456 -15.016 -8.293 375 H5' C 36 H5' CYT 36 -5.231 -21.025 -7.561 376 H5'' C 36 H5'' CYT 36 -6.340 -22.388 -7.330 377 H4' C 36 H4' CYT 36 -4.906 -22.274 -5.442 378 H3' C 36 H3' CYT 36 -7.689 -21.326 -4.766 379 HO3' C 36 H3T CYT 36 -7.332 -23.474 -5.378 380 H2' C 36 H2'' CYT 36 -6.923 -21.076 -2.505 381 HO2' C 36 H2' CYT 36 -5.644 -23.156 -2.759 382 H1' C 36 H1' CYT 36 -4.352 -20.057 -3.237 383 H41 C 36 H41 CYT 36 -7.902 -15.069 -1.466 384 H42 C 36 H42 CYT 36 -8.588 -14.993 -3.070 385 H5 C 36 H5 CYT 36 -8.160 -16.655 -4.761 386 H6 C 36 H6 CYT 36 -6.957 -18.706 -5.280 Start of MODEL 6 1 H5' G 1 H5' GUA 1 -17.783 -22.490 -7.228 2 H5'' G 1 H5'' GUA 1 -16.542 -23.486 -6.450 3 H4' G 1 H4' GUA 1 -16.156 -21.840 -5.056 4 H3' G 1 H3' GUA 1 -18.938 -22.429 -4.060 5 H2' G 1 H2'' GUA 1 -18.725 -20.472 -2.670 6 HO2' G 1 H2' GUA 1 -16.226 -21.037 -2.539 7 H1' G 1 H1' GUA 1 -17.597 -18.880 -4.700 8 H8 G 1 H8 GUA 1 -20.207 -20.907 -6.358 9 H1 G 1 H1 GUA 1 -22.596 -16.022 -2.942 10 H21 G 1 H21 GUA 1 -21.036 -15.173 -1.650 11 H22 G 1 H22 GUA 1 -19.404 -15.800 -1.616 12 HO5' G 1 H5T GUA 1 -19.277 -23.668 -6.352 13 H5' G 2 H5' GUA 2 -16.917 -21.517 -0.801 14 H5'' G 2 H5'' GUA 2 -17.046 -22.731 0.487 15 H4' G 2 H4' GUA 2 -17.600 -20.637 1.434 16 H3' G 2 H3' GUA 2 -20.039 -22.351 1.005 17 H2' G 2 H2'' GUA 2 -21.323 -20.612 2.037 18 HO2' G 2 H2' GUA 2 -20.445 -19.190 3.416 19 H1' G 2 H1' GUA 2 -19.852 -18.473 0.835 20 H8 G 2 H8 GUA 2 -20.658 -20.960 -1.795 21 H1 G 2 H1 GUA 2 -25.647 -17.213 -0.268 22 H21 G 2 H21 GUA 2 -25.213 -16.092 1.570 23 H22 G 2 H22 GUA 2 -23.698 -16.254 2.431 24 H5' A 3 H5' ADE 3 -20.760 -23.670 5.905 25 H5'' A 3 H5'' ADE 3 -22.183 -22.617 5.774 26 H4' A 3 H4' ADE 3 -19.286 -21.797 5.819 27 H3' A 3 H3' ADE 3 -20.645 -22.261 8.053 28 H2' A 3 H2'' ADE 3 -22.594 -20.924 7.526 29 HO2' A 3 H2' ADE 3 -22.286 -19.817 9.322 30 H1' A 3 H1' ADE 3 -20.750 -18.689 6.523 31 H8 A 3 H8 ADE 3 -23.773 -20.791 5.289 32 H61 A 3 H61 ADE 3 -26.322 -15.313 3.939 33 H62 A 3 H62 ADE 3 -26.538 -17.049 3.890 34 H2 A 3 H2 ADE 3 -22.304 -14.562 5.788 35 H5' G 4 H5' GUA 4 -14.963 -20.702 7.778 36 H5'' G 4 H5'' GUA 4 -16.155 -19.728 8.665 37 H4' G 4 H4' GUA 4 -15.466 -19.393 5.750 38 H3' G 4 H3' GUA 4 -14.360 -17.917 8.129 39 H2' G 4 H2'' GUA 4 -14.319 -15.941 6.735 40 HO2' G 4 H2' GUA 4 -13.940 -17.517 4.755 41 H1' G 4 H1' GUA 4 -16.919 -16.300 5.801 42 H8 G 4 H8 GUA 4 -17.015 -17.595 9.265 43 H1 G 4 H1 GUA 4 -17.029 -11.178 8.984 44 H21 G 4 H21 GUA 4 -16.518 -10.512 6.956 45 H22 G 4 H22 GUA 4 -16.169 -11.634 5.661 46 H5' U 5 H5' URI 5 -12.192 -16.757 5.054 47 H5'' U 5 H5'' URI 5 -10.438 -16.830 5.295 48 H4' U 5 H4' URI 5 -10.988 -14.652 4.547 49 H3' U 5 H3' URI 5 -10.253 -14.678 7.468 50 H2' U 5 H2'' URI 5 -10.500 -12.289 7.449 51 HO2' U 5 H2' URI 5 -10.089 -11.230 5.656 52 H1' U 5 H1' URI 5 -12.877 -12.318 5.946 53 H3 U 5 H3 URI 5 -13.880 -11.038 10.227 54 H5 U 5 H5 URI 5 -13.917 -15.237 10.243 55 H6 U 5 H6 URI 5 -12.988 -15.180 8.028 56 H5' G 6 H5' GUA 6 -7.113 -15.302 7.908 57 H5'' G 6 H5'' GUA 6 -5.506 -14.574 8.109 58 H4' G 6 H4' GUA 6 -5.110 -16.799 7.571 59 H3' G 6 H3' GUA 6 -4.693 -15.077 5.142 60 H2' G 6 H2'' GUA 6 -4.015 -17.067 3.966 61 HO2' G 6 H2' GUA 6 -3.664 -18.996 5.022 62 H1' G 6 H1' GUA 6 -6.185 -18.573 4.834 63 H8 G 6 H8 GUA 6 -7.642 -15.208 4.558 64 H1 G 6 H1 GUA 6 -6.665 -17.954 -1.164 65 H21 G 6 H21 GUA 6 -5.374 -19.714 -0.949 66 H22 G 6 H22 GUA 6 -4.740 -20.228 0.598 67 H5' G 7 H5' GUA 7 -1.616 -17.471 5.325 68 H5'' G 7 H5'' GUA 7 -0.033 -16.686 5.181 69 H4' G 7 H4' GUA 7 -0.122 -18.456 3.610 70 H3' G 7 H3' GUA 7 -0.333 -15.766 2.261 71 H2' G 7 H2'' GUA 7 -0.280 -16.981 0.163 72 HO2' G 7 H2' GUA 7 1.153 -18.723 1.373 73 H1' G 7 H1' GUA 7 -2.187 -18.841 0.963 74 H8 G 7 H8 GUA 7 -3.303 -15.714 2.580 75 H1 G 7 H1 GUA 7 -4.524 -15.817 -3.727 76 H21 G 7 H21 GUA 7 -3.433 -17.464 -4.680 77 H22 G 7 H22 GUA 7 -2.397 -18.548 -3.778 78 H5' U 8 H5' URI 8 2.455 -17.763 0.319 79 H5'' U 8 H5'' URI 8 3.968 -16.882 0.043 80 H4' U 8 H4' URI 8 3.228 -17.767 -2.031 81 H3' U 8 H3' URI 8 2.836 -14.774 -1.910 82 H2' U 8 H2'' URI 8 2.105 -14.936 -4.214 83 HO2' U 8 H2' URI 8 2.523 -16.667 -5.443 84 H1' U 8 H1' URI 8 0.424 -17.112 -3.743 85 H3 U 8 H3 URI 8 -2.202 -13.429 -4.353 86 H5 U 8 H5 URI 8 -1.166 -13.407 -0.286 87 H6 U 8 H6 URI 8 0.414 -15.159 -0.758 88 H5' U 9 H5' URI 9 4.713 -15.558 -5.300 89 H5'' U 9 H5'' URI 9 6.102 -14.517 -5.662 90 H4' U 9 H4' URI 9 4.657 -14.514 -7.538 91 H3' U 9 H3' URI 9 4.533 -11.885 -6.067 92 H2' U 9 H2'' URI 9 3.036 -11.123 -7.786 93 HO2' U 9 H2' URI 9 3.790 -13.541 -9.109 94 H1' U 9 H1' URI 9 1.502 -13.478 -7.806 95 H3 U 9 H3 URI 9 -1.029 -10.205 -5.904 96 H5 U 9 H5 URI 9 1.333 -11.743 -2.793 97 H6 U 9 H6 URI 9 2.602 -12.935 -4.455 98 H5' A 10 H5' ADE 10 5.014 -11.152 -9.905 99 H5'' A 10 H5'' ADE 10 6.226 -9.924 -10.314 100 H4' A 10 H4' ADE 10 4.192 -9.352 -11.384 101 H3' A 10 H3' ADE 10 4.789 -7.510 -9.080 102 H2' A 10 H2'' ADE 10 2.812 -6.287 -9.682 103 HO2' A 10 H2' ADE 10 2.778 -7.950 -12.008 104 H1' A 10 H1' ADE 10 1.235 -8.580 -10.107 105 H8 A 10 H8 ADE 10 3.318 -9.294 -7.119 106 H61 A 10 H61 ADE 10 -0.835 -6.106 -3.807 107 H62 A 10 H62 ADE 10 0.529 -7.198 -3.725 108 H2 A 10 H2 ADE 10 -1.656 -5.374 -8.150 109 H5' G 11 H5' GUA 11 3.810 -5.245 -12.124 110 H5'' G 11 H5'' GUA 11 4.920 -3.906 -12.476 111 H4' G 11 H4' GUA 11 2.734 -3.011 -12.269 112 H3' G 11 H3' GUA 11 4.470 -2.346 -9.904 113 H2' G 11 H2'' GUA 11 2.640 -1.096 -9.010 114 HO2' G 11 H2' GUA 11 0.797 -0.632 -10.324 115 H1' G 11 H1' GUA 11 0.626 -2.935 -9.877 116 H8 G 11 H8 GUA 11 3.374 -4.865 -8.283 117 H1 G 11 H1 GUA 11 -0.572 -2.087 -4.045 118 H21 G 11 H21 GUA 11 -1.866 -0.629 -5.070 119 H22 G 11 H22 GUA 11 -1.764 -0.337 -6.790 120 H5' U 12 H5' URI 12 5.450 2.604 -9.668 121 H5'' U 12 H5'' URI 12 5.379 1.232 -8.548 122 H4' U 12 H4' URI 12 3.269 3.296 -9.107 123 H3' U 12 H3' URI 12 4.950 2.692 -6.691 124 H2' U 12 H2'' URI 12 3.110 3.408 -5.326 125 HO2' U 12 H2' URI 12 1.603 4.735 -6.077 126 H1' U 12 H1' URI 12 1.167 2.008 -6.782 127 H3 U 12 H3 URI 12 1.849 -0.176 -2.808 128 H5 U 12 H5 URI 12 4.589 -1.799 -5.544 129 H6 U 12 H6 URI 12 4.017 -0.020 -7.056 130 H5' C 13 H5' CYT 13 3.351 6.250 -5.720 131 H5'' C 13 H5'' CYT 13 4.605 7.462 -5.387 132 H4' C 13 H4' CYT 13 3.119 7.510 -3.567 133 H3' C 13 H3' CYT 13 5.687 6.108 -2.854 134 H2' C 13 H2'' CYT 13 4.834 5.935 -0.599 135 HO2' C 13 H2' CYT 13 3.280 7.222 0.109 136 H1' C 13 H1' CYT 13 2.373 4.941 -1.381 137 H41 C 13 H41 CYT 13 6.171 -0.160 -0.919 138 H42 C 13 H42 CYT 13 6.454 -0.056 -2.638 139 H5 C 13 H5 CYT 13 5.621 1.745 -3.994 140 H6 C 13 H6 CYT 13 4.429 3.864 -3.982 141 H5' U 14 H5' URI 14 5.135 8.642 0.150 142 H5'' U 14 H5'' URI 14 6.521 9.704 0.459 143 H4' U 14 H4' URI 14 5.908 8.718 2.513 144 H3' U 14 H3' URI 14 8.448 7.511 1.432 145 H2' U 14 H2'' URI 14 8.576 6.229 3.473 146 HO2' U 14 H2' URI 14 7.448 6.762 5.236 147 H1' U 14 H1' URI 14 5.928 5.392 3.346 148 H3 U 14 H3 URI 14 8.594 1.926 2.012 149 H5 U 14 H5 URI 14 7.796 4.174 -1.441 150 H6 U 14 H6 URI 14 6.880 5.880 -0.023 151 H5' A 15 H5' ADE 15 9.138 8.384 5.213 152 H5'' A 15 H5'' ADE 15 10.636 9.283 5.506 153 H4' A 15 H4' ADE 15 10.622 7.422 6.957 154 H3' A 15 H3' ADE 15 12.574 7.043 4.693 155 H2' A 15 H2'' ADE 15 13.220 4.972 5.765 156 HO2' A 15 H2' ADE 15 12.859 4.639 7.843 157 H1' A 15 H1' ADE 15 10.614 4.099 6.117 158 H8 A 15 H8 ADE 15 10.449 6.001 2.955 159 H61 A 15 H61 ADE 15 12.755 1.027 0.074 160 H62 A 15 H62 ADE 15 11.982 2.582 -0.144 161 H2 A 15 H2 ADE 15 13.225 0.420 4.491 162 H5' C 16 H5' CYT 16 14.597 6.163 7.996 163 H5'' C 16 H5'' CYT 16 16.178 6.951 8.127 164 H4' C 16 H4' CYT 16 16.503 4.630 8.432 165 H3' C 16 H3' CYT 16 17.487 5.518 5.725 166 H2' C 16 H2'' CYT 16 18.273 3.245 5.422 167 HO2' C 16 H2' CYT 16 18.637 1.977 7.098 168 H1' C 16 H1' CYT 16 15.868 2.102 6.220 169 H41 C 16 H41 CYT 16 15.213 3.123 -0.034 170 H42 C 16 H42 CYT 16 14.552 4.702 0.304 171 H5 C 16 H5 CYT 16 14.501 5.654 2.515 172 H6 C 16 H6 CYT 16 15.068 5.287 4.851 173 H5' G 17 H5' GUA 17 20.451 3.327 7.194 174 H5'' G 17 H5'' GUA 17 22.025 4.142 7.131 175 H4' G 17 H4' GUA 17 22.297 2.009 6.152 176 H3' G 17 H3' GUA 17 22.246 4.173 4.044 177 H2' G 17 H2'' GUA 17 22.741 2.411 2.456 178 HO2' G 17 H2' GUA 17 22.930 0.676 4.716 179 H1' G 17 H1' GUA 17 20.820 0.661 3.485 180 H8 G 17 H8 GUA 17 19.326 4.052 3.733 181 H1 G 17 H1 GUA 17 19.173 1.681 -2.229 182 H21 G 17 H21 GUA 17 20.474 -0.084 -2.374 183 H22 G 17 H22 GUA 17 21.382 -0.693 -1.009 184 H5' U 18 H5' URI 18 25.488 2.043 3.150 185 H5'' U 18 H5'' URI 18 26.938 3.031 2.888 186 H4' U 18 H4' URI 18 26.662 1.643 0.991 187 H3' U 18 H3' URI 18 25.890 4.496 0.357 188 H2' U 18 H2'' URI 18 25.566 3.734 -1.914 189 HO2' U 18 H2' URI 18 26.325 1.799 -2.628 190 H1' U 18 H1' URI 18 24.191 1.403 -1.171 191 H3 U 18 H3 URI 18 21.222 4.257 -3.139 192 H5 U 18 H5 URI 18 21.406 5.440 0.886 193 H6 U 18 H6 URI 18 23.263 3.943 1.160 194 H5' U 19 H5' URI 19 28.203 3.520 -2.635 195 H5'' U 19 H5'' URI 19 29.429 4.744 -3.023 196 H4' U 19 H4' URI 19 28.174 4.332 -4.990 197 H3' U 19 H3' URI 19 27.437 6.986 -3.761 198 H2' U 19 H2'' URI 19 25.999 7.319 -5.670 199 HO2' U 19 H2' URI 19 26.329 6.287 -7.517 200 H1' U 19 H1' URI 19 24.929 4.717 -5.585 201 H3 U 19 H3 URI 19 21.673 7.594 -4.239 202 H5 U 19 H5 URI 19 24.022 6.926 -0.826 203 H6 U 19 H6 URI 19 25.610 5.797 -2.236 204 H5' U 20 H5' URI 20 28.882 10.816 -6.178 205 H5'' U 20 H5'' URI 20 27.122 10.599 -6.125 206 H4' U 20 H4' URI 20 27.876 11.701 -8.174 207 H3' U 20 H3' URI 20 25.871 9.948 -8.199 208 H2' U 20 H2'' URI 20 27.302 7.972 -8.484 209 HO2' U 20 H2' URI 20 26.553 8.923 -11.074 210 H1' U 20 H1' URI 20 28.720 9.587 -10.690 211 H3 U 20 H3 URI 20 31.768 6.498 -11.681 212 H5 U 20 H5 URI 20 31.020 5.744 -7.620 213 H6 U 20 H6 URI 20 29.393 7.516 -7.669 214 H5' C 21 H5' CYT 21 23.481 10.337 -10.983 215 H5'' C 21 H5'' CYT 21 23.103 12.046 -11.278 216 H4' C 21 H4' CYT 21 21.137 10.583 -10.784 217 H3' C 21 H3' CYT 21 21.275 13.176 -10.176 218 H2' C 21 H2'' CYT 21 22.391 12.864 -8.026 219 HO2' C 21 H2' CYT 21 20.233 13.999 -7.879 220 H1' C 21 H1' CYT 21 20.297 10.673 -7.505 221 H41 C 21 H41 CYT 21 23.705 9.640 -2.276 222 H42 C 21 H42 CYT 21 25.208 9.744 -3.165 223 H5 C 21 H5 CYT 21 25.304 10.266 -5.527 224 H6 C 21 H6 CYT 21 23.986 10.801 -7.505 225 H5' G 22 H5' GUA 22 17.295 10.163 -11.804 226 H5'' G 22 H5'' GUA 22 18.624 9.841 -10.671 227 H4' G 22 H4' GUA 22 18.421 9.143 -13.585 228 H3' G 22 H3' GUA 22 18.557 7.509 -11.088 229 H2' G 22 H2'' GUA 22 20.094 5.996 -12.071 230 HO2' G 22 H2' GUA 22 20.098 5.565 -14.202 231 H1' G 22 H1' GUA 22 21.401 7.857 -13.818 232 H8 G 22 H8 GUA 22 23.760 7.578 -13.045 233 H1 G 22 H1 GUA 22 21.997 7.481 -6.876 234 H21 G 22 H21 GUA 22 19.822 7.701 -6.709 235 H22 G 22 H22 GUA 22 18.786 7.865 -8.108 236 H5' A 23 H5' ADE 23 18.217 4.675 -13.230 237 H5'' A 23 H5'' ADE 23 16.943 3.490 -12.898 238 H4' A 23 H4' ADE 23 19.179 2.522 -12.705 239 H3' A 23 H3' ADE 23 17.598 2.600 -10.137 240 H2' A 23 H2'' ADE 23 19.450 1.395 -9.123 241 HO2' A 23 H2' ADE 23 19.898 0.422 -11.461 242 H1' A 23 H1' ADE 23 21.346 3.168 -10.084 243 H8 A 23 H8 ADE 23 18.132 5.055 -9.517 244 H61 A 23 H61 ADE 23 19.629 5.406 -3.524 245 H62 A 23 H62 ADE 23 18.522 5.959 -4.759 246 H2 A 23 H2 ADE 23 22.551 2.661 -5.530 247 H5' C 24 H5' CYT 24 19.027 -1.048 -10.578 248 H5'' C 24 H5'' CYT 24 17.893 -2.376 -10.288 249 H4' C 24 H4' CYT 24 19.846 -2.748 -8.991 250 H3' C 24 H3' CYT 24 17.510 -1.939 -7.265 251 H2' C 24 H2'' CYT 24 18.974 -2.316 -5.368 252 HO2' C 24 H2' CYT 24 20.878 -3.201 -7.308 253 H1' C 24 H1' CYT 24 21.054 -0.821 -6.436 254 H41 C 24 H41 CYT 24 17.364 3.294 -3.239 255 H42 C 24 H42 CYT 24 16.419 3.563 -4.682 256 H5 C 24 H5 CYT 24 16.756 2.315 -6.722 257 H6 C 24 H6 CYT 24 18.035 0.532 -7.776 258 H5' G 25 H5' GUA 25 19.134 -5.161 -5.639 259 H5'' G 25 H5'' GUA 25 17.987 -6.445 -5.226 260 H4' G 25 H4' GUA 25 19.337 -6.048 -3.331 261 H3' G 25 H3' GUA 25 16.563 -4.931 -2.935 262 H2' G 25 H2'' GUA 25 17.269 -4.387 -0.683 263 HO2' G 25 H2' GUA 25 18.747 -5.620 0.206 264 H1' G 25 H1' GUA 25 19.662 -3.227 -1.495 265 H8 G 25 H8 GUA 25 17.228 -2.425 -4.177 266 H1 G 25 H1 GUA 25 16.426 1.199 1.053 267 H21 G 25 H21 GUA 25 17.572 0.373 2.733 268 H22 G 25 H22 GUA 25 18.546 -1.073 2.585 269 H5' U 26 H5' URI 26 17.379 -7.087 0.271 270 H5'' U 26 H5'' URI 26 16.105 -8.211 0.771 271 H4' U 26 H4' URI 26 16.732 -6.914 2.649 272 H3' U 26 H3' URI 26 14.020 -6.084 1.616 273 H2' U 26 H2'' URI 26 13.911 -4.583 3.503 274 HO2' U 26 H2' URI 26 15.647 -4.586 5.052 275 H1' U 26 H1' URI 26 16.506 -3.603 3.132 276 H3 U 26 H3 URI 26 13.574 -0.361 1.821 277 H5 U 26 H5 URI 26 14.087 -2.845 -1.522 278 H6 U 26 H6 URI 26 15.240 -4.398 -0.095 279 H5' A 27 H5' ADE 27 13.791 -6.621 5.493 280 H5'' A 27 H5'' ADE 27 12.375 -7.511 6.072 281 H4' A 27 H4' ADE 27 12.536 -5.488 7.288 282 H3' A 27 H3' ADE 27 10.241 -5.413 5.338 283 H2' A 27 H2'' ADE 27 9.691 -3.250 6.260 284 HO2' A 27 H2' ADE 27 11.114 -2.439 8.001 285 H1' A 27 H1' ADE 27 12.314 -2.307 6.161 286 H8 A 27 H8 ADE 27 11.992 -4.442 3.158 287 H61 A 27 H61 ADE 27 9.223 0.326 0.344 288 H62 A 27 H62 ADE 27 9.973 -1.237 0.113 289 H2 A 27 H2 ADE 27 9.457 1.243 4.727 290 H5' G 28 H5' GUA 28 8.972 -4.199 8.819 291 H5'' G 28 H5'' GUA 28 7.424 -4.858 9.368 292 H4' G 28 H4' GUA 28 7.331 -2.490 9.499 293 H3' G 28 H3' GUA 28 5.626 -3.562 7.258 294 H2' G 28 H2'' GUA 28 4.921 -1.292 6.867 295 HO2' G 28 H2' GUA 28 5.322 0.340 8.309 296 H1' G 28 H1' GUA 28 7.497 -0.213 7.059 297 H8 G 28 H8 GUA 28 7.992 -3.423 5.316 298 H1 G 28 H1 GUA 28 5.535 1.118 1.497 299 H21 G 28 H21 GUA 28 4.832 2.818 2.699 300 H22 G 28 H22 GUA 28 4.954 2.846 4.443 301 H5' U 29 H5' URI 29 3.465 -1.033 9.351 302 H5'' U 29 H5'' URI 29 1.856 -1.601 9.834 303 H4' U 29 H4' URI 29 1.615 0.522 8.790 304 H3' U 29 H3' URI 29 0.637 -1.723 7.036 305 H2' U 29 H2'' URI 29 -0.030 -0.060 5.445 306 HO2' U 29 H2' URI 29 -0.644 1.867 6.097 307 H1' U 29 H1' URI 29 2.270 1.590 5.847 308 H3 U 29 H3 URI 29 2.414 0.152 1.524 309 H5 U 29 H5 URI 29 3.861 -3.104 3.748 310 H6 U 29 H6 URI 29 3.143 -1.865 5.813 311 H5' U 30 H5' URI 30 -4.222 -1.173 6.011 312 H5'' U 30 H5'' URI 30 -2.752 -1.710 5.175 313 H4' U 30 H4' URI 30 -4.071 0.991 5.048 314 H3' U 30 H3' URI 30 -3.788 -1.205 3.007 315 H2' U 30 H2'' URI 30 -3.751 0.552 1.334 316 HO2' U 30 H2' URI 30 -5.268 1.891 2.789 317 H1' U 30 H1' URI 30 -1.853 2.065 2.681 318 H3 U 30 H3 URI 30 0.272 -0.099 -0.762 319 H5 U 30 H5 URI 30 0.430 -2.703 2.528 320 H6 U 30 H6 URI 30 -1.110 -1.242 3.663 321 H5' C 31 H5' CYT 31 -6.530 1.226 1.479 322 H5'' C 31 H5'' CYT 31 -7.986 0.384 0.912 323 H4' C 31 H4' CYT 31 -7.201 1.720 -0.868 324 H3' C 31 H3' CYT 31 -6.595 -1.195 -1.349 325 H2' C 31 H2'' CYT 31 -5.756 -0.498 -3.520 326 HO2' C 31 H2' CYT 31 -6.604 2.130 -2.787 327 H1' C 31 H1' CYT 31 -4.204 1.556 -2.474 328 H41 C 31 H41 CYT 31 -0.447 -3.592 -2.332 329 H42 C 31 H42 CYT 31 -1.045 -3.981 -0.736 330 H5 C 31 H5 CYT 31 -2.841 -2.760 0.326 331 H6 C 31 H6 CYT 31 -4.454 -0.955 0.056 332 H5' U 32 H5' URI 32 -8.272 0.034 -4.720 333 H5'' U 32 H5'' URI 32 -9.595 -1.003 -5.285 334 H4' U 32 H4' URI 32 -8.093 -0.704 -7.084 335 H3' U 32 H3' URI 32 -7.849 -3.477 -5.924 336 H2' U 32 H2'' URI 32 -6.283 -3.940 -7.700 337 HO2' U 32 H2' URI 32 -6.549 -2.904 -9.532 338 H1' U 32 H1' URI 32 -4.855 -1.559 -7.335 339 H3 U 32 H3 URI 32 -2.289 -4.956 -5.703 340 H5 U 32 H5 URI 32 -4.882 -3.913 -2.573 341 H6 U 32 H6 URI 32 -6.103 -2.561 -4.142 342 H5' A 33 H5' ADE 33 -8.242 -3.831 -9.849 343 H5'' A 33 H5'' ADE 33 -9.407 -5.061 -10.368 344 H4' A 33 H4' ADE 33 -7.401 -5.439 -11.541 345 H3' A 33 H3' ADE 33 -7.797 -7.513 -9.388 346 H2' A 33 H2'' ADE 33 -5.792 -8.570 -10.233 347 HO2' A 33 H2' ADE 33 -5.137 -8.244 -12.235 348 H1' A 33 H1' ADE 33 -4.334 -6.196 -10.346 349 H8 A 33 H8 ADE 33 -6.501 -5.837 -7.351 350 H61 A 33 H61 ADE 33 -2.365 -9.278 -4.267 351 H62 A 33 H62 ADE 33 -3.765 -8.241 -4.108 352 H2 A 33 H2 ADE 33 -1.405 -9.517 -8.634 353 H5' A 34 H5' ADE 34 -6.960 -9.448 -12.734 354 H5'' A 34 H5'' ADE 34 -8.029 -10.814 -13.097 355 H4' A 34 H4' ADE 34 -5.794 -11.576 -13.237 356 H3' A 34 H3' ADE 34 -7.141 -12.619 -10.746 357 H2' A 34 H2'' ADE 34 -5.102 -13.870 -10.354 358 HO2' A 34 H2' ADE 34 -3.813 -14.368 -11.969 359 H1' A 34 H1' ADE 34 -3.434 -11.694 -10.823 360 H8 A 34 H8 ADE 34 -6.515 -10.347 -9.187 361 H61 A 34 H61 ADE 34 -4.047 -12.017 -3.759 362 H62 A 34 H62 ADE 34 -5.318 -11.098 -4.532 363 H2 A 34 H2 ADE 34 -1.586 -13.845 -7.029 364 H5' C 35 H5' CYT 35 -5.465 -15.723 -12.513 365 H5'' C 35 H5'' CYT 35 -6.498 -17.155 -12.662 366 H4' C 35 H4' CYT 35 -4.452 -17.812 -11.655 367 H3' C 35 H3' CYT 35 -6.701 -17.794 -9.641 368 H2' C 35 H2'' CYT 35 -5.078 -18.690 -8.075 369 HO2' C 35 H2' CYT 35 -2.871 -19.031 -8.897 370 H1' C 35 H1' CYT 35 -3.106 -16.833 -8.746 371 H41 C 35 H41 CYT 35 -6.301 -14.203 -3.918 372 H42 C 35 H42 CYT 35 -7.431 -13.488 -5.047 373 H5 C 35 H5 CYT 35 -7.417 -13.996 -7.419 374 H6 C 35 H6 CYT 35 -6.305 -15.273 -9.175 375 H5' C 36 H5' CYT 36 -4.909 -21.301 -9.209 376 H5'' C 36 H5'' CYT 36 -6.007 -22.694 -9.214 377 H4' C 36 H4' CYT 36 -4.642 -22.852 -7.284 378 H3' C 36 H3' CYT 36 -7.452 -22.016 -6.579 379 HO3' C 36 H3T CYT 36 -7.393 -24.009 -7.302 380 H2' C 36 H2'' CYT 36 -6.772 -22.106 -4.275 381 HO2' C 36 H2' CYT 36 -4.757 -23.006 -3.682 382 H1' C 36 H1' CYT 36 -4.241 -20.899 -4.731 383 H41 C 36 H41 CYT 36 -8.098 -16.281 -2.659 384 H42 C 36 H42 CYT 36 -8.650 -16.014 -4.296 385 H5 C 36 H5 CYT 36 -8.002 -17.422 -6.146 386 H6 C 36 H6 CYT 36 -6.721 -19.384 -6.798 Start of MODEL 7 1 H5' G 1 H5' GUA 1 6.622 5.124 7.638 2 H5'' G 1 H5'' GUA 1 7.830 5.650 8.820 3 H4' G 1 H4' GUA 1 7.113 2.763 8.422 4 H3' G 1 H3' GUA 1 5.675 4.745 10.179 5 H2' G 1 H2'' GUA 1 5.433 2.979 11.788 6 HO2' G 1 H2' GUA 1 6.087 0.824 11.238 7 H1' G 1 H1' GUA 1 8.071 2.028 11.491 8 H8 G 1 H8 GUA 1 8.316 5.714 11.403 9 H1 G 1 H1 GUA 1 7.434 3.392 17.324 10 H21 G 1 H21 GUA 1 6.842 1.280 17.225 11 H22 G 1 H22 GUA 1 6.659 0.428 15.707 12 HO5' G 1 H5T GUA 1 9.218 4.001 7.735 13 H5' G 2 H5' GUA 2 3.537 1.474 10.393 14 H5'' G 2 H5'' GUA 2 1.808 1.699 10.069 15 H4' G 2 H4' GUA 2 2.007 0.567 12.138 16 H3' G 2 H3' GUA 2 1.216 3.451 12.507 17 H2' G 2 H2'' GUA 2 1.115 3.039 14.854 18 HO2' G 2 H2' GUA 2 0.326 1.176 15.474 19 H1' G 2 H1' GUA 2 3.333 1.209 14.892 20 H8 G 2 H8 GUA 2 4.326 4.291 13.091 21 H1 G 2 H1 GUA 2 4.342 4.992 19.475 22 H21 G 2 H21 GUA 2 3.334 3.289 20.424 23 H22 G 2 H22 GUA 2 2.653 1.970 19.499 24 H5' A 3 H5' ADE 3 -1.054 1.386 9.982 25 H5'' A 3 H5'' ADE 3 -2.407 2.371 9.395 26 H4' A 3 H4' ADE 3 -2.727 0.089 8.749 27 H3' A 3 H3' ADE 3 -4.672 1.047 10.832 28 H2' A 3 H2'' ADE 3 -5.762 -1.100 10.652 29 HO2' A 3 H2' ADE 3 -3.889 -1.568 8.538 30 H1' A 3 H1' ADE 3 -3.401 -2.528 10.931 31 H8 A 3 H8 ADE 3 -2.817 0.556 12.922 32 H61 A 3 H61 ADE 3 -5.957 -2.097 17.546 33 H62 A 3 H62 ADE 3 -4.925 -0.759 17.093 34 H2 A 3 H2 ADE 3 -6.551 -4.580 13.857 35 H5' G 4 H5' GUA 4 -9.270 0.856 9.293 36 H5'' G 4 H5'' GUA 4 -8.514 -0.177 10.522 37 H4' G 4 H4' GUA 4 -10.192 -1.483 9.562 38 H3' G 4 H3' GUA 4 -7.534 -2.275 8.392 39 H2' G 4 H2'' GUA 4 -8.683 -3.927 7.113 40 HO2' G 4 H2' GUA 4 -10.481 -4.850 7.825 41 H1' G 4 H1' GUA 4 -11.026 -2.318 6.672 42 H8 G 4 H8 GUA 4 -8.008 -0.339 5.839 43 H1 G 4 H1 GUA 4 -9.673 -4.454 1.198 44 H21 G 4 H21 GUA 4 -11.160 -5.879 1.950 45 H22 G 4 H22 GUA 4 -11.758 -5.830 3.593 46 H5' U 5 H5' URI 5 -6.530 -7.095 9.288 47 H5'' U 5 H5'' URI 5 -6.283 -5.934 7.970 48 H4' U 5 H4' URI 5 -8.515 -7.946 8.221 49 H3' U 5 H3' URI 5 -6.087 -7.882 6.444 50 H2' U 5 H2'' URI 5 -7.423 -9.010 4.783 51 HO2' U 5 H2' URI 5 -9.709 -9.454 5.405 52 H1' U 5 H1' URI 5 -9.616 -7.300 5.106 53 H3 U 5 H3 URI 5 -7.567 -6.292 1.146 54 H5 U 5 H5 URI 5 -5.468 -4.141 4.082 55 H6 U 5 H6 URI 5 -6.716 -5.347 5.752 56 H5' G 6 H5' GUA 6 -6.391 -12.607 8.635 57 H5'' G 6 H5'' GUA 6 -4.638 -12.372 8.794 58 H4' G 6 H4' GUA 6 -4.885 -14.641 8.371 59 H3' G 6 H3' GUA 6 -4.133 -13.208 5.831 60 H2' G 6 H2'' GUA 6 -4.052 -15.351 4.756 61 HO2' G 6 H2' GUA 6 -4.124 -17.263 5.924 62 H1' G 6 H1' GUA 6 -6.431 -16.287 5.932 63 H8 G 6 H8 GUA 6 -7.187 -12.786 5.158 64 H1 G 6 H1 GUA 6 -7.142 -16.512 -0.070 65 H21 G 6 H21 GUA 6 -6.200 -18.442 0.385 66 H22 G 6 H22 GUA 6 -5.577 -18.828 1.974 67 H5' G 7 H5' GUA 7 -1.697 -16.275 6.027 68 H5'' G 7 H5'' GUA 7 0.005 -15.837 5.794 69 H4' G 7 H4' GUA 7 -0.469 -17.612 4.318 70 H3' G 7 H3' GUA 7 -0.299 -14.989 2.829 71 H2' G 7 H2'' GUA 7 -0.560 -16.301 0.816 72 HO2' G 7 H2' GUA 7 -0.308 -18.557 2.548 73 H1' G 7 H1' GUA 7 -2.640 -17.869 1.853 74 H8 G 7 H8 GUA 7 -3.313 -14.460 3.120 75 H1 G 7 H1 GUA 7 -4.797 -15.172 -3.092 76 H21 G 7 H21 GUA 7 -3.934 -17.044 -3.855 77 H22 G 7 H22 GUA 7 -2.994 -18.121 -2.846 78 H5' U 8 H5' URI 8 2.046 -17.522 0.903 79 H5'' U 8 H5'' URI 8 3.656 -16.881 0.539 80 H4' U 8 H4' URI 8 2.774 -17.773 -1.460 81 H3' U 8 H3' URI 8 2.706 -14.755 -1.515 82 H2' U 8 H2'' URI 8 1.912 -14.983 -3.794 83 HO2' U 8 H2' URI 8 2.308 -16.747 -4.927 84 H1' U 8 H1' URI 8 0.032 -16.950 -3.158 85 H3 U 8 H3 URI 8 -2.268 -13.097 -3.991 86 H5 U 8 H5 URI 8 -1.121 -12.859 0.040 87 H6 U 8 H6 URI 8 0.295 -14.772 -0.334 88 H5' U 9 H5' URI 9 4.474 -15.922 -4.902 89 H5'' U 9 H5'' URI 9 5.966 -15.041 -5.261 90 H4' U 9 H4' URI 9 4.628 -14.980 -7.196 91 H3' U 9 H3' URI 9 4.607 -12.307 -5.804 92 H2' U 9 H2'' URI 9 3.282 -11.506 -7.655 93 HO2' U 9 H2' URI 9 3.727 -14.075 -8.833 94 H1' U 9 H1' URI 9 1.572 -13.738 -7.668 95 H3 U 9 H3 URI 9 -0.816 -10.230 -5.989 96 H5 U 9 H5 URI 9 1.345 -11.761 -2.731 97 H6 U 9 H6 URI 9 2.586 -13.110 -4.293 98 H5' A 10 H5' ADE 10 5.485 -11.651 -9.651 99 H5'' A 10 H5'' ADE 10 6.851 -10.548 -9.883 100 H4' A 10 H4' ADE 10 5.090 -9.770 -11.231 101 H3' A 10 H3' ADE 10 5.425 -8.032 -8.795 102 H2' A 10 H2'' ADE 10 3.693 -6.627 -9.710 103 HO2' A 10 H2' ADE 10 4.001 -8.262 -12.032 104 H1' A 10 H1' ADE 10 2.007 -8.768 -10.378 105 H8 A 10 H8 ADE 10 3.676 -9.670 -7.162 106 H61 A 10 H61 ADE 10 -0.581 -6.227 -4.261 107 H62 A 10 H62 ADE 10 0.718 -7.379 -4.050 108 H2 A 10 H2 ADE 10 -0.936 -5.463 -8.665 109 H5' G 11 H5' GUA 11 5.372 -5.592 -11.991 110 H5'' G 11 H5'' GUA 11 6.655 -4.368 -11.963 111 H4' G 11 H4' GUA 11 4.627 -3.248 -12.356 112 H3' G 11 H3' GUA 11 5.552 -2.799 -9.519 113 H2' G 11 H2'' GUA 11 3.659 -1.307 -9.306 114 HO2' G 11 H2' GUA 11 3.055 -0.283 -11.061 115 H1' G 11 H1' GUA 11 1.858 -3.087 -10.471 116 H8 G 11 H8 GUA 11 4.220 -5.201 -8.534 117 H1 G 11 H1 GUA 11 -0.059 -2.150 -4.847 118 H21 G 11 H21 GUA 11 -1.110 -0.621 -6.039 119 H22 G 11 H22 GUA 11 -0.762 -0.353 -7.732 120 H5' U 12 H5' URI 12 4.669 0.805 -10.891 121 H5'' U 12 H5'' URI 12 5.934 2.018 -10.624 122 H4' U 12 H4' URI 12 3.900 2.907 -9.815 123 H3' U 12 H3' URI 12 5.710 2.096 -7.542 124 H2' U 12 H2'' URI 12 4.042 3.024 -6.064 125 HO2' U 12 H2' URI 12 2.792 3.931 -8.468 126 H1' U 12 H1' URI 12 1.899 1.781 -7.352 127 H3 U 12 H3 URI 12 2.617 -0.422 -3.411 128 H5 U 12 H5 URI 12 5.184 -2.214 -6.208 129 H6 U 12 H6 URI 12 4.673 -0.410 -7.715 130 H5' C 13 H5' CYT 13 4.486 5.791 -6.697 131 H5'' C 13 H5'' CYT 13 5.800 6.912 -6.299 132 H4' C 13 H4' CYT 13 4.194 7.092 -4.594 133 H3' C 13 H3' CYT 13 6.605 5.555 -3.641 134 H2' C 13 H2'' CYT 13 5.541 5.514 -1.465 135 HO2' C 13 H2' CYT 13 3.557 7.183 -2.667 136 H1' C 13 H1' CYT 13 3.088 4.679 -2.444 137 H41 C 13 H41 CYT 13 6.339 -0.683 -1.342 138 H42 C 13 H42 CYT 13 6.843 -0.690 -3.017 139 H5 C 13 H5 CYT 13 6.371 1.128 -4.538 140 H6 C 13 H6 CYT 13 5.378 3.340 -4.750 141 H5' U 14 H5' URI 14 5.942 8.220 -0.776 142 H5'' U 14 H5'' URI 14 7.361 9.193 -0.343 143 H4' U 14 H4' URI 14 6.479 8.295 1.651 144 H3' U 14 H3' URI 14 9.027 6.905 0.855 145 H2' U 14 H2'' URI 14 8.858 5.646 2.904 146 HO2' U 14 H2' URI 14 6.652 7.373 3.478 147 H1' U 14 H1' URI 14 6.173 5.006 2.540 148 H3 U 14 H3 URI 14 8.641 1.294 1.510 149 H5 U 14 H5 URI 14 8.268 3.493 -2.047 150 H6 U 14 H6 URI 14 7.447 5.326 -0.733 151 H5' A 15 H5' ADE 15 9.407 7.763 4.695 152 H5'' A 15 H5'' ADE 15 10.913 8.595 5.125 153 H4' A 15 H4' ADE 15 10.696 6.733 6.557 154 H3' A 15 H3' ADE 15 12.807 6.273 4.458 155 H2' A 15 H2'' ADE 15 13.278 4.177 5.574 156 HO2' A 15 H2' ADE 15 12.244 3.642 7.519 157 H1' A 15 H1' ADE 15 10.617 3.414 5.698 158 H8 A 15 H8 ADE 15 10.725 5.298 2.542 159 H61 A 15 H61 ADE 15 13.052 0.249 -0.176 160 H62 A 15 H62 ADE 15 12.321 1.815 -0.443 161 H2 A 15 H2 ADE 15 13.300 -0.325 4.266 162 H5' C 16 H5' CYT 16 14.545 5.200 7.851 163 H5'' C 16 H5'' CYT 16 16.133 5.948 8.114 164 H4' C 16 H4' CYT 16 16.402 3.613 8.362 165 H3' C 16 H3' CYT 16 17.538 4.573 5.739 166 H2' C 16 H2'' CYT 16 18.321 2.301 5.414 167 HO2' C 16 H2' CYT 16 18.124 0.756 7.037 168 H1' C 16 H1' CYT 16 15.863 1.162 6.044 169 H41 C 16 H41 CYT 16 15.547 2.363 -0.207 170 H42 C 16 H42 CYT 16 14.882 3.935 0.146 171 H5 C 16 H5 CYT 16 14.753 4.834 2.372 172 H6 C 16 H6 CYT 16 15.187 4.393 4.722 173 H5' G 17 H5' GUA 17 20.461 2.297 7.197 174 H5'' G 17 H5'' GUA 17 22.009 3.165 7.236 175 H4' G 17 H4' GUA 17 22.396 1.122 6.123 176 H3' G 17 H3' GUA 17 22.270 3.422 4.174 177 H2' G 17 H2'' GUA 17 22.865 1.814 2.467 178 HO2' G 17 H2' GUA 17 23.700 -0.145 2.945 179 H1' G 17 H1' GUA 17 21.067 -0.147 3.382 180 H8 G 17 H8 GUA 17 19.376 3.150 3.728 181 H1 G 17 H1 GUA 17 19.362 0.968 -2.305 182 H21 G 17 H21 GUA 17 20.742 -0.729 -2.503 183 H22 G 17 H22 GUA 17 21.671 -1.342 -1.153 184 H5' U 18 H5' URI 18 25.657 1.571 3.112 185 H5'' U 18 H5'' URI 18 27.028 2.694 3.025 186 H4' U 18 H4' URI 18 26.929 1.546 0.961 187 H3' U 18 H3' URI 18 25.904 4.368 0.693 188 H2' U 18 H2'' URI 18 25.605 3.940 -1.638 189 HO2' U 18 H2' URI 18 26.580 2.186 -2.659 190 H1' U 18 H1' URI 18 24.732 1.228 -1.285 191 H3 U 18 H3 URI 18 21.329 3.536 -3.261 192 H5 U 18 H5 URI 18 21.129 4.545 0.810 193 H6 U 18 H6 URI 18 23.218 3.402 1.113 194 H5' U 19 H5' URI 19 28.336 7.552 -1.921 195 H5'' U 19 H5'' URI 19 26.677 7.208 -1.401 196 H4' U 19 H4' URI 19 27.948 6.496 -4.042 197 H3' U 19 H3' URI 19 25.865 8.556 -3.324 198 H2' U 19 H2'' URI 19 24.879 8.144 -5.477 199 HO2' U 19 H2' URI 19 26.089 7.530 -7.112 200 H1' U 19 H1' URI 19 25.215 5.328 -5.370 201 H3 U 19 H3 URI 19 20.754 6.316 -5.278 202 H5 U 19 H5 URI 19 22.094 6.898 -1.342 203 H6 U 19 H6 URI 19 24.338 6.557 -2.137 204 H5' U 20 H5' URI 20 26.251 12.902 -4.270 205 H5'' U 20 H5'' URI 20 24.628 12.188 -4.268 206 H4' U 20 H4' URI 20 24.809 13.935 -5.924 207 H3' U 20 H3' URI 20 23.515 11.676 -6.510 208 H2' U 20 H2'' URI 20 25.481 10.489 -7.364 209 HO2' U 20 H2' URI 20 24.152 10.208 -9.075 210 H1' U 20 H1' URI 20 26.118 13.071 -8.914 211 H3 U 20 H3 URI 20 29.915 11.596 -10.711 212 H5 U 20 H5 URI 20 29.758 9.488 -7.083 213 H6 U 20 H6 URI 20 27.652 10.560 -6.637 214 H5' C 21 H5' CYT 21 20.960 12.005 -9.257 215 H5'' C 21 H5'' CYT 21 19.885 13.363 -8.885 216 H4' C 21 H4' CYT 21 18.890 10.996 -9.098 217 H3' C 21 H3' CYT 21 17.781 13.121 -7.929 218 H2' C 21 H2'' CYT 21 18.824 12.801 -5.748 219 HO2' C 21 H2' CYT 21 17.160 11.975 -4.432 220 H1' C 21 H1' CYT 21 18.115 9.826 -6.051 221 H41 C 21 H41 CYT 21 21.529 9.266 -0.743 222 H42 C 21 H42 CYT 21 22.705 10.434 -1.302 223 H5 C 21 H5 CYT 21 22.502 11.594 -3.416 224 H6 C 21 H6 CYT 21 21.131 11.879 -5.405 225 H5' G 22 H5' GUA 22 17.038 11.093 -12.186 226 H5'' G 22 H5'' GUA 22 15.765 9.884 -11.941 227 H4' G 22 H4' GUA 22 17.442 8.915 -13.290 228 H3' G 22 H3' GUA 22 17.454 7.772 -10.507 229 H2' G 22 H2'' GUA 22 19.244 6.335 -11.195 230 HO2' G 22 H2' GUA 22 19.558 5.792 -13.267 231 H1' G 22 H1' GUA 22 20.552 8.268 -12.802 232 H8 G 22 H8 GUA 22 20.292 10.410 -10.165 233 H1 G 22 H1 GUA 22 24.130 5.547 -8.552 234 H21 G 22 H21 GUA 22 23.787 3.840 -9.892 235 H22 G 22 H22 GUA 22 22.596 3.879 -11.174 236 H5' A 23 H5' ADE 23 17.619 4.682 -12.912 237 H5'' A 23 H5'' ADE 23 16.428 3.397 -12.655 238 H4' A 23 H4' ADE 23 18.685 2.511 -12.698 239 H3' A 23 H3' ADE 23 17.306 2.285 -10.022 240 H2' A 23 H2'' ADE 23 19.264 1.061 -9.274 241 HO2' A 23 H2' ADE 23 20.824 0.381 -10.670 242 H1' A 23 H1' ADE 23 21.035 2.973 -10.209 243 H8 A 23 H8 ADE 23 17.849 4.714 -9.211 244 H61 A 23 H61 ADE 23 19.786 4.446 -3.343 245 H62 A 23 H62 ADE 23 18.584 5.103 -4.427 246 H2 A 23 H2 ADE 23 22.590 1.999 -5.834 247 H5' C 24 H5' CYT 24 18.795 -1.297 -10.878 248 H5'' C 24 H5'' CYT 24 17.683 -2.658 -10.655 249 H4' C 24 H4' CYT 24 19.680 -3.151 -9.488 250 H3' C 24 H3' CYT 24 17.456 -2.446 -7.579 251 H2' C 24 H2'' CYT 24 19.011 -2.984 -5.796 252 HO2' C 24 H2' CYT 24 20.978 -3.931 -6.201 253 H1' C 24 H1' CYT 24 21.056 -1.436 -6.853 254 H41 C 24 H41 CYT 24 17.529 2.496 -3.264 255 H42 C 24 H42 CYT 24 16.531 2.846 -4.652 256 H5 C 24 H5 CYT 24 16.778 1.719 -6.759 257 H6 C 24 H6 CYT 24 18.002 0.003 -7.962 258 H5' G 25 H5' GUA 25 19.062 -5.780 -6.210 259 H5'' G 25 H5'' GUA 25 17.898 -7.057 -5.818 260 H4' G 25 H4' GUA 25 19.311 -6.774 -3.950 261 H3' G 25 H3' GUA 25 16.580 -5.611 -3.407 262 H2' G 25 H2'' GUA 25 17.380 -5.188 -1.158 263 HO2' G 25 H2' GUA 25 18.955 -6.364 -0.353 264 H1' G 25 H1' GUA 25 19.768 -4.044 -2.001 265 H8 G 25 H8 GUA 25 17.269 -3.076 -4.560 266 H1 G 25 H1 GUA 25 16.669 0.293 0.862 267 H21 G 25 H21 GUA 25 17.860 -0.624 2.463 268 H22 G 25 H22 GUA 25 18.816 -2.067 2.212 269 H5' U 26 H5' URI 26 17.475 -7.831 -0.310 270 H5'' U 26 H5'' URI 26 16.212 -8.955 0.222 271 H4' U 26 H4' URI 26 16.921 -7.683 2.093 272 H3' U 26 H3' URI 26 14.173 -6.842 1.181 273 H2' U 26 H2'' URI 26 14.136 -5.364 3.089 274 HO2' U 26 H2' URI 26 16.582 -6.663 3.806 275 H1' U 26 H1' URI 26 16.709 -4.369 2.631 276 H3 U 26 H3 URI 26 13.708 -1.131 1.449 277 H5 U 26 H5 URI 26 14.154 -3.571 -1.935 278 H6 U 26 H6 URI 26 15.348 -5.134 -0.559 279 H5' A 27 H5' ADE 27 14.072 -7.374 5.058 280 H5'' A 27 H5'' ADE 27 12.698 -8.310 5.673 281 H4' A 27 H4' ADE 27 12.811 -6.282 6.888 282 H3' A 27 H3' ADE 27 10.498 -6.285 4.958 283 H2' A 27 H2'' ADE 27 9.881 -4.146 5.889 284 HO2' A 27 H2' ADE 27 11.908 -4.743 7.811 285 H1' A 27 H1' ADE 27 12.487 -3.119 5.813 286 H8 A 27 H8 ADE 27 12.184 -5.185 2.757 287 H61 A 27 H61 ADE 27 9.396 -0.371 0.046 288 H62 A 27 H62 ADE 27 10.168 -1.918 -0.217 289 H2 A 27 H2 ADE 27 9.590 0.440 4.452 290 H5' G 28 H5' GUA 28 9.172 -5.105 8.429 291 H5'' G 28 H5'' GUA 28 7.675 -5.872 8.989 292 H4' G 28 H4' GUA 28 7.386 -3.523 9.100 293 H3' G 28 H3' GUA 28 5.835 -4.749 6.834 294 H2' G 28 H2'' GUA 28 4.976 -2.569 6.345 295 HO2' G 28 H2' GUA 28 5.327 -0.824 7.819 296 H1' G 28 H1' GUA 28 7.436 -1.212 6.853 297 H8 G 28 H8 GUA 28 8.188 -4.221 4.811 298 H1 G 28 H1 GUA 28 5.895 0.662 1.325 299 H21 G 28 H21 GUA 28 5.057 2.203 2.644 300 H22 G 28 H22 GUA 28 5.053 2.044 4.387 301 H5' U 29 H5' URI 29 0.879 -3.747 7.693 302 H5'' U 29 H5'' URI 29 1.960 -3.822 6.287 303 H4' U 29 H4' URI 29 1.075 -1.398 7.828 304 H3' U 29 H3' URI 29 0.498 -2.328 5.029 305 H2' U 29 H2'' URI 29 0.356 0.013 4.419 306 HO2' U 29 H2' URI 29 -0.035 1.496 5.894 307 H1' U 29 H1' URI 29 2.772 0.659 5.589 308 H3 U 29 H3 URI 29 3.500 0.129 1.096 309 H5 U 29 H5 URI 29 4.174 -3.651 2.802 310 H6 U 29 H6 URI 29 3.182 -2.746 4.925 311 H5' U 30 H5' URI 30 -2.044 0.603 5.604 312 H5'' U 30 H5'' URI 30 -3.717 0.198 5.173 313 H4' U 30 H4' URI 30 -3.149 2.160 3.994 314 H3' U 30 H3' URI 30 -3.176 -0.247 2.180 315 H2' U 30 H2'' URI 30 -2.764 1.306 0.361 316 HO2' U 30 H2' URI 30 -2.851 3.509 0.662 317 H1' U 30 H1' URI 30 -0.695 2.608 1.686 318 H3 U 30 H3 URI 30 1.228 -0.133 -1.441 319 H5 U 30 H5 URI 30 0.770 -2.464 2.019 320 H6 U 30 H6 URI 30 -0.597 -0.707 2.930 321 H5' C 31 H5' CYT 31 -5.375 2.441 0.259 322 H5'' C 31 H5'' CYT 31 -6.930 1.799 -0.304 323 H4' C 31 H4' CYT 31 -5.857 2.775 -2.163 324 H3' C 31 H3' CYT 31 -5.719 -0.237 -2.298 325 H2' C 31 H2'' CYT 31 -4.685 0.073 -4.472 326 HO2' C 31 H2' CYT 31 -5.139 2.865 -4.078 327 H1' C 31 H1' CYT 31 -2.885 1.989 -3.555 328 H41 C 31 H41 CYT 31 0.076 -3.591 -2.787 329 H42 C 31 H42 CYT 31 -0.613 -3.740 -1.189 330 H5 C 31 H5 CYT 31 -2.261 -2.194 -0.321 331 H6 C 31 H6 CYT 31 -3.592 -0.211 -0.821 332 H5' U 32 H5' URI 32 -7.018 0.842 -5.871 333 H5'' U 32 H5'' URI 32 -8.459 -0.041 -6.404 334 H4' U 32 H4' URI 32 -6.848 -0.178 -8.131 335 H3' U 32 H3' URI 32 -7.083 -2.807 -6.669 336 H2' U 32 H2'' URI 32 -5.525 -3.691 -8.285 337 HO2' U 32 H2' URI 32 -4.896 -2.475 -10.091 338 H1' U 32 H1' URI 32 -3.793 -1.479 -8.132 339 H3 U 32 H3 URI 32 -1.708 -4.991 -6.094 340 H5 U 32 H5 URI 32 -4.246 -3.360 -3.173 341 H6 U 32 H6 URI 32 -5.236 -2.009 -4.901 342 H5' A 33 H5' ADE 33 -7.392 -3.545 -10.565 343 H5'' A 33 H5'' ADE 33 -8.693 -4.667 -10.993 344 H4' A 33 H4' ADE 33 -6.718 -5.441 -12.017 345 H3' A 33 H3' ADE 33 -7.439 -7.177 -9.658 346 H2' A 33 H2'' ADE 33 -5.562 -8.563 -10.297 347 HO2' A 33 H2' ADE 33 -4.618 -8.419 -12.257 348 H1' A 33 H1' ADE 33 -3.823 -6.402 -10.669 349 H8 A 33 H8 ADE 33 -5.957 -5.521 -7.743 350 H61 A 33 H61 ADE 33 -2.185 -9.011 -4.274 351 H62 A 33 H62 ADE 33 -3.485 -7.841 -4.240 352 H2 A 33 H2 ADE 33 -1.213 -9.765 -8.577 353 H5' A 34 H5' ADE 34 -6.771 -9.580 -12.736 354 H5'' A 34 H5'' ADE 34 -7.983 -10.850 -12.967 355 H4' A 34 H4' ADE 34 -5.848 -11.865 -12.965 356 H3' A 34 H3' ADE 34 -7.313 -12.458 -10.394 357 H2' A 34 H2'' ADE 34 -5.422 -13.875 -9.842 358 HO2' A 34 H2' ADE 34 -3.666 -13.990 -11.445 359 H1' A 34 H1' ADE 34 -3.521 -11.965 -10.564 360 H8 A 34 H8 ADE 34 -6.397 -10.122 -9.039 361 H61 A 34 H61 ADE 34 -3.961 -11.453 -3.501 362 H62 A 34 H62 ADE 34 -5.145 -10.484 -4.350 363 H2 A 34 H2 ADE 34 -1.817 -13.889 -6.589 364 H5' C 35 H5' CYT 35 -5.972 -15.900 -11.763 365 H5'' C 35 H5'' CYT 35 -7.140 -17.232 -11.743 366 H4' C 35 H4' CYT 35 -5.160 -17.947 -10.642 367 H3' C 35 H3' CYT 35 -7.392 -17.475 -8.663 368 H2' C 35 H2'' CYT 35 -5.856 -18.322 -6.989 369 HO2' C 35 H2' CYT 35 -4.209 -18.945 -9.236 370 H1' C 35 H1' CYT 35 -3.710 -16.767 -7.890 371 H41 C 35 H41 CYT 35 -6.492 -13.288 -3.360 372 H42 C 35 H42 CYT 35 -7.562 -12.582 -4.548 373 H5 C 35 H5 CYT 35 -7.664 -13.354 -6.847 374 H6 C 35 H6 CYT 35 -6.744 -14.937 -8.457 375 H5' C 36 H5' CYT 36 -5.914 -21.043 -7.784 376 H5'' C 36 H5'' CYT 36 -7.128 -22.325 -7.618 377 H4' C 36 H4' CYT 36 -5.759 -22.362 -5.684 378 H3' C 36 H3' CYT 36 -8.477 -21.200 -5.078 379 HO3' C 36 H3T CYT 36 -7.189 -23.678 -4.920 380 H2' C 36 H2'' CYT 36 -7.773 -21.060 -2.787 381 HO2' C 36 H2' CYT 36 -6.658 -23.219 -3.015 382 H1' C 36 H1' CYT 36 -5.119 -20.215 -3.406 383 H41 C 36 H41 CYT 36 -8.374 -15.018 -1.699 384 H42 C 36 H42 CYT 36 -8.964 -14.853 -3.336 385 H5 C 36 H5 CYT 36 -8.553 -16.500 -5.053 386 H6 C 36 H6 CYT 36 -7.502 -18.638 -5.547 Start of MODEL 8 1 H5' G 1 H5' GUA 1 -24.982 0.291 12.772 2 H5'' G 1 H5'' GUA 1 -24.910 2.058 12.682 3 H4' G 1 H4' GUA 1 -23.455 2.024 14.324 4 H3' G 1 H3' GUA 1 -21.665 0.712 12.286 5 H2' G 1 H2'' GUA 1 -20.115 0.279 14.041 6 HO2' G 1 H2' GUA 1 -21.631 2.144 15.590 7 H1' G 1 H1' GUA 1 -22.137 -0.141 16.064 8 H8 G 1 H8 GUA 1 -22.856 -2.286 13.130 9 H1 G 1 H1 GUA 1 -18.256 -4.655 16.934 10 H21 G 1 H21 GUA 1 -17.582 -3.116 18.348 11 H22 G 1 H22 GUA 1 -18.256 -1.502 18.368 12 HO5' G 1 H5T GUA 1 -23.478 1.941 11.049 13 H5' G 2 H5' GUA 2 -17.252 3.054 11.916 14 H5'' G 2 H5'' GUA 2 -17.885 1.416 11.662 15 H4' G 2 H4' GUA 2 -16.630 2.493 14.186 16 H3' G 2 H3' GUA 2 -15.548 0.645 12.071 17 H2' G 2 H2'' GUA 2 -14.422 -0.554 13.792 18 HO2' G 2 H2' GUA 2 -13.468 0.897 15.077 19 H1' G 2 H1' GUA 2 -16.493 -0.183 15.762 20 H8 G 2 H8 GUA 2 -18.039 -1.495 12.680 21 H1 G 2 H1 GUA 2 -15.119 -6.036 16.156 22 H21 G 2 H21 GUA 2 -13.832 -5.111 17.675 23 H22 G 2 H22 GUA 2 -13.682 -3.376 17.847 24 H5' A 3 H5' ADE 3 -10.628 0.717 11.629 25 H5'' A 3 H5'' ADE 3 -11.969 -0.424 11.408 26 H4' A 3 H4' ADE 3 -10.167 -0.144 13.801 27 H3' A 3 H3' ADE 3 -10.371 -2.271 11.687 28 H2' A 3 H2'' ADE 3 -9.758 -3.874 13.367 29 HO2' A 3 H2' ADE 3 -9.379 -1.644 15.118 30 H1' A 3 H1' ADE 3 -11.503 -2.855 15.306 31 H8 A 3 H8 ADE 3 -13.374 -2.483 12.156 32 H61 A 3 H61 ADE 3 -14.876 -8.471 12.591 33 H62 A 3 H62 ADE 3 -15.210 -6.964 11.768 34 H2 A 3 H2 ADE 3 -11.626 -7.632 15.565 35 H5' G 4 H5' GUA 4 -7.060 -3.119 13.634 36 H5'' G 4 H5'' GUA 4 -5.650 -3.385 12.589 37 H4' G 4 H4' GUA 4 -5.842 -5.261 14.005 38 H3' G 4 H3' GUA 4 -6.739 -5.912 11.202 39 H2' G 4 H2'' GUA 4 -7.009 -8.188 11.951 40 HO2' G 4 H2' GUA 4 -6.094 -8.926 13.777 41 H1' G 4 H1' GUA 4 -8.348 -7.481 14.303 42 H8 G 4 H8 GUA 4 -9.528 -5.046 11.789 43 H1 G 4 H1 GUA 4 -12.194 -10.847 11.094 44 H21 G 4 H21 GUA 4 -11.112 -12.325 12.300 45 H22 G 4 H22 GUA 4 -9.729 -11.902 13.285 46 H5' U 5 H5' URI 5 -4.317 -8.776 12.252 47 H5'' U 5 H5'' URI 5 -3.047 -9.167 11.082 48 H4' U 5 H4' URI 5 -4.142 -11.173 11.663 49 H3' U 5 H3' URI 5 -4.862 -10.288 8.882 50 H2' U 5 H2'' URI 5 -6.152 -12.310 8.669 51 HO2' U 5 H2' URI 5 -6.123 -13.874 10.361 52 H1' U 5 H1' URI 5 -7.390 -12.050 11.146 53 H3 U 5 H3 URI 5 -10.482 -10.955 7.970 54 H5 U 5 H5 URI 5 -8.434 -7.404 8.863 55 H6 U 5 H6 URI 5 -6.841 -8.720 10.096 56 H5' G 6 H5' GUA 6 -4.102 -14.424 8.873 57 H5'' G 6 H5'' GUA 6 -2.359 -14.108 8.839 58 H4' G 6 H4' GUA 6 -2.564 -16.261 8.046 59 H3' G 6 H3' GUA 6 -2.260 -14.394 5.707 60 H2' G 6 H2'' GUA 6 -2.271 -16.334 4.292 61 HO2' G 6 H2' GUA 6 -2.235 -17.882 6.697 62 H1' G 6 H1' GUA 6 -4.395 -17.600 5.644 63 H8 G 6 H8 GUA 6 -5.460 -14.090 5.552 64 H1 G 6 H1 GUA 6 -5.929 -16.996 -0.170 65 H21 G 6 H21 GUA 6 -4.852 -18.904 -0.138 66 H22 G 6 H22 GUA 6 -4.005 -19.480 1.279 67 H5' G 7 H5' GUA 7 0.296 -17.324 5.193 68 H5'' G 7 H5'' GUA 7 1.945 -16.809 4.796 69 H4' G 7 H4' GUA 7 1.293 -18.414 3.193 70 H3' G 7 H3' GUA 7 1.268 -15.630 2.021 71 H2' G 7 H2'' GUA 7 0.748 -16.692 -0.085 72 HO2' G 7 H2' GUA 7 1.214 -18.751 -0.456 73 H1' G 7 H1' GUA 7 -1.162 -18.430 1.021 74 H8 G 7 H8 GUA 7 -1.714 -15.180 2.724 75 H1 G 7 H1 GUA 7 -3.982 -15.330 -3.286 76 H21 G 7 H21 GUA 7 -3.206 -17.101 -4.327 77 H22 G 7 H22 GUA 7 -2.130 -18.245 -3.555 78 H5' U 8 H5' URI 8 3.322 -17.887 -0.454 79 H5'' U 8 H5'' URI 8 4.870 -17.203 -0.980 80 H4' U 8 H4' URI 8 3.665 -17.870 -2.907 81 H3' U 8 H3' URI 8 3.681 -14.857 -2.635 82 H2' U 8 H2'' URI 8 2.558 -14.850 -4.792 83 HO2' U 8 H2' URI 8 3.883 -16.977 -5.308 84 H1' U 8 H1' URI 8 0.764 -16.893 -4.086 85 H3 U 8 H3 URI 8 -1.651 -13.032 -4.316 86 H5 U 8 H5 URI 8 -0.021 -13.098 -0.448 87 H6 U 8 H6 URI 8 1.363 -14.942 -1.147 88 H5' U 9 H5' URI 9 4.861 -15.670 -6.322 89 H5'' U 9 H5'' URI 9 6.276 -14.765 -6.878 90 H4' U 9 H4' URI 9 4.541 -14.500 -8.472 91 H3' U 9 H3' URI 9 4.969 -11.966 -6.890 92 H2' U 9 H2'' URI 9 3.303 -10.955 -8.300 93 HO2' U 9 H2' URI 9 2.564 -11.981 -10.169 94 H1' U 9 H1' URI 9 1.571 -13.200 -8.246 95 H3 U 9 H3 URI 9 -0.524 -9.839 -5.994 96 H5 U 9 H5 URI 9 2.078 -11.585 -3.201 97 H6 U 9 H6 URI 9 3.071 -12.816 -5.018 98 H5' A 10 H5' ADE 10 4.974 -11.081 -10.749 99 H5'' A 10 H5'' ADE 10 6.241 -9.959 -11.273 100 H4' A 10 H4' ADE 10 4.160 -9.128 -12.032 101 H3' A 10 H3' ADE 10 5.220 -7.488 -9.738 102 H2' A 10 H2'' ADE 10 3.305 -6.066 -10.013 103 HO2' A 10 H2' ADE 10 2.225 -5.938 -11.879 104 H1' A 10 H1' ADE 10 1.485 -8.199 -10.481 105 H8 A 10 H8 ADE 10 3.701 -9.158 -7.638 106 H61 A 10 H61 ADE 10 -0.108 -5.970 -3.941 107 H62 A 10 H62 ADE 10 1.219 -7.109 -3.998 108 H2 A 10 H2 ADE 10 -1.166 -5.007 -8.193 109 H5' G 11 H5' GUA 11 4.179 -5.005 -12.630 110 H5'' G 11 H5'' GUA 11 5.361 -3.737 -13.002 111 H4' G 11 H4' GUA 11 3.264 -2.699 -12.609 112 H3' G 11 H3' GUA 11 5.183 -2.265 -10.326 113 H2' G 11 H2'' GUA 11 3.497 -0.959 -9.266 114 HO2' G 11 H2' GUA 11 3.000 0.192 -11.278 115 H1' G 11 H1' GUA 11 1.295 -2.552 -10.248 116 H8 G 11 H8 GUA 11 3.866 -4.699 -8.597 117 H1 G 11 H1 GUA 11 -0.069 -1.746 -4.468 118 H21 G 11 H21 GUA 11 -1.235 -0.209 -5.525 119 H22 G 11 H22 GUA 11 -1.052 0.092 -7.239 120 H5' U 12 H5' URI 12 6.215 2.617 -9.762 121 H5'' U 12 H5'' URI 12 6.005 1.195 -8.721 122 H4' U 12 H4' URI 12 3.991 3.344 -9.341 123 H3' U 12 H3' URI 12 5.541 2.690 -6.850 124 H2' U 12 H2'' URI 12 3.645 3.446 -5.578 125 HO2' U 12 H2' URI 12 2.256 4.839 -6.398 126 H1' U 12 H1' URI 12 1.763 2.073 -7.122 127 H3 U 12 H3 URI 12 2.251 -0.081 -3.102 128 H5 U 12 H5 URI 12 5.047 -1.793 -5.727 129 H6 U 12 H6 URI 12 4.572 -0.014 -7.273 130 H5' C 13 H5' CYT 13 3.941 6.253 -6.024 131 H5'' C 13 H5'' CYT 13 5.171 7.443 -5.558 132 H4' C 13 H4' CYT 13 3.510 7.501 -3.898 133 H3' C 13 H3' CYT 13 5.967 6.048 -2.936 134 H2' C 13 H2'' CYT 13 4.872 5.894 -0.783 135 HO2' C 13 H2' CYT 13 2.793 7.461 -1.960 136 H1' C 13 H1' CYT 13 2.478 4.974 -1.835 137 H41 C 13 H41 CYT 13 5.975 -0.251 -0.826 138 H42 C 13 H42 CYT 13 6.501 -0.187 -2.493 139 H5 C 13 H5 CYT 13 5.966 1.650 -3.970 140 H6 C 13 H6 CYT 13 4.854 3.810 -4.141 141 H5' U 14 H5' URI 14 5.208 8.558 0.070 142 H5'' U 14 H5'' URI 14 6.593 9.597 0.455 143 H4' U 14 H4' URI 14 5.860 8.640 2.477 144 H3' U 14 H3' URI 14 8.408 7.346 1.528 145 H2' U 14 H2'' URI 14 8.396 6.070 3.573 146 HO2' U 14 H2' URI 14 7.330 6.752 5.294 147 H1' U 14 H1' URI 14 5.712 5.349 3.352 148 H3 U 14 H3 URI 14 8.248 1.714 2.195 149 H5 U 14 H5 URI 14 7.657 3.917 -1.329 150 H6 U 14 H6 URI 14 6.811 5.708 0.025 151 H5' A 15 H5' ADE 15 8.987 8.185 5.345 152 H5'' A 15 H5'' ADE 15 10.495 9.055 5.681 153 H4' A 15 H4' ADE 15 10.423 7.194 7.124 154 H3' A 15 H3' ADE 15 12.396 6.759 4.887 155 H2' A 15 H2'' ADE 15 12.978 4.682 5.988 156 HO2' A 15 H2' ADE 15 11.217 5.596 8.043 157 H1' A 15 H1' ADE 15 10.344 3.877 6.302 158 H8 A 15 H8 ADE 15 10.261 5.737 3.116 159 H61 A 15 H61 ADE 15 12.481 0.681 0.323 160 H62 A 15 H62 ADE 15 11.740 2.246 0.082 161 H2 A 15 H2 ADE 15 12.919 0.127 4.753 162 H5' C 16 H5' CYT 16 14.382 5.781 8.176 163 H5'' C 16 H5'' CYT 16 15.973 6.551 8.320 164 H4' C 16 H4' CYT 16 16.286 4.230 8.598 165 H3' C 16 H3' CYT 16 17.245 5.131 5.886 166 H2' C 16 H2'' CYT 16 18.021 2.857 5.564 167 HO2' C 16 H2' CYT 16 17.650 1.320 7.312 168 H1' C 16 H1' CYT 16 15.615 1.722 6.370 169 H41 C 16 H41 CYT 16 14.888 2.814 0.130 170 H42 C 16 H42 CYT 16 14.230 4.387 0.499 171 H5 C 16 H5 CYT 16 14.217 5.314 2.718 172 H6 C 16 H6 CYT 16 14.818 4.923 5.042 173 H5' G 17 H5' GUA 17 20.249 2.929 7.285 174 H5'' G 17 H5'' GUA 17 21.811 3.764 7.196 175 H4' G 17 H4' GUA 17 22.092 1.648 6.191 176 H3' G 17 H3' GUA 17 21.958 3.819 4.097 177 H2' G 17 H2'' GUA 17 22.441 2.073 2.487 178 HO2' G 17 H2' GUA 17 22.882 0.483 4.812 179 H1' G 17 H1' GUA 17 20.570 0.289 3.551 180 H8 G 17 H8 GUA 17 19.046 3.660 3.870 181 H1 G 17 H1 GUA 17 18.717 1.337 -2.103 182 H21 G 17 H21 GUA 17 20.035 -0.406 -2.312 183 H22 G 17 H22 GUA 17 21.000 -1.017 -0.987 184 H5' U 18 H5' URI 18 25.177 1.714 3.113 185 H5'' U 18 H5'' URI 18 26.614 2.712 2.810 186 H4' U 18 H4' URI 18 26.294 1.321 0.920 187 H3' U 18 H3' URI 18 25.476 4.169 0.313 188 H2' U 18 H2'' URI 18 25.118 3.393 -1.956 189 HO2' U 18 H2' URI 18 27.045 1.839 -1.639 190 H1' U 18 H1' URI 18 23.787 1.047 -1.167 191 H3 U 18 H3 URI 18 20.747 3.845 -3.114 192 H5 U 18 H5 URI 18 21.004 5.092 0.885 193 H6 U 18 H6 URI 18 22.868 3.605 1.149 194 H5' U 19 H5' URI 19 27.708 3.274 -2.762 195 H5'' U 19 H5'' URI 19 28.924 4.509 -3.140 196 H4' U 19 H4' URI 19 27.629 4.144 -5.094 197 H3' U 19 H3' URI 19 26.931 6.771 -3.786 198 H2' U 19 H2'' URI 19 25.437 7.159 -5.632 199 HO2' U 19 H2' URI 19 25.603 6.081 -7.518 200 H1' U 19 H1' URI 19 24.413 4.524 -5.658 201 H3 U 19 H3 URI 19 21.080 7.289 -4.247 202 H5 U 19 H5 URI 19 23.424 6.552 -0.841 203 H6 U 19 H6 URI 19 25.039 5.501 -2.279 204 H5' U 20 H5' URI 20 28.222 10.633 -6.281 205 H5'' U 20 H5'' URI 20 26.478 10.372 -6.109 206 H4' U 20 H4' URI 20 26.988 11.478 -8.197 207 H3' U 20 H3' URI 20 25.161 9.537 -8.120 208 H2' U 20 H2'' URI 20 26.753 7.712 -8.508 209 HO2' U 20 H2' URI 20 25.853 6.944 -10.281 210 H1' U 20 H1' URI 20 27.892 9.461 -10.772 211 H3 U 20 H3 URI 20 31.123 6.624 -11.940 212 H5 U 20 H5 URI 20 30.682 5.850 -7.837 213 H6 U 20 H6 URI 20 28.915 7.479 -7.796 214 H5' C 21 H5' CYT 21 22.449 9.618 -10.487 215 H5'' C 21 H5'' CYT 21 21.990 11.288 -10.871 216 H4' C 21 H4' CYT 21 20.111 9.886 -10.090 217 H3' C 21 H3' CYT 21 20.332 12.491 -9.561 218 H2' C 21 H2'' CYT 21 21.649 12.234 -7.528 219 HO2' C 21 H2' CYT 21 18.875 12.252 -6.838 220 H1' C 21 H1' CYT 21 19.640 10.050 -6.726 221 H41 C 21 H41 CYT 21 23.660 9.192 -1.923 222 H42 C 21 H42 CYT 21 25.038 9.221 -3.000 223 H5 C 21 H5 CYT 21 24.839 9.633 -5.377 224 H6 C 21 H6 CYT 21 23.288 10.122 -7.193 225 H5' G 22 H5' GUA 22 16.127 9.789 -10.974 226 H5'' G 22 H5'' GUA 22 17.547 9.307 -10.023 227 H4' G 22 H4' GUA 22 17.017 8.938 -12.956 228 H3' G 22 H3' GUA 22 17.447 7.057 -10.670 229 H2' G 22 H2'' GUA 22 18.880 5.694 -11.964 230 HO2' G 22 H2' GUA 22 17.592 6.863 -14.228 231 H1' G 22 H1' GUA 22 19.742 7.760 -13.830 232 H8 G 22 H8 GUA 22 22.209 7.378 -13.748 233 H1 G 22 H1 GUA 22 22.123 6.440 -7.402 234 H21 G 22 H21 GUA 22 20.073 6.618 -6.641 235 H22 G 22 H22 GUA 22 18.713 6.968 -7.685 236 H5' A 23 H5' ADE 23 16.873 4.400 -12.834 237 H5'' A 23 H5'' ADE 23 15.671 3.165 -12.424 238 H4' A 23 H4' ADE 23 17.950 2.275 -12.450 239 H3' A 23 H3' ADE 23 16.582 2.227 -9.759 240 H2' A 23 H2'' ADE 23 18.548 1.061 -8.939 241 HO2' A 23 H2' ADE 23 19.432 1.148 -11.656 242 H1' A 23 H1' ADE 23 20.305 2.916 -10.006 243 H8 A 23 H8 ADE 23 17.073 4.641 -9.082 244 H61 A 23 H61 ADE 23 19.106 4.879 -3.243 245 H62 A 23 H62 ADE 23 17.866 5.414 -4.355 246 H2 A 23 H2 ADE 23 21.953 2.341 -5.609 247 H5' C 24 H5' CYT 24 18.090 -1.369 -10.419 248 H5'' C 24 H5'' CYT 24 17.014 -2.736 -10.080 249 H4' C 24 H4' CYT 24 19.052 -3.096 -8.930 250 H3' C 24 H3' CYT 24 16.837 -2.345 -7.032 251 H2' C 24 H2'' CYT 24 18.432 -2.715 -5.244 252 HO2' C 24 H2' CYT 24 20.135 -3.956 -5.541 253 H1' C 24 H1' CYT 24 20.414 -1.179 -6.433 254 H41 C 24 H41 CYT 24 16.863 2.873 -3.014 255 H42 C 24 H42 CYT 24 15.834 3.126 -4.401 256 H5 C 24 H5 CYT 24 16.070 1.886 -6.451 257 H6 C 24 H6 CYT 24 17.301 0.119 -7.571 258 H5' G 25 H5' GUA 25 18.581 -5.547 -5.508 259 H5'' G 25 H5'' GUA 25 17.472 -6.842 -5.025 260 H4' G 25 H4' GUA 25 18.909 -6.405 -3.204 261 H3' G 25 H3' GUA 25 16.142 -5.319 -2.674 262 H2' G 25 H2'' GUA 25 16.959 -4.740 -0.470 263 HO2' G 25 H2' GUA 25 19.322 -6.136 -1.258 264 H1' G 25 H1' GUA 25 19.301 -3.572 -1.413 265 H8 G 25 H8 GUA 25 16.739 -2.799 -3.971 266 H1 G 25 H1 GUA 25 16.153 0.828 1.287 267 H21 G 25 H21 GUA 25 17.384 0.011 2.913 268 H22 G 25 H22 GUA 25 18.361 -1.427 2.719 269 H5' U 26 H5' URI 26 17.175 -7.336 0.517 270 H5'' U 26 H5'' URI 26 15.967 -8.472 1.141 271 H4' U 26 H4' URI 26 16.668 -7.059 2.918 272 H3' U 26 H3' URI 26 13.866 -6.393 2.016 273 H2' U 26 H2'' URI 26 13.803 -4.800 3.828 274 HO2' U 26 H2' URI 26 15.048 -5.054 5.537 275 H1' U 26 H1' URI 26 16.336 -3.744 3.264 276 H3 U 26 H3 URI 26 13.222 -0.653 1.980 277 H5 U 26 H5 URI 26 13.653 -3.261 -1.278 278 H6 U 26 H6 URI 26 14.919 -4.719 0.151 279 H5' A 27 H5' ADE 27 13.853 -6.686 5.921 280 H5'' A 27 H5'' ADE 27 12.528 -7.636 6.620 281 H4' A 27 H4' ADE 27 12.567 -5.523 7.690 282 H3' A 27 H3' ADE 27 10.232 -5.764 5.798 283 H2' A 27 H2'' ADE 27 9.537 -3.593 6.584 284 HO2' A 27 H2' ADE 27 11.647 -3.868 8.496 285 H1' A 27 H1' ADE 27 12.117 -2.478 6.469 286 H8 A 27 H8 ADE 27 11.812 -4.650 3.475 287 H61 A 27 H61 ADE 27 8.919 0.052 0.671 288 H62 A 27 H62 ADE 27 9.705 -1.494 0.439 289 H2 A 27 H2 ADE 27 9.156 0.979 5.053 290 H5' G 28 H5' GUA 28 8.852 -4.391 9.159 291 H5'' G 28 H5'' GUA 28 7.399 -5.189 9.787 292 H4' G 28 H4' GUA 28 6.982 -2.853 9.686 293 H3' G 28 H3' GUA 28 5.507 -4.367 7.541 294 H2' G 28 H2'' GUA 28 4.541 -2.292 6.854 295 HO2' G 28 H2' GUA 28 3.945 -1.350 8.758 296 H1' G 28 H1' GUA 28 6.910 -0.745 7.333 297 H8 G 28 H8 GUA 28 7.791 -3.796 5.387 298 H1 G 28 H1 GUA 28 5.285 0.871 1.754 299 H21 G 28 H21 GUA 28 4.401 2.424 3.028 300 H22 G 28 H22 GUA 28 4.418 2.326 4.774 301 H5' U 29 H5' URI 29 0.518 -3.543 8.265 302 H5'' U 29 H5'' URI 29 1.631 -3.627 6.881 303 H4' U 29 H4' URI 29 0.605 -1.172 8.289 304 H3' U 29 H3' URI 29 0.075 -2.281 5.542 305 H2' U 29 H2'' URI 29 -0.200 0.016 4.818 306 HO2' U 29 H2' URI 29 -0.787 1.471 6.247 307 H1' U 29 H1' URI 29 2.180 0.848 5.953 308 H3 U 29 H3 URI 29 2.938 0.205 1.487 309 H5 U 29 H5 URI 29 3.710 -3.514 3.282 310 H6 U 29 H6 URI 29 2.715 -2.577 5.390 311 H5' U 30 H5' URI 30 -2.615 0.517 6.037 312 H5'' U 30 H5'' URI 30 -4.262 0.017 5.605 313 H4' U 30 H4' URI 30 -3.794 1.996 4.409 314 H3' U 30 H3' URI 30 -3.675 -0.422 2.604 315 H2' U 30 H2'' URI 30 -3.339 1.149 0.789 316 HO2' U 30 H2' URI 30 -3.728 3.281 1.005 317 H1' U 30 H1' URI 30 -1.390 2.616 2.152 318 H3 U 30 H3 URI 30 0.777 0.135 -1.028 319 H5 U 30 H5 URI 30 0.416 -2.371 2.321 320 H6 U 30 H6 URI 30 -1.063 -0.737 3.289 321 H5' C 31 H5' CYT 31 -6.029 2.164 0.744 322 H5'' C 31 H5'' CYT 31 -7.533 1.452 0.132 323 H4' C 31 H4' CYT 31 -6.487 2.571 -1.666 324 H3' C 31 H3' CYT 31 -6.176 -0.422 -1.938 325 H2' C 31 H2'' CYT 31 -5.142 0.061 -4.080 326 HO2' C 31 H2' CYT 31 -5.921 2.757 -3.549 327 H1' C 31 H1' CYT 31 -3.500 2.078 -3.052 328 H41 C 31 H41 CYT 31 -0.025 -3.238 -2.663 329 H42 C 31 H42 CYT 31 -0.689 -3.557 -1.077 330 H5 C 31 H5 CYT 31 -2.476 -2.240 -0.108 331 H6 C 31 H6 CYT 31 -3.992 -0.364 -0.476 332 H5' U 32 H5' URI 32 -7.504 0.768 -5.463 333 H5'' U 32 H5'' URI 32 -8.874 -0.177 -6.073 334 H4' U 32 H4' URI 32 -7.224 -0.117 -7.767 335 H3' U 32 H3' URI 32 -7.320 -2.829 -6.447 336 H2' U 32 H2'' URI 32 -5.678 -3.530 -8.067 337 HO2' U 32 H2' URI 32 -5.115 -2.199 -9.813 338 H1' U 32 H1' URI 32 -4.112 -1.196 -7.798 339 H3 U 32 H3 URI 32 -1.745 -4.634 -5.952 340 H5 U 32 H5 URI 32 -4.387 -3.361 -2.947 341 H6 U 32 H6 URI 32 -5.500 -2.020 -4.606 342 H5' A 33 H5' ADE 33 -7.502 -3.394 -10.375 343 H5'' A 33 H5'' ADE 33 -8.732 -4.564 -10.884 344 H4' A 33 H4' ADE 33 -6.700 -5.183 -11.900 345 H3' A 33 H3' ADE 33 -7.362 -7.055 -9.627 346 H2' A 33 H2'' ADE 33 -5.402 -8.308 -10.291 347 HO2' A 33 H2' ADE 33 -4.218 -7.611 -12.183 348 H1' A 33 H1' ADE 33 -3.783 -6.033 -10.566 349 H8 A 33 H8 ADE 33 -5.963 -5.404 -7.606 350 H61 A 33 H61 ADE 33 -1.977 -8.785 -4.279 351 H62 A 33 H62 ADE 33 -3.345 -7.696 -4.205 352 H2 A 33 H2 ADE 33 -0.977 -9.319 -8.613 353 H5' A 34 H5' ADE 34 -6.539 -9.298 -12.793 354 H5'' A 34 H5'' ADE 34 -7.691 -10.611 -13.090 355 H4' A 34 H4' ADE 34 -5.515 -11.533 -13.091 356 H3' A 34 H3' ADE 34 -6.985 -12.274 -10.559 357 H2' A 34 H2'' ADE 34 -5.040 -13.624 -10.027 358 HO2' A 34 H2' ADE 34 -4.164 -12.927 -12.655 359 H1' A 34 H1' ADE 34 -3.212 -11.610 -10.688 360 H8 A 34 H8 ADE 34 -6.182 -9.961 -9.108 361 H61 A 34 H61 ADE 34 -3.673 -11.272 -3.608 362 H62 A 34 H62 ADE 34 -4.907 -10.357 -4.443 363 H2 A 34 H2 ADE 34 -1.384 -13.515 -6.749 364 H5' C 35 H5' CYT 35 -5.507 -15.596 -12.081 365 H5'' C 35 H5'' CYT 35 -6.615 -16.979 -12.116 366 H4' C 35 H4' CYT 35 -4.591 -17.648 -11.062 367 H3' C 35 H3' CYT 35 -6.822 -17.373 -9.039 368 H2' C 35 H2'' CYT 35 -5.214 -18.234 -7.435 369 HO2' C 35 H2' CYT 35 -4.232 -19.585 -9.349 370 H1' C 35 H1' CYT 35 -3.133 -16.569 -8.331 371 H41 C 35 H41 CYT 35 -5.776 -13.471 -3.449 372 H42 C 35 H42 CYT 35 -6.932 -12.734 -4.534 373 H5 C 35 H5 CYT 35 -7.139 -13.367 -6.864 374 H6 C 35 H6 CYT 35 -6.257 -14.810 -8.624 375 H5' C 36 H5' CYT 36 -5.194 -20.930 -8.358 376 H5'' C 36 H5'' CYT 36 -6.358 -22.261 -8.232 377 H4' C 36 H4' CYT 36 -4.958 -22.321 -6.316 378 H3' C 36 H3' CYT 36 -7.715 -21.308 -5.635 379 HO3' C 36 H3T CYT 36 -8.056 -23.302 -5.754 380 H2' C 36 H2'' CYT 36 -6.997 -21.183 -3.362 381 HO2' C 36 H2' CYT 36 -6.000 -23.195 -3.178 382 H1' C 36 H1' CYT 36 -4.296 -20.390 -4.001 383 H41 C 36 H41 CYT 36 -7.316 -15.317 -1.612 384 H42 C 36 H42 CYT 36 -8.018 -14.992 -3.182 385 H5 C 36 H5 CYT 36 -7.740 -16.467 -5.078 386 H6 C 36 H6 CYT 36 -6.754 -18.558 -5.844 Start of MODEL 9 1 H5' G 1 H5' GUA 1 -7.267 -25.458 28.573 2 H5'' G 1 H5'' GUA 1 -7.715 -27.053 27.950 3 H4' G 1 H4' GUA 1 -6.469 -24.842 26.327 4 H3' G 1 H3' GUA 1 -9.369 -25.601 26.615 5 H2' G 1 H2'' GUA 1 -9.637 -25.027 24.296 6 HO2' G 1 H2' GUA 1 -6.951 -24.053 24.453 7 H1' G 1 H1' GUA 1 -7.275 -26.326 23.470 8 H8 G 1 H8 GUA 1 -8.801 -28.490 26.064 9 H1 G 1 H1 GUA 1 -11.731 -28.941 20.368 10 H21 G 1 H21 GUA 1 -11.054 -27.329 19.042 11 H22 G 1 H22 GUA 1 -9.880 -26.132 19.544 12 HO5' G 1 H5T GUA 1 -5.542 -26.724 28.985 13 H5' G 2 H5' GUA 2 -11.282 -20.845 26.134 14 H5'' G 2 H5'' GUA 2 -11.813 -21.420 24.543 15 H4' G 2 H4' GUA 2 -9.030 -20.719 25.444 16 H3' G 2 H3' GUA 2 -10.867 -19.530 23.377 17 H2' G 2 H2'' GUA 2 -8.965 -19.043 22.050 18 HO2' G 2 H2' GUA 2 -7.000 -18.650 22.914 19 H1' G 2 H1' GUA 2 -7.414 -21.325 22.985 20 H8 G 2 H8 GUA 2 -10.643 -22.436 21.540 21 H1 G 2 H1 GUA 2 -6.191 -21.121 17.100 22 H21 G 2 H21 GUA 2 -4.506 -20.053 18.021 23 H22 G 2 H22 GUA 2 -4.466 -19.660 19.725 24 H5' A 3 H5' ADE 3 -9.951 -14.616 22.742 25 H5'' A 3 H5'' ADE 3 -10.523 -15.969 21.748 26 H4' A 3 H4' ADE 3 -7.701 -14.935 21.964 27 H3' A 3 H3' ADE 3 -9.751 -14.687 19.777 28 H2' A 3 H2'' ADE 3 -7.986 -14.856 18.188 29 HO2' A 3 H2' ADE 3 -6.139 -13.927 18.645 30 H1' A 3 H1' ADE 3 -6.450 -16.753 19.697 31 H8 A 3 H8 ADE 3 -9.954 -17.951 19.554 32 H61 A 3 H61 ADE 3 -8.664 -20.327 13.984 33 H62 A 3 H62 ADE 3 -9.823 -20.285 15.293 34 H2 A 3 H2 ADE 3 -5.285 -17.622 15.160 35 H5' G 4 H5' GUA 4 -9.002 -10.716 16.864 36 H5'' G 4 H5'' GUA 4 -9.768 -12.314 16.763 37 H4' G 4 H4' GUA 4 -6.948 -11.584 16.010 38 H3' G 4 H3' GUA 4 -9.345 -12.257 14.322 39 H2' G 4 H2'' GUA 4 -7.840 -13.280 12.757 40 HO2' G 4 H2' GUA 4 -5.805 -12.077 14.361 41 H1' G 4 H1' GUA 4 -6.336 -14.617 14.708 42 H8 G 4 H8 GUA 4 -9.754 -14.854 15.995 43 H1 G 4 H1 GUA 4 -8.696 -18.808 11.050 44 H21 G 4 H21 GUA 4 -6.830 -18.260 10.033 45 H22 G 4 H22 GUA 4 -5.834 -16.920 10.556 46 H5' U 5 H5' URI 5 -6.645 -10.875 11.777 47 H5'' U 5 H5'' URI 5 -7.284 -9.685 10.628 48 H4' U 5 H4' URI 5 -6.136 -11.685 9.643 49 H3' U 5 H3' URI 5 -8.065 -10.284 8.437 50 H2' U 5 H2'' URI 5 -9.945 -11.518 9.352 51 HO2' U 5 H2' URI 5 -9.181 -12.998 7.028 52 H1' U 5 H1' URI 5 -8.380 -14.086 8.741 53 H3 U 5 H3 URI 5 -11.933 -16.470 10.029 54 H5 U 5 H5 URI 5 -11.285 -13.874 13.263 55 H6 U 5 H6 URI 5 -9.578 -12.791 11.962 56 H5' G 6 H5' GUA 6 -4.908 -12.952 8.567 57 H5'' G 6 H5'' GUA 6 -3.404 -12.111 8.152 58 H4' G 6 H4' GUA 6 -3.049 -14.476 8.178 59 H3' G 6 H3' GUA 6 -2.858 -13.208 5.463 60 H2' G 6 H2'' GUA 6 -2.231 -15.362 4.599 61 HO2' G 6 H2' GUA 6 -2.115 -16.093 7.357 62 H1' G 6 H1' GUA 6 -4.283 -16.723 5.891 63 H8 G 6 H8 GUA 6 -5.921 -13.534 5.203 64 H1 G 6 H1 GUA 6 -5.191 -17.099 -0.090 65 H21 G 6 H21 GUA 6 -3.775 -18.730 0.285 66 H22 G 6 H22 GUA 6 -2.995 -18.957 1.834 67 H5' G 7 H5' GUA 7 0.296 -15.512 5.777 68 H5'' G 7 H5'' GUA 7 1.837 -14.711 5.414 69 H4' G 7 H4' GUA 7 1.742 -16.689 4.128 70 H3' G 7 H3' GUA 7 1.290 -14.239 2.426 71 H2' G 7 H2'' GUA 7 1.275 -15.739 0.525 72 HO2' G 7 H2' GUA 7 1.785 -17.924 0.760 73 H1' G 7 H1' GUA 7 -0.460 -17.560 1.717 74 H8 G 7 H8 GUA 7 -1.682 -14.315 2.961 75 H1 G 7 H1 GUA 7 -3.265 -15.357 -3.177 76 H21 G 7 H21 GUA 7 -2.117 -17.049 -3.974 77 H22 G 7 H22 GUA 7 -0.953 -17.931 -3.009 78 H5' U 8 H5' URI 8 4.048 -16.343 0.537 79 H5'' U 8 H5'' URI 8 5.486 -15.421 0.061 80 H4' U 8 H4' URI 8 4.681 -16.558 -1.855 81 H3' U 8 H3' URI 8 4.078 -13.602 -2.003 82 H2' U 8 H2'' URI 8 3.213 -14.046 -4.220 83 HO2' U 8 H2' URI 8 3.552 -15.962 -5.254 84 H1' U 8 H1' URI 8 1.730 -16.270 -3.418 85 H3 U 8 H3 URI 8 -1.213 -12.868 -4.174 86 H5 U 8 H5 URI 8 0.082 -12.372 -0.214 87 H6 U 8 H6 URI 8 1.774 -14.029 -0.643 88 H5' U 9 H5' URI 9 5.755 -14.546 -5.466 89 H5'' U 9 H5'' URI 9 7.049 -13.452 -5.991 90 H4' U 9 H4' URI 9 5.491 -13.651 -7.762 91 H3' U 9 H3' URI 9 5.280 -10.961 -6.420 92 H2' U 9 H2'' URI 9 3.627 -10.390 -8.069 93 HO2' U 9 H2' URI 9 3.673 -11.304 -9.987 94 H1' U 9 H1' URI 9 2.271 -12.853 -7.889 95 H3 U 9 H3 URI 9 -0.408 -9.681 -6.018 96 H5 U 9 H5 URI 9 2.246 -10.830 -2.977 97 H6 U 9 H6 URI 9 3.509 -12.025 -4.643 98 H5' A 10 H5' ADE 10 5.476 -10.327 -10.324 99 H5'' A 10 H5'' ADE 10 6.606 -9.053 -10.821 100 H4' A 10 H4' ADE 10 4.508 -8.580 -11.797 101 H3' A 10 H3' ADE 10 5.111 -6.707 -9.521 102 H2' A 10 H2'' ADE 10 3.051 -5.588 -10.016 103 HO2' A 10 H2' ADE 10 2.340 -5.538 -12.014 104 H1' A 10 H1' ADE 10 1.579 -7.964 -10.460 105 H8 A 10 H8 ADE 10 3.745 -8.534 -7.489 106 H61 A 10 H61 ADE 10 -0.594 -5.665 -4.123 107 H62 A 10 H62 ADE 10 0.852 -6.647 -4.060 108 H2 A 10 H2 ADE 10 -1.529 -5.007 -8.456 109 H5' G 11 H5' GUA 11 3.930 -4.460 -12.542 110 H5'' G 11 H5'' GUA 11 4.985 -3.081 -12.903 111 H4' G 11 H4' GUA 11 2.785 -2.252 -12.649 112 H3' G 11 H3' GUA 11 4.519 -1.582 -10.284 113 H2' G 11 H2'' GUA 11 2.658 -0.420 -9.344 114 HO2' G 11 H2' GUA 11 2.148 0.547 -11.489 115 H1' G 11 H1' GUA 11 0.684 -2.275 -10.304 116 H8 G 11 H8 GUA 11 3.447 -4.153 -8.672 117 H1 G 11 H1 GUA 11 -0.713 -1.609 -4.491 118 H21 G 11 H21 GUA 11 -2.023 -0.171 -5.520 119 H22 G 11 H22 GUA 11 -1.884 0.165 -7.230 120 H5' U 12 H5' URI 12 5.441 3.272 -9.796 121 H5'' U 12 H5'' URI 12 5.318 1.838 -8.762 122 H4' U 12 H4' URI 12 3.253 3.964 -9.244 123 H3' U 12 H3' URI 12 4.888 3.212 -6.837 124 H2' U 12 H2'' URI 12 3.034 3.890 -5.467 125 HO2' U 12 H2' URI 12 1.364 5.090 -6.252 126 H1' U 12 H1' URI 12 1.101 2.580 -7.013 127 H3 U 12 H3 URI 12 1.742 0.206 -3.132 128 H5 U 12 H5 URI 12 4.456 -1.334 -5.941 129 H6 U 12 H6 URI 12 3.915 0.521 -7.371 130 H5' C 13 H5' CYT 13 3.389 6.807 -5.670 131 H5'' C 13 H5'' CYT 13 4.707 7.932 -5.286 132 H4' C 13 H4' CYT 13 3.246 7.971 -3.452 133 H3' C 13 H3' CYT 13 5.725 6.376 -2.842 134 H2' C 13 H2'' CYT 13 4.879 6.131 -0.591 135 HO2' C 13 H2' CYT 13 3.439 7.490 0.205 136 H1' C 13 H1' CYT 13 2.354 5.336 -1.398 137 H41 C 13 H41 CYT 13 5.849 0.002 -1.280 138 H42 C 13 H42 CYT 13 6.129 0.195 -2.990 139 H5 C 13 H5 CYT 13 5.395 2.116 -4.230 140 H6 C 13 H6 CYT 13 4.326 4.294 -4.080 141 H5' U 14 H5' URI 14 5.367 8.785 0.290 142 H5'' U 14 H5'' URI 14 6.834 9.709 0.662 143 H4' U 14 H4' URI 14 6.133 8.643 2.650 144 H3' U 14 H3' URI 14 8.577 7.310 1.498 145 H2' U 14 H2'' URI 14 8.585 5.894 3.453 146 HO2' U 14 H2' URI 14 7.122 6.244 5.150 147 H1' U 14 H1' URI 14 5.883 5.277 3.258 148 H3 U 14 H3 URI 14 8.285 1.708 1.702 149 H5 U 14 H5 URI 14 7.706 4.243 -1.593 150 H6 U 14 H6 URI 14 6.909 5.915 -0.067 151 H5' A 15 H5' ADE 15 9.289 7.900 5.331 152 H5'' A 15 H5'' ADE 15 10.856 8.641 5.699 153 H4' A 15 H4' ADE 15 10.644 6.703 7.030 154 H3' A 15 H3' ADE 15 12.610 6.296 4.784 155 H2' A 15 H2'' ADE 15 13.051 4.117 5.734 156 HO2' A 15 H2' ADE 15 11.364 5.015 7.856 157 H1' A 15 H1' ADE 15 10.374 3.451 5.970 158 H8 A 15 H8 ADE 15 10.433 5.556 2.939 159 H61 A 15 H61 ADE 15 12.407 0.607 -0.214 160 H62 A 15 H62 ADE 15 11.753 2.224 -0.345 161 H2 A 15 H2 ADE 15 12.751 -0.304 4.162 162 H5' C 16 H5' CYT 16 14.459 5.010 8.046 163 H5'' C 16 H5'' CYT 16 16.101 5.646 8.263 164 H4' C 16 H4' CYT 16 16.219 3.288 8.403 165 H3' C 16 H3' CYT 16 17.334 4.285 5.785 166 H2' C 16 H2'' CYT 16 17.939 1.983 5.330 167 HO2' C 16 H2' CYT 16 17.809 0.408 6.873 168 H1' C 16 H1' CYT 16 15.428 0.992 5.993 169 H41 C 16 H41 CYT 16 15.026 2.531 -0.180 170 H42 C 16 H42 CYT 16 14.499 4.133 0.267 171 H5 C 16 H5 CYT 16 14.494 4.922 2.538 172 H6 C 16 H6 CYT 16 14.950 4.329 4.851 173 H5' G 17 H5' GUA 17 20.114 1.757 7.112 174 H5'' G 17 H5'' GUA 17 21.737 2.474 7.130 175 H4' G 17 H4' GUA 17 21.894 0.421 5.975 176 H3' G 17 H3' GUA 17 21.979 2.752 4.057 177 H2' G 17 H2'' GUA 17 22.380 1.111 2.324 178 HO2' G 17 H2' GUA 17 22.992 -0.933 2.767 179 H1' G 17 H1' GUA 17 20.374 -0.631 3.216 180 H8 G 17 H8 GUA 17 19.063 2.812 3.705 181 H1 G 17 H1 GUA 17 18.782 0.872 -2.404 182 H21 G 17 H21 GUA 17 19.977 -0.954 -2.673 183 H22 G 17 H22 GUA 17 20.845 -1.708 -1.354 184 H5' U 18 H5' URI 18 25.104 0.533 2.954 185 H5'' U 18 H5'' URI 18 26.598 1.476 2.790 186 H4' U 18 H4' URI 18 26.272 0.294 0.763 187 H3' U 18 H3' URI 18 25.606 3.226 0.423 188 H2' U 18 H2'' URI 18 25.269 2.705 -1.915 189 HO2' U 18 H2' URI 18 27.138 1.083 -1.759 190 H1' U 18 H1' URI 18 23.863 0.312 -1.405 191 H3 U 18 H3 URI 18 20.971 3.327 -3.244 192 H5 U 18 H5 URI 18 21.088 4.257 0.851 193 H6 U 18 H6 URI 18 22.908 2.706 1.072 194 H5' U 19 H5' URI 19 27.886 2.605 -2.697 195 H5'' U 19 H5'' URI 19 29.144 3.842 -2.892 196 H4' U 19 H4' URI 19 27.876 3.787 -4.893 197 H3' U 19 H3' URI 19 27.202 6.218 -3.238 198 H2' U 19 H2'' URI 19 25.765 6.896 -5.052 199 HO2' U 19 H2' URI 19 25.723 5.545 -6.994 200 H1' U 19 H1' URI 19 24.665 4.324 -5.425 201 H3 U 19 H3 URI 19 21.408 6.980 -3.669 202 H5 U 19 H5 URI 19 23.687 5.710 -0.379 203 H6 U 19 H6 URI 19 25.292 4.819 -1.936 204 H5' U 20 H5' URI 20 28.526 10.364 -5.191 205 H5'' U 20 H5'' URI 20 26.778 10.062 -5.139 206 H4' U 20 H4' URI 20 27.411 11.441 -7.041 207 H3' U 20 H3' URI 20 25.539 9.556 -7.257 208 H2' U 20 H2'' URI 20 27.089 7.745 -7.828 209 HO2' U 20 H2' URI 20 26.352 8.945 -10.320 210 H1' U 20 H1' URI 20 28.355 9.726 -9.813 211 H3 U 20 H3 URI 20 31.531 6.947 -11.232 212 H5 U 20 H5 URI 20 30.962 5.711 -7.261 213 H6 U 20 H6 URI 20 29.234 7.374 -7.073 214 H5' C 21 H5' CYT 21 22.901 9.994 -9.711 215 H5'' C 21 H5'' CYT 21 22.529 11.721 -9.876 216 H4' C 21 H4' CYT 21 20.571 10.281 -9.365 217 H3' C 21 H3' CYT 21 20.847 12.806 -8.546 218 H2' C 21 H2'' CYT 21 22.035 12.299 -6.488 219 HO2' C 21 H2' CYT 21 19.243 12.233 -5.864 220 H1' C 21 H1' CYT 21 19.950 10.093 -6.018 221 H41 C 21 H41 CYT 21 23.735 8.634 -1.162 222 H42 C 21 H42 CYT 21 25.158 8.719 -2.174 223 H5 C 21 H5 CYT 21 25.078 9.387 -4.501 224 H6 C 21 H6 CYT 21 23.622 10.094 -6.322 225 H5' G 22 H5' GUA 22 16.754 10.347 -10.517 226 H5'' G 22 H5'' GUA 22 18.089 9.776 -9.496 227 H4' G 22 H4' GUA 22 17.823 9.677 -12.485 228 H3' G 22 H3' GUA 22 18.033 7.604 -10.342 229 H2' G 22 H2'' GUA 22 19.602 6.358 -11.584 230 HO2' G 22 H2' GUA 22 18.508 7.640 -13.886 231 H1' G 22 H1' GUA 22 20.530 8.577 -13.265 232 H8 G 22 H8 GUA 22 23.010 8.296 -13.118 233 H1 G 22 H1 GUA 22 22.703 6.508 -6.963 234 H21 G 22 H21 GUA 22 20.618 6.525 -6.275 235 H22 G 22 H22 GUA 22 19.290 6.971 -7.322 236 H5' A 23 H5' ADE 23 17.546 5.111 -12.915 237 H5'' A 23 H5'' ADE 23 16.215 3.960 -12.711 238 H4' A 23 H4' ADE 23 18.374 2.836 -12.753 239 H3' A 23 H3' ADE 23 16.921 2.676 -10.114 240 H2' A 23 H2'' ADE 23 18.726 1.224 -9.375 241 HO2' A 23 H2' ADE 23 19.770 0.111 -10.851 242 H1' A 23 H1' ADE 23 20.705 2.975 -10.214 243 H8 A 23 H8 ADE 23 17.660 4.954 -9.193 244 H61 A 23 H61 ADE 23 19.557 4.463 -3.321 245 H62 A 23 H62 ADE 23 18.416 5.236 -4.399 246 H2 A 23 H2 ADE 23 22.151 1.824 -5.849 247 H5' C 24 H5' CYT 24 18.038 -1.000 -11.054 248 H5'' C 24 H5'' CYT 24 16.786 -2.244 -10.883 249 H4' C 24 H4' CYT 24 18.704 -2.971 -9.707 250 H3' C 24 H3' CYT 24 16.540 -2.090 -7.802 251 H2' C 24 H2'' CYT 24 18.012 -2.841 -6.024 252 HO2' C 24 H2' CYT 24 19.566 -4.250 -6.405 253 H1' C 24 H1' CYT 24 20.220 -1.488 -7.024 254 H41 C 24 H41 CYT 24 17.147 2.695 -3.298 255 H42 C 24 H42 CYT 24 16.194 3.202 -4.669 256 H5 C 24 H5 CYT 24 16.326 2.136 -6.823 257 H6 C 24 H6 CYT 24 17.338 0.321 -8.085 258 H5' G 25 H5' GUA 25 17.777 -5.651 -6.567 259 H5'' G 25 H5'' GUA 25 16.475 -6.803 -6.233 260 H4' G 25 H4' GUA 25 17.910 -6.788 -4.365 261 H3' G 25 H3' GUA 25 15.336 -5.339 -3.753 262 H2' G 25 H2'' GUA 25 16.176 -5.129 -1.487 263 HO2' G 25 H2' GUA 25 18.319 -6.775 -2.410 264 H1' G 25 H1' GUA 25 18.672 -4.214 -2.282 265 H8 G 25 H8 GUA 25 16.302 -2.867 -4.800 266 H1 G 25 H1 GUA 25 16.078 0.328 0.756 267 H21 G 25 H21 GUA 25 17.141 -0.790 2.318 268 H22 G 25 H22 GUA 25 17.922 -2.325 2.008 269 H5' U 26 H5' URI 26 15.918 -7.887 -0.792 270 H5'' U 26 H5'' URI 26 14.504 -8.858 -0.347 271 H4' U 26 H4' URI 26 15.359 -7.853 1.617 272 H3' U 26 H3' URI 26 12.777 -6.541 0.766 273 H2' U 26 H2'' URI 26 12.937 -5.229 2.789 274 HO2' U 26 H2' URI 26 14.041 -5.961 4.453 275 H1' U 26 H1' URI 26 15.609 -4.559 2.378 276 H3 U 26 H3 URI 26 13.053 -0.912 1.374 277 H5 U 26 H5 URI 26 13.221 -3.192 -2.145 278 H6 U 26 H6 URI 26 14.193 -4.970 -0.855 279 H5' A 27 H5' ADE 27 12.531 -7.360 4.591 280 H5'' A 27 H5'' ADE 27 11.016 -8.109 5.124 281 H4' A 27 H4' ADE 27 11.444 -6.237 6.504 282 H3' A 27 H3' ADE 27 9.169 -5.707 4.603 283 H2' A 27 H2'' ADE 27 8.896 -3.579 5.703 284 HO2' A 27 H2' ADE 27 9.835 -3.123 7.617 285 H1' A 27 H1' ADE 27 11.598 -2.943 5.597 286 H8 A 27 H8 ADE 27 11.058 -4.854 2.490 287 H61 A 27 H61 ADE 27 8.759 0.308 -0.035 288 H62 A 27 H62 ADE 27 9.364 -1.303 -0.357 289 H2 A 27 H2 ADE 27 9.054 0.938 4.396 290 H5' G 28 H5' GUA 28 8.074 -4.621 8.193 291 H5'' G 28 H5'' GUA 28 6.464 -5.146 8.712 292 H4' G 28 H4' GUA 28 6.627 -2.806 9.039 293 H3' G 28 H3' GUA 28 4.825 -3.488 6.723 294 H2' G 28 H2'' GUA 28 4.367 -1.123 6.547 295 HO2' G 28 H2' GUA 28 4.657 0.188 8.207 296 H1' G 28 H1' GUA 28 7.041 -0.375 6.699 297 H8 G 28 H8 GUA 28 7.157 -3.568 4.862 298 H1 G 28 H1 GUA 28 5.130 1.315 1.220 299 H21 G 28 H21 GUA 28 4.623 3.039 2.484 300 H22 G 28 H22 GUA 28 4.776 3.002 4.227 301 H5' U 29 H5' URI 29 2.894 -0.875 8.940 302 H5'' U 29 H5'' URI 29 1.239 -1.331 9.385 303 H4' U 29 H4' URI 29 1.171 0.849 8.443 304 H3' U 29 H3' URI 29 0.062 -1.233 6.573 305 H2' U 29 H2'' URI 29 -0.472 0.552 5.060 306 HO2' U 29 H2' URI 29 -1.053 2.407 5.903 307 H1' U 29 H1' URI 29 1.956 1.970 5.502 308 H3 U 29 H3 URI 29 2.023 0.552 1.167 309 H5 U 29 H5 URI 29 3.233 -2.800 3.386 310 H6 U 29 H6 URI 29 2.570 -1.532 5.451 311 H5' U 30 H5' URI 30 -4.696 -0.762 5.553 312 H5'' U 30 H5'' URI 30 -3.198 -1.268 4.748 313 H4' U 30 H4' URI 30 -4.611 1.382 4.532 314 H3' U 30 H3' URI 30 -4.196 -0.854 2.555 315 H2' U 30 H2'' URI 30 -4.217 0.867 0.841 316 HO2' U 30 H2' URI 30 -4.742 2.703 2.967 317 H1' U 30 H1' URI 30 -2.396 2.482 2.177 318 H3 U 30 H3 URI 30 -0.159 0.326 -1.200 319 H5 U 30 H5 URI 30 -0.010 -2.255 2.107 320 H6 U 30 H6 URI 30 -1.580 -0.805 3.216 321 H5' C 31 H5' CYT 31 -6.996 1.405 0.889 322 H5'' C 31 H5'' CYT 31 -8.399 0.480 0.326 323 H4' C 31 H4' CYT 31 -7.637 1.789 -1.486 324 H3' C 31 H3' CYT 31 -6.883 -1.111 -1.849 325 H2' C 31 H2'' CYT 31 -6.034 -0.446 -4.028 326 HO2' C 31 H2' CYT 31 -7.826 1.259 -4.161 327 H1' C 31 H1' CYT 31 -4.632 1.742 -3.026 328 H41 C 31 H41 CYT 31 -0.533 -3.128 -2.741 329 H42 C 31 H42 CYT 31 -1.117 -3.528 -1.143 330 H5 C 31 H5 CYT 31 -3.006 -2.412 -0.119 331 H6 C 31 H6 CYT 31 -4.741 -0.728 -0.441 332 H5' U 32 H5' URI 32 -8.566 -0.116 -5.317 333 H5'' U 32 H5'' URI 32 -9.820 -1.255 -5.840 334 H4' U 32 H4' URI 32 -8.314 -0.975 -7.637 335 H3' U 32 H3' URI 32 -7.919 -3.652 -6.303 336 H2' U 32 H2'' URI 32 -6.298 -4.123 -8.029 337 HO2' U 32 H2' URI 32 -5.957 -2.488 -9.698 338 H1' U 32 H1' URI 32 -5.048 -1.613 -7.825 339 H3 U 32 H3 URI 32 -2.197 -4.681 -6.017 340 H5 U 32 H5 URI 32 -4.878 -3.705 -2.937 341 H6 U 32 H6 URI 32 -6.211 -2.549 -4.573 342 H5' A 33 H5' ADE 33 -8.278 -4.327 -10.218 343 H5'' A 33 H5'' ADE 33 -9.363 -5.667 -10.619 344 H4' A 33 H4' ADE 33 -7.346 -6.026 -11.772 345 H3' A 33 H3' ADE 33 -7.584 -7.911 -9.430 346 H2' A 33 H2'' ADE 33 -5.516 -8.899 -10.195 347 HO2' A 33 H2' ADE 33 -5.763 -7.153 -12.446 348 H1' A 33 H1' ADE 33 -4.234 -6.443 -10.582 349 H8 A 33 H8 ADE 33 -6.373 -5.998 -7.562 350 H61 A 33 H61 ADE 33 -1.866 -8.742 -4.299 351 H62 A 33 H62 ADE 33 -3.358 -7.833 -4.194 352 H2 A 33 H2 ADE 33 -0.969 -9.287 -8.650 353 H5' A 34 H5' ADE 34 -6.681 -10.104 -12.621 354 H5'' A 34 H5'' ADE 34 -7.649 -11.576 -12.808 355 H4' A 34 H4' ADE 34 -5.364 -12.173 -12.949 356 H3' A 34 H3' ADE 34 -6.549 -13.063 -10.319 357 H2' A 34 H2'' ADE 34 -4.403 -14.100 -9.883 358 HO2' A 34 H2' ADE 34 -3.063 -14.605 -11.465 359 H1' A 34 H1' ADE 34 -2.932 -11.864 -10.662 360 H8 A 34 H8 ADE 34 -6.028 -10.607 -8.976 361 H61 A 34 H61 ADE 34 -3.126 -11.520 -3.582 362 H62 A 34 H62 ADE 34 -4.509 -10.782 -4.356 363 H2 A 34 H2 ADE 34 -0.714 -13.474 -6.813 364 H5' C 35 H5' CYT 35 -4.664 -16.181 -11.822 365 H5'' C 35 H5'' CYT 35 -5.572 -17.702 -11.783 366 H4' C 35 H4' CYT 35 -3.448 -18.074 -10.791 367 H3' C 35 H3' CYT 35 -5.633 -18.028 -8.705 368 H2' C 35 H2'' CYT 35 -3.897 -18.611 -7.115 369 HO2' C 35 H2' CYT 35 -1.883 -19.260 -7.754 370 H1' C 35 H1' CYT 35 -2.095 -16.695 -8.072 371 H41 C 35 H41 CYT 35 -5.284 -13.826 -3.375 372 H42 C 35 H42 CYT 35 -6.516 -13.325 -4.511 373 H5 C 35 H5 CYT 35 -6.566 -14.079 -6.814 374 H6 C 35 H6 CYT 35 -5.429 -15.442 -8.487 375 H5' C 36 H5' CYT 36 -3.534 -21.310 -7.983 376 H5'' C 36 H5'' CYT 36 -4.509 -22.781 -7.803 377 H4' C 36 H4' CYT 36 -3.076 -22.623 -5.924 378 H3' C 36 H3' CYT 36 -5.923 -21.950 -5.194 379 HO3' C 36 H3T CYT 36 -5.469 -24.021 -5.868 380 H2' C 36 H2'' CYT 36 -5.172 -21.727 -2.929 381 HO2' C 36 H2' CYT 36 -3.807 -23.622 -2.991 382 H1' C 36 H1' CYT 36 -2.712 -20.449 -3.617 383 H41 C 36 H41 CYT 36 -6.678 -15.856 -1.688 384 H42 C 36 H42 CYT 36 -7.345 -15.761 -3.300 385 H5 C 36 H5 CYT 36 -6.745 -17.299 -5.060 386 H6 C 36 H6 CYT 36 -5.398 -19.242 -5.633 Start of MODEL 10 1 H5' G 1 H5' GUA 1 -33.861 -1.877 -1.276 2 H5'' G 1 H5'' GUA 1 -34.911 -2.926 -2.241 3 H4' G 1 H4' GUA 1 -32.922 -3.592 -3.569 4 H3' G 1 H3' GUA 1 -31.501 -1.506 -1.922 5 H2' G 1 H2'' GUA 1 -30.311 -0.881 -3.893 6 HO2' G 1 H2' GUA 1 -31.332 -3.255 -5.112 7 H1' G 1 H1' GUA 1 -32.512 -1.347 -5.685 8 H8 G 1 H8 GUA 1 -33.728 0.774 -2.925 9 H1 G 1 H1 GUA 1 -30.287 4.010 -7.274 10 H21 G 1 H21 GUA 1 -29.223 2.604 -8.589 11 H22 G 1 H22 GUA 1 -29.352 0.869 -8.405 12 HO5' G 1 H5T GUA 1 -34.074 -3.891 -0.286 13 H5' G 2 H5' GUA 2 -28.542 -3.170 -4.008 14 H5'' G 2 H5'' GUA 2 -27.355 -3.943 -2.943 15 H4' G 2 H4' GUA 2 -26.187 -2.631 -4.540 16 H3' G 2 H3' GUA 2 -25.589 -2.357 -1.914 17 H2' G 2 H2'' GUA 2 -26.967 -0.388 -1.539 18 HO2' G 2 H2' GUA 2 -25.342 0.844 -0.953 19 H1' G 2 H1' GUA 2 -25.925 0.607 -4.260 20 H8 G 2 H8 GUA 2 -29.288 0.360 -2.340 21 H1 G 2 H1 GUA 2 -27.860 6.101 -4.844 22 H21 G 2 H21 GUA 2 -25.895 6.035 -5.814 23 H22 G 2 H22 GUA 2 -24.917 4.586 -5.856 24 H5' A 3 H5' ADE 3 -22.128 -1.710 -1.151 25 H5'' A 3 H5'' ADE 3 -21.092 -2.858 -2.021 26 H4' A 3 H4' ADE 3 -20.767 -3.074 0.352 27 H3' A 3 H3' ADE 3 -21.010 -5.252 -1.196 28 H2' A 3 H2'' ADE 3 -23.416 -5.505 -0.915 29 HO2' A 3 H2' ADE 3 -22.130 -7.395 -0.057 30 H1' A 3 H1' ADE 3 -22.955 -4.941 2.078 31 H8 A 3 H8 ADE 3 -25.345 -3.921 -0.810 32 H61 A 3 H61 ADE 3 -29.851 -4.865 3.333 33 H62 A 3 H62 ADE 3 -29.489 -4.370 1.695 34 H2 A 3 H2 ADE 3 -25.931 -5.817 5.294 35 H5' G 4 H5' GUA 4 -16.495 -5.615 1.934 36 H5'' G 4 H5'' GUA 4 -16.516 -7.026 0.859 37 H4' G 4 H4' GUA 4 -17.097 -7.070 3.819 38 H3' G 4 H3' GUA 4 -14.546 -7.689 2.349 39 H2' G 4 H2'' GUA 4 -14.146 -9.440 3.929 40 HO2' G 4 H2' GUA 4 -14.716 -8.401 5.839 41 H1' G 4 H1' GUA 4 -16.856 -10.303 4.036 42 H8 G 4 H8 GUA 4 -16.009 -9.712 0.477 43 H1 G 4 H1 GUA 4 -13.739 -15.293 2.704 44 H21 G 4 H21 GUA 4 -13.882 -15.349 4.891 45 H22 G 4 H22 GUA 4 -14.533 -14.019 5.824 46 H5' U 5 H5' URI 5 -10.572 -7.152 5.381 47 H5'' U 5 H5'' URI 5 -11.062 -8.224 4.056 48 H4' U 5 H4' URI 5 -11.191 -8.770 7.013 49 H3' U 5 H3' URI 5 -9.441 -9.886 4.822 50 H2' U 5 H2'' URI 5 -9.417 -11.950 6.157 51 HO2' U 5 H2' URI 5 -10.613 -12.024 8.111 52 H1' U 5 H1' URI 5 -12.139 -12.087 6.227 53 H3 U 5 H3 URI 5 -10.777 -14.601 2.631 54 H5 U 5 H5 URI 5 -11.583 -10.751 1.165 55 H6 U 5 H6 URI 5 -11.716 -9.991 3.443 56 H5' G 6 H5' GUA 6 -7.474 -11.386 7.839 57 H5'' G 6 H5'' GUA 6 -5.785 -10.835 7.884 58 H4' G 6 H4' GUA 6 -5.762 -13.201 7.940 59 H3' G 6 H3' GUA 6 -4.939 -12.147 5.241 60 H2' G 6 H2'' GUA 6 -4.491 -14.431 4.611 61 HO2' G 6 H2' GUA 6 -5.170 -15.106 7.308 62 H1' G 6 H1' GUA 6 -6.930 -15.373 5.572 63 H8 G 6 H8 GUA 6 -7.542 -11.915 4.324 64 H1 G 6 H1 GUA 6 -7.147 -16.236 -0.390 65 H21 G 6 H21 GUA 6 -6.317 -18.117 0.372 66 H22 G 6 H22 GUA 6 -5.864 -18.334 2.048 67 H5' G 7 H5' GUA 7 -2.242 -14.838 6.182 68 H5'' G 7 H5'' GUA 7 -0.568 -14.284 5.993 69 H4' G 7 H4' GUA 7 -0.769 -16.328 4.837 70 H3' G 7 H3' GUA 7 -0.650 -14.004 2.920 71 H2' G 7 H2'' GUA 7 -0.637 -15.653 1.149 72 HO2' G 7 H2' GUA 7 -0.126 -17.714 1.509 73 H1' G 7 H1' GUA 7 -2.749 -17.116 2.213 74 H8 G 7 H8 GUA 7 -3.632 -13.643 3.058 75 H1 G 7 H1 GUA 7 -4.586 -14.983 -3.150 76 H21 G 7 H21 GUA 7 -3.594 -16.870 -3.677 77 H22 G 7 H22 GUA 7 -2.694 -17.813 -2.510 78 H5' U 8 H5' URI 8 2.010 -16.618 1.585 79 H5'' U 8 H5'' URI 8 3.609 -15.925 1.260 80 H4' U 8 H4' URI 8 2.947 -17.127 -0.660 81 H3' U 8 H3' URI 8 2.735 -14.152 -1.129 82 H2' U 8 H2'' URI 8 2.144 -14.718 -3.413 83 HO2' U 8 H2' URI 8 2.675 -17.416 -2.641 84 H1' U 8 H1' URI 8 0.279 -16.645 -2.667 85 H3 U 8 H3 URI 8 -2.051 -12.958 -4.030 86 H5 U 8 H5 URI 8 -1.229 -12.347 0.037 87 H6 U 8 H6 URI 8 0.276 -14.220 -0.067 88 H5' U 9 H5' URI 9 4.731 -15.587 -4.227 89 H5'' U 9 H5'' URI 9 6.209 -14.696 -4.635 90 H4' U 9 H4' URI 9 4.901 -14.874 -6.596 91 H3' U 9 H3' URI 9 4.823 -12.069 -5.497 92 H2' U 9 H2'' URI 9 3.515 -11.478 -7.433 93 HO2' U 9 H2' URI 9 3.556 -12.658 -9.226 94 H1' U 9 H1' URI 9 1.831 -13.715 -7.244 95 H3 U 9 H3 URI 9 -0.597 -10.073 -5.947 96 H5 U 9 H5 URI 9 1.440 -11.361 -2.511 97 H6 U 9 H6 URI 9 2.741 -12.807 -3.923 98 H5' A 10 H5' ADE 10 5.633 -11.801 -9.355 99 H5'' A 10 H5'' ADE 10 6.962 -10.702 -9.770 100 H4' A 10 H4' ADE 10 5.087 -10.093 -11.071 101 H3' A 10 H3' ADE 10 5.586 -8.102 -8.869 102 H2' A 10 H2'' ADE 10 3.770 -6.809 -9.776 103 HO2' A 10 H2' ADE 10 2.972 -7.155 -11.791 104 H1' A 10 H1' ADE 10 2.077 -9.024 -10.149 105 H8 A 10 H8 ADE 10 3.830 -9.627 -6.935 106 H61 A 10 H61 ADE 10 -0.345 -5.917 -4.264 107 H62 A 10 H62 ADE 10 0.925 -7.086 -3.980 108 H2 A 10 H2 ADE 10 -0.720 -5.463 -8.709 109 H5' G 11 H5' GUA 11 5.082 -6.005 -12.167 110 H5'' G 11 H5'' GUA 11 6.327 -4.777 -12.470 111 H4' G 11 H4' GUA 11 4.220 -3.707 -12.586 112 H3' G 11 H3' GUA 11 5.700 -3.015 -10.058 113 H2' G 11 H2'' GUA 11 3.886 -1.563 -9.487 114 HO2' G 11 H2' GUA 11 2.754 -0.602 -11.009 115 H1' G 11 H1' GUA 11 1.849 -3.323 -10.414 116 H8 G 11 H8 GUA 11 4.300 -5.349 -8.512 117 H1 G 11 H1 GUA 11 0.272 -2.070 -4.739 118 H21 G 11 H21 GUA 11 -0.818 -0.575 -5.922 119 H22 G 11 H22 GUA 11 -0.563 -0.374 -7.642 120 H5' U 12 H5' URI 12 6.976 1.851 -9.903 121 H5'' U 12 H5'' URI 12 6.636 0.554 -8.745 122 H4' U 12 H4' URI 12 4.791 2.721 -9.702 123 H3' U 12 H3' URI 12 6.078 2.158 -7.045 124 H2' U 12 H2'' URI 12 4.127 3.095 -5.992 125 HO2' U 12 H2' URI 12 2.448 4.002 -7.301 126 H1' U 12 H1' URI 12 2.320 1.664 -7.548 127 H3 U 12 H3 URI 12 2.581 -0.302 -3.409 128 H5 U 12 H5 URI 12 5.398 -2.231 -5.852 129 H6 U 12 H6 URI 12 5.053 -0.503 -7.486 130 H5' C 13 H5' CYT 13 4.610 5.816 -6.438 131 H5'' C 13 H5'' CYT 13 5.867 6.966 -5.937 132 H4' C 13 H4' CYT 13 4.138 7.108 -4.344 133 H3' C 13 H3' CYT 13 6.509 5.589 -3.277 134 H2' C 13 H2'' CYT 13 5.344 5.478 -1.163 135 HO2' C 13 H2' CYT 13 3.715 6.796 -0.689 136 H1' C 13 H1' CYT 13 2.966 4.606 -2.281 137 H41 C 13 H41 CYT 13 6.376 -0.667 -1.204 138 H42 C 13 H42 CYT 13 6.924 -0.616 -2.865 139 H5 C 13 H5 CYT 13 6.434 1.224 -4.353 140 H6 C 13 H6 CYT 13 5.348 3.395 -4.544 141 H5' U 14 H5' URI 14 5.719 8.081 -0.311 142 H5'' U 14 H5'' URI 14 7.111 9.065 0.185 143 H4' U 14 H4' URI 14 6.247 8.034 2.125 144 H3' U 14 H3' URI 14 8.820 6.740 1.249 145 H2' U 14 H2'' URI 14 8.686 5.373 3.227 146 HO2' U 14 H2' URI 14 6.775 5.713 4.630 147 H1' U 14 H1' URI 14 6.021 4.685 2.817 148 H3 U 14 H3 URI 14 8.628 1.126 1.590 149 H5 U 14 H5 URI 14 8.240 3.535 -1.826 150 H6 U 14 H6 URI 14 7.303 5.239 -0.422 151 H5' A 15 H5' ADE 15 9.227 7.361 5.132 152 H5'' A 15 H5'' ADE 15 10.723 8.198 5.586 153 H4' A 15 H4' ADE 15 10.570 6.253 6.912 154 H3' A 15 H3' ADE 15 12.649 5.950 4.753 155 H2' A 15 H2'' ADE 15 13.178 3.806 5.743 156 HO2' A 15 H2' ADE 15 11.317 4.584 7.767 157 H1' A 15 H1' ADE 15 10.535 2.986 5.874 158 H8 A 15 H8 ADE 15 10.574 5.051 2.825 159 H61 A 15 H61 ADE 15 12.939 0.192 -0.194 160 H62 A 15 H62 ADE 15 12.190 1.762 -0.366 161 H2 A 15 H2 ADE 15 13.224 -0.631 4.207 162 H5' C 16 H5' CYT 16 14.460 4.737 8.053 163 H5'' C 16 H5'' CYT 16 16.049 5.476 8.331 164 H4' C 16 H4' CYT 16 16.324 3.129 8.442 165 H3' C 16 H3' CYT 16 17.429 4.238 5.866 166 H2' C 16 H2'' CYT 16 18.208 1.988 5.402 167 HO2' C 16 H2' CYT 16 18.206 0.411 6.930 168 H1' C 16 H1' CYT 16 15.755 0.816 5.997 169 H41 C 16 H41 CYT 16 15.391 2.344 -0.176 170 H42 C 16 H42 CYT 16 14.737 3.902 0.261 171 H5 C 16 H5 CYT 16 14.633 4.688 2.533 172 H6 C 16 H6 CYT 16 15.076 4.122 4.856 173 H5' G 17 H5' GUA 17 20.355 1.878 7.157 174 H5'' G 17 H5'' GUA 17 21.916 2.720 7.222 175 H4' G 17 H4' GUA 17 22.246 0.737 5.979 176 H3' G 17 H3' GUA 17 22.142 3.156 4.177 177 H2' G 17 H2'' GUA 17 22.675 1.649 2.368 178 HO2' G 17 H2' GUA 17 23.346 -0.451 2.738 179 H1' G 17 H1' GUA 17 20.875 -0.351 3.210 180 H8 G 17 H8 GUA 17 19.215 2.941 3.717 181 H1 G 17 H1 GUA 17 19.129 1.011 -2.403 182 H21 G 17 H21 GUA 17 20.493 -0.690 -2.680 183 H22 G 17 H22 GUA 17 21.431 -1.363 -1.364 184 H5' U 18 H5' URI 18 25.425 1.304 2.940 185 H5'' U 18 H5'' URI 18 26.835 2.380 2.859 186 H4' U 18 H4' URI 18 26.600 1.349 0.737 187 H3' U 18 H3' URI 18 25.699 4.226 0.666 188 H2' U 18 H2'' URI 18 25.293 3.935 -1.673 189 HO2' U 18 H2' URI 18 26.061 2.018 -2.748 190 H1' U 18 H1' URI 18 24.324 1.241 -1.420 191 H3 U 18 H3 URI 18 20.944 3.752 -3.189 192 H5 U 18 H5 URI 18 20.905 4.583 0.926 193 H6 U 18 H6 URI 18 22.962 3.359 1.114 194 H5' U 19 H5' URI 19 28.206 7.344 -2.037 195 H5'' U 19 H5'' URI 19 26.585 7.155 -1.342 196 H4' U 19 H4' URI 19 27.492 6.331 -4.096 197 H3' U 19 H3' URI 19 25.748 8.613 -3.183 198 H2' U 19 H2'' URI 19 24.470 8.325 -5.180 199 HO2' U 19 H2' URI 19 25.278 7.402 -6.964 200 H1' U 19 H1' URI 19 24.579 5.472 -5.154 201 H3 U 19 H3 URI 19 20.233 6.769 -4.680 202 H5 U 19 H5 URI 19 21.922 7.119 -0.855 203 H6 U 19 H6 URI 19 24.070 6.681 -1.846 204 H5' U 20 H5' URI 20 26.543 12.864 -5.047 205 H5'' U 20 H5'' URI 20 24.839 12.380 -4.983 206 H4' U 20 H4' URI 20 25.292 13.705 -6.950 207 H3' U 20 H3' URI 20 23.723 11.555 -7.127 208 H2' U 20 H2'' URI 20 25.547 9.981 -7.594 209 HO2' U 20 H2' URI 20 24.711 10.947 -10.155 210 H1' U 20 H1' URI 20 26.537 12.069 -9.630 211 H3 U 20 H3 URI 20 30.105 9.746 -10.934 212 H5 U 20 H5 URI 20 29.726 8.629 -6.905 213 H6 U 20 H6 URI 20 27.752 10.001 -6.790 214 H5' C 21 H5' CYT 21 21.328 11.591 -9.835 215 H5'' C 21 H5'' CYT 21 20.474 13.140 -9.963 216 H4' C 21 H4' CYT 21 18.951 11.255 -9.647 217 H3' C 21 H3' CYT 21 18.521 13.620 -8.491 218 H2' C 21 H2'' CYT 21 19.794 13.159 -6.464 219 HO2' C 21 H2' CYT 21 17.547 13.713 -5.955 220 H1' C 21 H1' CYT 21 18.374 10.435 -6.391 221 H41 C 21 H41 CYT 21 22.446 9.356 -1.665 222 H42 C 21 H42 CYT 21 23.769 10.040 -2.581 223 H5 C 21 H5 CYT 21 23.487 11.007 -4.773 224 H6 C 21 H6 CYT 21 21.880 11.551 -6.521 225 H5' G 22 H5' GUA 22 15.255 10.048 -10.710 226 H5'' G 22 H5'' GUA 22 16.559 9.850 -9.523 227 H4' G 22 H4' GUA 22 16.638 9.500 -12.502 228 H3' G 22 H3' GUA 22 17.083 7.664 -10.188 229 H2' G 22 H2'' GUA 22 18.972 6.687 -11.225 230 HO2' G 22 H2' GUA 22 19.141 6.497 -13.405 231 H1' G 22 H1' GUA 22 19.741 8.979 -12.823 232 H8 G 22 H8 GUA 22 22.131 9.251 -12.142 233 H1 G 22 H1 GUA 22 20.812 7.859 -6.024 234 H21 G 22 H21 GUA 22 18.676 7.441 -5.782 235 H22 G 22 H22 GUA 22 17.551 7.513 -7.120 236 H5' A 23 H5' ADE 23 17.362 5.034 -12.820 237 H5'' A 23 H5'' ADE 23 16.226 3.680 -12.730 238 H4' A 23 H4' ADE 23 18.478 2.851 -12.697 239 H3' A 23 H3' ADE 23 17.062 2.521 -10.055 240 H2' A 23 H2'' ADE 23 19.043 1.343 -9.295 241 HO2' A 23 H2' ADE 23 20.832 1.135 -10.806 242 H1' A 23 H1' ADE 23 20.770 3.331 -10.150 243 H8 A 23 H8 ADE 23 17.497 4.924 -9.195 244 H61 A 23 H61 ADE 23 19.343 4.716 -3.289 245 H62 A 23 H62 ADE 23 18.129 5.320 -4.393 246 H2 A 23 H2 ADE 23 22.299 2.408 -5.758 247 H5' C 24 H5' CYT 24 18.670 -0.980 -10.956 248 H5'' C 24 H5'' CYT 24 17.600 -2.382 -10.775 249 H4' C 24 H4' CYT 24 19.596 -2.825 -9.584 250 H3' C 24 H3' CYT 24 17.315 -2.235 -7.704 251 H2' C 24 H2'' CYT 24 18.854 -2.750 -5.904 252 HO2' C 24 H2' CYT 24 20.644 -3.476 -8.010 253 H1' C 24 H1' CYT 24 20.865 -1.115 -6.902 254 H41 C 24 H41 CYT 24 17.201 2.635 -3.265 255 H42 C 24 H42 CYT 24 16.200 2.990 -4.648 256 H5 C 24 H5 CYT 24 16.487 1.911 -6.784 257 H6 C 24 H6 CYT 24 17.769 0.254 -8.017 258 H5' G 25 H5' GUA 25 19.013 -5.562 -6.393 259 H5'' G 25 H5'' GUA 25 17.883 -6.882 -6.047 260 H4' G 25 H4' GUA 25 19.271 -6.614 -4.160 261 H3' G 25 H3' GUA 25 16.507 -5.542 -3.608 262 H2' G 25 H2'' GUA 25 17.273 -5.154 -1.345 263 HO2' G 25 H2' GUA 25 19.668 -6.471 -2.180 264 H1' G 25 H1' GUA 25 19.646 -3.937 -2.134 265 H8 G 25 H8 GUA 25 17.138 -2.957 -4.682 266 H1 G 25 H1 GUA 25 16.476 0.289 0.810 267 H21 G 25 H21 GUA 25 17.670 -0.646 2.394 268 H22 G 25 H22 GUA 25 18.646 -2.072 2.117 269 H5' U 26 H5' URI 26 17.443 -7.873 -0.583 270 H5'' U 26 H5'' URI 26 16.200 -9.037 -0.095 271 H4' U 26 H4' URI 26 16.895 -7.827 1.823 272 H3' U 26 H3' URI 26 14.130 -7.000 0.957 273 H2' U 26 H2'' URI 26 14.079 -5.596 2.922 274 HO2' U 26 H2' URI 26 15.256 -6.115 4.614 275 H1' U 26 H1' URI 26 16.639 -4.549 2.490 276 H3 U 26 H3 URI 26 13.607 -1.287 1.461 277 H5 U 26 H5 URI 26 14.033 -3.590 -2.020 278 H6 U 26 H6 URI 26 15.249 -5.200 -0.717 279 H5' A 27 H5' ADE 27 14.052 -7.686 4.818 280 H5'' A 27 H5'' ADE 27 12.694 -8.668 5.397 281 H4' A 27 H4' ADE 27 12.774 -6.691 6.691 282 H3' A 27 H3' ADE 27 10.461 -6.654 4.766 283 H2' A 27 H2'' ADE 27 9.811 -4.557 5.756 284 HO2' A 27 H2' ADE 27 10.307 -4.177 7.785 285 H1' A 27 H1' ADE 27 12.407 -3.494 5.752 286 H8 A 27 H8 ADE 27 12.143 -5.431 2.606 287 H61 A 27 H61 ADE 27 9.336 -0.526 0.082 288 H62 A 27 H62 ADE 27 10.112 -2.061 -0.240 289 H2 A 27 H2 ADE 27 9.499 0.100 4.520 290 H5' G 28 H5' GUA 28 9.122 -5.647 8.306 291 H5'' G 28 H5'' GUA 28 7.633 -6.459 8.824 292 H4' G 28 H4' GUA 28 7.310 -4.125 9.054 293 H3' G 28 H3' GUA 28 5.791 -5.245 6.711 294 H2' G 28 H2'' GUA 28 4.919 -3.052 6.329 295 HO2' G 28 H2' GUA 28 4.415 -2.005 8.108 296 H1' G 28 H1' GUA 28 7.354 -1.696 6.963 297 H8 G 28 H8 GUA 28 8.133 -4.563 4.730 298 H1 G 28 H1 GUA 28 5.846 0.534 1.565 299 H21 G 28 H21 GUA 28 5.020 1.992 2.982 300 H22 G 28 H22 GUA 28 5.017 1.722 4.711 301 H5' U 29 H5' URI 29 0.822 -4.320 7.552 302 H5'' U 29 H5'' URI 29 1.925 -4.296 6.161 303 H4' U 29 H4' URI 29 0.990 -1.981 7.837 304 H3' U 29 H3' URI 29 0.478 -2.734 4.971 305 H2' U 29 H2'' URI 29 0.307 -0.359 4.516 306 HO2' U 29 H2' URI 29 0.489 1.153 6.212 307 H1' U 29 H1' URI 29 2.697 0.230 5.758 308 H3 U 29 H3 URI 29 3.470 0.005 1.253 309 H5 U 29 H5 URI 29 4.112 -3.890 2.687 310 H6 U 29 H6 URI 29 3.121 -3.131 4.867 311 H5' U 30 H5' URI 30 -2.124 0.134 5.656 312 H5'' U 30 H5'' URI 30 -3.777 -0.291 5.169 313 H4' U 30 H4' URI 30 -3.252 1.759 4.128 314 H3' U 30 H3' URI 30 -3.151 -0.523 2.159 315 H2' U 30 H2'' URI 30 -2.758 1.163 0.458 316 HO2' U 30 H2' URI 30 -3.294 3.205 0.776 317 H1' U 30 H1' URI 30 -0.769 2.445 1.918 318 H3 U 30 H3 URI 30 1.309 -0.002 -1.350 319 H5 U 30 H5 URI 30 0.877 -2.581 1.935 320 H6 U 30 H6 URI 30 -0.570 -0.939 2.934 321 H5' C 31 H5' CYT 31 -5.424 2.209 0.305 322 H5'' C 31 H5'' CYT 31 -6.947 1.515 -0.284 323 H4' C 31 H4' CYT 31 -5.944 2.622 -2.102 324 H3' C 31 H3' CYT 31 -5.633 -0.366 -2.361 325 H2' C 31 H2'' CYT 31 -4.628 0.083 -4.524 326 HO2' C 31 H2' CYT 31 -5.291 2.813 -4.007 327 H1' C 31 H1' CYT 31 -2.918 2.041 -3.539 328 H41 C 31 H41 CYT 31 0.262 -3.439 -2.859 329 H42 C 31 H42 CYT 31 -0.431 -3.637 -1.268 330 H5 C 31 H5 CYT 31 -2.129 -2.164 -0.383 331 H6 C 31 H6 CYT 31 -3.536 -0.233 -0.863 332 H5' U 32 H5' URI 32 -7.014 0.746 -5.919 333 H5'' U 32 H5'' URI 32 -8.420 -0.197 -6.445 334 H4' U 32 H4' URI 32 -6.843 -0.228 -8.203 335 H3' U 32 H3' URI 32 -6.904 -2.884 -6.775 336 H2' U 32 H2'' URI 32 -5.339 -3.663 -8.441 337 HO2' U 32 H2' URI 32 -5.804 -1.133 -9.692 338 H1' U 32 H1' URI 32 -3.705 -1.391 -8.259 339 H3 U 32 H3 URI 32 -1.491 -4.830 -6.225 340 H5 U 32 H5 URI 32 -4.064 -3.262 -3.302 341 H6 U 32 H6 URI 32 -5.117 -1.971 -5.036 342 H5' A 33 H5' ADE 33 -7.249 -3.637 -10.677 343 H5'' A 33 H5'' ADE 33 -8.520 -4.804 -11.075 344 H4' A 33 H4' ADE 33 -6.551 -5.518 -12.141 345 H3' A 33 H3' ADE 33 -7.153 -7.261 -9.759 346 H2' A 33 H2'' ADE 33 -5.244 -8.587 -10.428 347 HO2' A 33 H2' ADE 33 -5.289 -6.929 -12.751 348 H1' A 33 H1' ADE 33 -3.578 -6.381 -10.814 349 H8 A 33 H8 ADE 33 -5.739 -5.494 -7.920 350 H61 A 33 H61 ADE 33 -1.939 -8.837 -4.353 351 H62 A 33 H62 ADE 33 -3.265 -7.695 -4.362 352 H2 A 33 H2 ADE 33 -0.914 -9.666 -8.636 353 H5' A 34 H5' ADE 34 -6.477 -9.660 -12.846 354 H5'' A 34 H5'' ADE 34 -7.651 -10.971 -13.049 355 H4' A 34 H4' ADE 34 -5.482 -11.913 -13.076 356 H3' A 34 H3' ADE 34 -6.890 -12.554 -10.486 357 H2' A 34 H2'' ADE 34 -4.945 -13.903 -9.955 358 HO2' A 34 H2' ADE 34 -3.995 -13.215 -12.561 359 H1' A 34 H1' ADE 34 -3.133 -11.912 -10.649 360 H8 A 34 H8 ADE 34 -6.105 -10.164 -9.205 361 H61 A 34 H61 ADE 34 -3.755 -11.354 -3.606 362 H62 A 34 H62 ADE 34 -4.947 -10.434 -4.496 363 H2 A 34 H2 ADE 34 -1.467 -13.766 -6.617 364 H5' C 35 H5' CYT 35 -5.420 -15.940 -11.836 365 H5'' C 35 H5'' CYT 35 -6.528 -17.323 -11.801 366 H4' C 35 H4' CYT 35 -4.518 -17.941 -10.698 367 H3' C 35 H3' CYT 35 -6.768 -17.552 -8.724 368 H2' C 35 H2'' CYT 35 -5.201 -18.316 -7.035 369 HO2' C 35 H2' CYT 35 -3.364 -19.346 -7.547 370 H1' C 35 H1' CYT 35 -3.161 -16.624 -7.890 371 H41 C 35 H41 CYT 35 -6.436 -13.223 -3.618 372 H42 C 35 H42 CYT 35 -7.484 -12.643 -4.889 373 H5 C 35 H5 CYT 35 -7.414 -13.505 -7.146 374 H6 C 35 H6 CYT 35 -6.289 -15.055 -8.652 375 H5' C 36 H5' CYT 36 -5.118 -21.024 -7.798 376 H5'' C 36 H5'' CYT 36 -6.264 -22.366 -7.631 377 H4' C 36 H4' CYT 36 -4.910 -22.320 -5.686 378 H3' C 36 H3' CYT 36 -7.690 -21.299 -5.110 379 HO3' C 36 H3T CYT 36 -6.746 -23.591 -5.653 380 H2' C 36 H2'' CYT 36 -7.012 -21.133 -2.805 381 HO2' C 36 H2' CYT 36 -5.699 -22.677 -2.161 382 H1' C 36 H1' CYT 36 -4.473 -20.029 -3.390 383 H41 C 36 H41 CYT 36 -8.317 -15.120 -2.081 384 H42 C 36 H42 CYT 36 -8.828 -15.083 -3.750 385 H5 C 36 H5 CYT 36 -8.178 -16.759 -5.353 386 H6 C 36 H6 CYT 36 -6.902 -18.800 -5.696