data_17RA # _entry.id 17RA # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 17RA pdb_000017ra 10.2210/pdb17ra/pdb WWPDB D_1000170178 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1999-04-20 2 'Structure model' 1 1 2008-03-24 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-16 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 4 'Structure model' Other 7 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_nmr_software 4 4 'Structure model' pdbx_struct_assembly 5 4 'Structure model' pdbx_struct_oper_list 6 5 'Structure model' chem_comp_atom 7 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' 4 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 17RA _pdbx_database_status.recvd_initial_deposition_date 1998-08-04 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Nikonowicz, E.P.' 1 'Smith, J.S.' 2 # _citation.id primary _citation.title ;NMR structure and dynamics of an RNA motif common to the spliceosome branch-point helix and the RNA-binding site for phage GA coat protein. ; _citation.journal_abbrev Biochemistry _citation.journal_volume 37 _citation.page_first 13486 _citation.page_last 13498 _citation.year 1998 _citation.journal_id_ASTM BICHAW _citation.country US _citation.journal_id_ISSN 0006-2960 _citation.journal_id_CSD 0033 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9753434 _citation.pdbx_database_id_DOI 10.1021/bi981558a # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Smith, J.S.' 1 ? primary 'Nikonowicz, E.P.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description RNA _entity.formula_weight 6729.044 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation 'A5U, A6U' _entity.pdbx_fragment 'RBS AND START SITE FOR PHAGE GA REPLICASE GENE' _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCGUAAGGAUUACCUAUGCC _entity_poly.pdbx_seq_one_letter_code_can GGCGUAAGGAUUACCUAUGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 A n 1 7 A n 1 8 G n 1 9 G n 1 10 A n 1 11 U n 1 12 U n 1 13 A n 1 14 C n 1 15 C n 1 16 U n 1 17 A n 1 18 U n 1 19 G n 1 20 C n 1 21 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details ;IN VITRO SYNTHESIS FROM DNA TEMPLATE USING T7 RNA POLYMERASE. HAIRPIN CORRESPONDS TO NT -16 - +5 OF PHAGE GA REPLICASE AND THE YEAST PRE-MRNA BRANCHPOINT HELIX ; # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 A 7 7 7 A A A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 U 12 12 12 U U A . n A 1 13 A 13 13 13 A A A . n A 1 14 C 14 14 14 C C A . n A 1 15 C 15 15 15 C C A . n A 1 16 U 16 16 16 U U A . n A 1 17 A 17 17 17 A A A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' 3.1 ? 1 X-PLOR refinement 3.1 ? 2 X-PLOR phasing 3.1 ? 3 # _cell.entry_id 17RA _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 17RA _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 17RA _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 17RA _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 17RA _struct.title 'BRANCHPOINT HELIX FROM YEAST AND BINDING SITE FOR PHAGE GA/MS2 COAT PROTEINS, NMR, 12 STRUCTURES' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 17RA _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'BRANCHPOINT HELIX, PHAGE MS2, BULGE, BASE TRIPLE, RIBONUCLEIC ACID, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 17RA _struct_ref.pdbx_db_accession 17RA _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 17RA _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 21 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 17RA _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 21 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 21 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 3 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 3 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 3 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A U 18 O2 ? ? A G 4 A U 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A U 18 N3 ? ? A G 4 A U 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 17 N1 ? ? A U 5 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 5 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 15 N3 ? ? A G 8 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 15 O2 ? ? A G 8 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 8 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 14 N3 ? ? A G 9 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 14 O2 ? ? A G 9 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 14 N4 ? ? A G 9 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AAU _struct_site.pdbx_evidence_code Unknown _struct_site.pdbx_auth_asym_id ? _struct_site.pdbx_auth_comp_id ? _struct_site.pdbx_auth_seq_id ? _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 3 _struct_site.details 'A-A)*U MOTIF. PKA OF A7~6.1 AND IS PARTIALLY PROTONATED AT PH 6.8, A7 NH1 MAY BE STABILIZED BY U16 O2 (MODELS 7-12).' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AAU 3 A A 6 ? A A 6 . ? 1_555 ? 2 AAU 3 A A 7 ? A A 7 . ? 1_555 ? 3 AAU 3 U A 16 ? U A 16 . ? 1_555 ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.66 113.10 4.56 0.50 N 2 1 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.45 106.40 -2.95 0.40 N 3 1 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.62 113.10 4.52 0.50 N 4 1 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.48 106.40 -2.92 0.40 N 5 1 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.59 113.10 4.49 0.50 N 6 1 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.49 106.40 -2.91 0.40 N 7 1 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.54 101.50 5.04 0.80 N 8 1 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.52 113.80 3.72 0.50 N 9 1 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.59 113.80 3.79 0.50 N 10 1 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.29 105.80 -2.51 0.40 N 11 1 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.66 113.10 4.56 0.50 N 12 1 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.46 106.40 -2.94 0.40 N 13 1 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.67 113.10 4.57 0.50 N 14 1 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.35 106.40 -3.05 0.40 N 15 1 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.65 113.80 3.85 0.50 N 16 1 C8 A A 10 ? ? N9 A A 10 ? ? C4 A A 10 ? ? 103.36 105.80 -2.44 0.40 N 17 1 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.46 113.80 3.66 0.50 N 18 1 C8 A A 13 ? ? N9 A A 13 ? ? C4 A A 13 ? ? 103.29 105.80 -2.51 0.40 N 19 1 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.52 113.80 3.72 0.50 N 20 1 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.24 105.80 -2.56 0.40 N 21 1 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.67 113.10 4.57 0.50 N 22 1 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.43 106.40 -2.97 0.40 N 23 2 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.64 113.10 4.54 0.50 N 24 2 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.45 106.40 -2.95 0.40 N 25 2 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 26 2 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.42 106.40 -2.98 0.40 N 27 2 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.60 113.10 4.50 0.50 N 28 2 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.50 106.40 -2.90 0.40 N 29 2 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.52 101.50 5.02 0.80 N 30 2 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.68 113.80 3.88 0.50 N 31 2 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.52 113.80 3.72 0.50 N 32 2 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.31 105.80 -2.49 0.40 N 33 2 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.56 113.10 4.46 0.50 N 34 2 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.50 106.40 -2.90 0.40 N 35 2 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.83 113.10 4.73 0.50 N 36 2 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.29 106.40 -3.11 0.40 N 37 2 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.58 113.80 3.78 0.50 N 38 2 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.28 113.80 3.48 0.50 N 39 2 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.54 113.80 3.74 0.50 N 40 2 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.35 105.80 -2.45 0.40 N 41 2 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.65 113.10 4.55 0.50 N 42 2 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.43 106.40 -2.97 0.40 N 43 3 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.57 113.10 4.47 0.50 N 44 3 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.41 106.40 -2.99 0.40 N 45 3 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.69 113.10 4.59 0.50 N 46 3 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.41 106.40 -2.99 0.40 N 47 3 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.57 113.10 4.47 0.50 N 48 3 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.51 106.40 -2.89 0.40 N 49 3 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.47 101.50 4.97 0.80 N 50 3 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.65 113.80 3.85 0.50 N 51 3 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.49 113.80 3.69 0.50 N 52 3 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.35 105.80 -2.45 0.40 N 53 3 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.67 113.10 4.57 0.50 N 54 3 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.41 106.40 -2.99 0.40 N 55 3 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.72 113.10 4.62 0.50 N 56 3 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.34 106.40 -3.06 0.40 N 57 3 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.57 113.80 3.77 0.50 N 58 3 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.28 113.80 3.48 0.50 N 59 3 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.53 113.80 3.73 0.50 N 60 3 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.29 105.80 -2.51 0.40 N 61 3 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.64 113.10 4.54 0.50 N 62 3 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.52 106.40 -2.88 0.40 N 63 4 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.62 113.10 4.52 0.50 N 64 4 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.52 106.40 -2.88 0.40 N 65 4 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.73 113.10 4.63 0.50 N 66 4 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.38 106.40 -3.02 0.40 N 67 4 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.58 113.10 4.48 0.50 N 68 4 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.50 106.40 -2.90 0.40 N 69 4 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.48 101.50 4.98 0.80 N 70 4 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.59 113.80 3.79 0.50 N 71 4 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.49 113.80 3.69 0.50 N 72 4 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.34 105.80 -2.46 0.40 N 73 4 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.60 113.10 4.50 0.50 N 74 4 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.47 106.40 -2.93 0.40 N 75 4 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.66 113.10 4.56 0.50 N 76 4 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.39 106.40 -3.01 0.40 N 77 4 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.58 113.80 3.78 0.50 N 78 4 C8 A A 10 ? ? N9 A A 10 ? ? C4 A A 10 ? ? 103.37 105.80 -2.43 0.40 N 79 4 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.29 113.80 3.49 0.50 N 80 4 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.55 113.80 3.75 0.50 N 81 4 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.34 105.80 -2.46 0.40 N 82 4 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.59 113.10 4.49 0.50 N 83 4 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.54 106.40 -2.86 0.40 N 84 5 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.63 113.10 4.53 0.50 N 85 5 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.48 106.40 -2.92 0.40 N 86 5 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 87 5 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.44 106.40 -2.96 0.40 N 88 5 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.61 113.10 4.51 0.50 N 89 5 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.43 106.40 -2.97 0.40 N 90 5 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.71 101.50 5.21 0.80 N 91 5 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.64 113.80 3.84 0.50 N 92 5 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.49 113.80 3.69 0.50 N 93 5 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.30 105.80 -2.50 0.40 N 94 5 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.63 113.10 4.53 0.50 N 95 5 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.52 106.40 -2.88 0.40 N 96 5 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.73 113.10 4.63 0.50 N 97 5 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.29 106.40 -3.11 0.40 N 98 5 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.70 113.80 3.90 0.50 N 99 5 C8 A A 10 ? ? N9 A A 10 ? ? C4 A A 10 ? ? 103.32 105.80 -2.48 0.40 N 100 5 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.14 113.80 3.34 0.50 N 101 5 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.59 113.80 3.79 0.50 N 102 5 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.29 105.80 -2.51 0.40 N 103 5 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.69 113.10 4.59 0.50 N 104 5 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.46 106.40 -2.94 0.40 N 105 6 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.62 113.10 4.52 0.50 N 106 6 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.48 106.40 -2.92 0.40 N 107 6 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.68 113.10 4.58 0.50 N 108 6 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.43 106.40 -2.97 0.40 N 109 6 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.57 113.10 4.47 0.50 N 110 6 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.57 106.40 -2.83 0.40 N 111 6 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.55 101.50 5.05 0.80 N 112 6 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.67 113.80 3.87 0.50 N 113 6 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.37 105.80 -2.43 0.40 N 114 6 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.54 113.80 3.74 0.50 N 115 6 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.34 105.80 -2.46 0.40 N 116 6 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.65 113.10 4.55 0.50 N 117 6 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.49 106.40 -2.91 0.40 N 118 6 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.71 113.10 4.61 0.50 N 119 6 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.29 106.40 -3.11 0.40 N 120 6 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.65 113.80 3.85 0.50 N 121 6 C8 A A 10 ? ? N9 A A 10 ? ? C4 A A 10 ? ? 103.39 105.80 -2.41 0.40 N 122 6 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.48 113.80 3.68 0.50 N 123 6 C8 A A 13 ? ? N9 A A 13 ? ? C4 A A 13 ? ? 103.35 105.80 -2.45 0.40 N 124 6 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.56 113.80 3.76 0.50 N 125 6 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.26 105.80 -2.54 0.40 N 126 6 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.64 113.10 4.54 0.50 N 127 6 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.49 106.40 -2.91 0.40 N 128 7 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.68 113.10 4.58 0.50 N 129 7 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.45 106.40 -2.95 0.40 N 130 7 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 131 7 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.46 106.40 -2.94 0.40 N 132 7 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.60 113.10 4.50 0.50 N 133 7 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.44 106.40 -2.96 0.40 N 134 7 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.81 113.80 4.01 0.50 N 135 7 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.31 105.80 -2.49 0.40 N 136 7 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.52 113.80 3.72 0.50 N 137 7 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.38 105.80 -2.42 0.40 N 138 7 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.63 113.10 4.53 0.50 N 139 7 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.47 106.40 -2.93 0.40 N 140 7 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.75 113.10 4.65 0.50 N 141 7 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.35 106.40 -3.05 0.40 N 142 7 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.52 113.80 3.72 0.50 N 143 7 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.31 113.80 3.51 0.50 N 144 7 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.53 113.80 3.73 0.50 N 145 7 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.31 105.80 -2.49 0.40 N 146 7 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.72 113.10 4.62 0.50 N 147 7 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.43 106.40 -2.97 0.40 N 148 8 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.60 113.10 4.50 0.50 N 149 8 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.47 106.40 -2.93 0.40 N 150 8 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.62 113.10 4.52 0.50 N 151 8 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.43 106.40 -2.97 0.40 N 152 8 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.61 113.10 4.51 0.50 N 153 8 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.48 106.40 -2.92 0.40 N 154 8 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.85 113.80 4.05 0.50 N 155 8 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.26 105.80 -2.54 0.40 N 156 8 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.55 113.80 3.75 0.50 N 157 8 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.34 105.80 -2.46 0.40 N 158 8 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.57 113.10 4.47 0.50 N 159 8 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.48 106.40 -2.92 0.40 N 160 8 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.72 113.10 4.62 0.50 N 161 8 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.37 106.40 -3.03 0.40 N 162 8 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.51 113.80 3.71 0.50 N 163 8 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.19 113.80 3.39 0.50 N 164 8 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.54 113.80 3.74 0.50 N 165 8 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.32 105.80 -2.48 0.40 N 166 8 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.74 113.10 4.64 0.50 N 167 8 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.42 106.40 -2.98 0.40 N 168 9 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.64 113.10 4.54 0.50 N 169 9 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.50 106.40 -2.90 0.40 N 170 9 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.72 113.10 4.62 0.50 N 171 9 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.37 106.40 -3.03 0.40 N 172 9 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.60 113.10 4.50 0.50 N 173 9 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.44 106.40 -2.96 0.40 N 174 9 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.86 113.80 4.06 0.50 N 175 9 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.19 105.80 -2.61 0.40 N 176 9 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.54 113.80 3.74 0.50 N 177 9 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.36 105.80 -2.44 0.40 N 178 9 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.63 113.10 4.53 0.50 N 179 9 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.43 106.40 -2.97 0.40 N 180 9 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.69 113.10 4.59 0.50 N 181 9 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.37 106.40 -3.03 0.40 N 182 9 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.55 113.80 3.75 0.50 N 183 9 C8 A A 10 ? ? N9 A A 10 ? ? C4 A A 10 ? ? 103.38 105.80 -2.42 0.40 N 184 9 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.38 113.80 3.58 0.50 N 185 9 C8 A A 13 ? ? N9 A A 13 ? ? C4 A A 13 ? ? 103.22 105.80 -2.58 0.40 N 186 9 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.48 113.80 3.68 0.50 N 187 9 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.34 105.80 -2.46 0.40 N 188 9 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.60 113.10 4.50 0.50 N 189 9 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.49 106.40 -2.91 0.40 N 190 10 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.66 113.10 4.56 0.50 N 191 10 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.38 106.40 -3.02 0.40 N 192 10 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.66 113.10 4.56 0.50 N 193 10 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.39 106.40 -3.01 0.40 N 194 10 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.55 113.10 4.45 0.50 N 195 10 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.49 106.40 -2.91 0.40 N 196 10 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.80 113.80 4.00 0.50 N 197 10 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.29 105.80 -2.51 0.40 N 198 10 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.48 113.80 3.68 0.50 N 199 10 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.38 105.80 -2.42 0.40 N 200 10 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.58 113.10 4.48 0.50 N 201 10 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.47 106.40 -2.93 0.40 N 202 10 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.73 113.10 4.63 0.50 N 203 10 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.41 106.40 -2.99 0.40 N 204 10 "O4'" A A 10 ? ? "C1'" A A 10 ? ? N9 A A 10 ? ? 112.70 108.50 4.20 0.70 N 205 10 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.52 113.80 3.72 0.50 N 206 10 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.48 113.80 3.68 0.50 N 207 10 C8 A A 13 ? ? N9 A A 13 ? ? C4 A A 13 ? ? 103.26 105.80 -2.54 0.40 N 208 10 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.61 113.80 3.81 0.50 N 209 10 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.27 105.80 -2.53 0.40 N 210 10 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.70 113.10 4.60 0.50 N 211 10 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.42 106.40 -2.98 0.40 N 212 11 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.64 113.10 4.54 0.50 N 213 11 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.47 106.40 -2.93 0.40 N 214 11 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.62 113.10 4.52 0.50 N 215 11 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.43 106.40 -2.97 0.40 N 216 11 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.59 113.10 4.49 0.50 N 217 11 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.50 106.40 -2.90 0.40 N 218 11 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.45 101.50 4.95 0.80 N 219 11 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.82 113.80 4.02 0.50 N 220 11 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.36 105.80 -2.44 0.40 N 221 11 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.55 113.80 3.75 0.50 N 222 11 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.36 105.80 -2.44 0.40 N 223 11 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.69 113.10 4.59 0.50 N 224 11 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.44 106.40 -2.96 0.40 N 225 11 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.74 113.10 4.64 0.50 N 226 11 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.35 106.40 -3.05 0.40 N 227 11 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.62 113.80 3.82 0.50 N 228 11 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.52 113.80 3.72 0.50 N 229 11 C8 A A 13 ? ? N9 A A 13 ? ? C4 A A 13 ? ? 103.19 105.80 -2.61 0.40 N 230 11 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.58 113.80 3.78 0.50 N 231 11 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.32 105.80 -2.48 0.40 N 232 11 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.72 113.10 4.62 0.50 N 233 11 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.45 106.40 -2.95 0.40 N 234 12 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.62 113.10 4.52 0.50 N 235 12 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.48 106.40 -2.92 0.40 N 236 12 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.64 113.10 4.54 0.50 N 237 12 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.45 106.40 -2.95 0.40 N 238 12 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.57 113.10 4.47 0.50 N 239 12 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 103.51 106.40 -2.89 0.40 N 240 12 "C3'" A A 6 ? ? "C2'" A A 6 ? ? "C1'" A A 6 ? ? 106.59 101.50 5.09 0.80 N 241 12 N7 A A 6 ? ? C8 A A 6 ? ? N9 A A 6 ? ? 117.85 113.80 4.05 0.50 N 242 12 C8 A A 6 ? ? N9 A A 6 ? ? C4 A A 6 ? ? 103.31 105.80 -2.49 0.40 N 243 12 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.52 113.80 3.72 0.50 N 244 12 C8 A A 7 ? ? N9 A A 7 ? ? C4 A A 7 ? ? 103.37 105.80 -2.43 0.40 N 245 12 N7 A G 8 ? ? C8 A G 8 ? ? N9 A G 8 ? ? 117.69 113.10 4.59 0.50 N 246 12 C8 A G 8 ? ? N9 A G 8 ? ? C4 A G 8 ? ? 103.40 106.40 -3.00 0.40 N 247 12 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.68 113.10 4.58 0.50 N 248 12 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.38 106.40 -3.02 0.40 N 249 12 N7 A A 10 ? ? C8 A A 10 ? ? N9 A A 10 ? ? 117.50 113.80 3.70 0.50 N 250 12 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.40 113.80 3.60 0.50 N 251 12 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.53 113.80 3.73 0.50 N 252 12 C8 A A 17 ? ? N9 A A 17 ? ? C4 A A 17 ? ? 103.30 105.80 -2.50 0.40 N 253 12 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.64 113.10 4.54 0.50 N 254 12 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.54 106.40 -2.86 0.40 N # _pdbx_nmr_ensemble.entry_id 17RA _pdbx_nmr_ensemble.conformers_calculated_total_number 75 _pdbx_nmr_ensemble.conformers_submitted_total_number 12 _pdbx_nmr_ensemble.conformer_selection_criteria 'LEAST RESTRAINT VIOLATION' # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '10% H2O/90% D2O, 100% D2O' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.8 _pdbx_nmr_exptl_sample_conditions.ionic_strength '20 mM' _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D/3D NOESY' 1 2 1 COSY 1 3 1 HETCOR 1 # _pdbx_nmr_details.entry_id 17RA _pdbx_nmr_details.text ;FURTHER DETAILS OF DATA ACQUISITION AND STRUCTURE CALCULATION CAN BE FOUND IN THE METHODS SECTION OF THE MANUSCRIPT LISTED ABOVE. MODELS 1-6 ARE MINIMIZED STRUCTURES CALCULATED WITHOUT BASE PAIR CONSTRAINTS FOR A6, A7, AND U16. MODELS 7-12 ARE MINIMIZED STRUCTURES CALCULATED USING A6-U16 BASE PAIR CONSTRAINTS AND AN A7 N1H-U16 O2 HYDROGEN BOND. ; # _pdbx_nmr_refine.entry_id 17RA _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details 'REFINEMENT DETAILS CAN BE FOUND IN THE JRNL CITATION ABOVE.' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR 3.1 BRUNGER 1 'structure solution' Felix 950 ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 17RA 'a-form double helix' 17RA 'hairpin loop' 17RA 'mismatched base pair' 17RA 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 21 1_555 0.057 0.225 0.109 4.182 -9.684 -1.829 1 A_G1:C21_A A 1 ? A 21 ? 19 1 1 A G 2 1_555 A C 20 1_555 0.076 0.102 -0.656 7.913 1.441 -1.975 2 A_G2:C20_A A 2 ? A 20 ? 19 1 1 A C 3 1_555 A G 19 1_555 -0.088 0.153 -0.739 11.852 6.258 -4.657 3 A_C3:G19_A A 3 ? A 19 ? 19 1 1 A G 4 1_555 A U 18 1_555 -2.668 -0.240 0.578 17.099 -19.902 -3.554 4 A_G4:U18_A A 4 ? A 18 ? 28 ? 1 A U 5 1_555 A A 17 1_555 0.431 -0.065 1.001 0.170 -0.004 -3.222 5 A_U5:A17_A A 5 ? A 17 ? 20 1 1 A G 8 1_555 A C 15 1_555 -0.414 0.101 -0.274 29.618 2.283 0.839 6 A_G8:C15_A A 8 ? A 15 ? 19 1 1 A G 9 1_555 A C 14 1_555 -0.191 -0.263 -1.437 -1.261 -8.327 6.658 7 A_G9:C14_A A 9 ? A 14 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 21 1_555 A G 2 1_555 A C 20 1_555 -0.225 -1.328 4.234 -0.418 -0.410 27.141 -2.696 0.343 4.256 -0.873 0.891 27.147 1 AA_G1G2:C20C21_AA A 1 ? A 21 ? A 2 ? A 20 ? 1 A G 2 1_555 A C 20 1_555 A C 3 1_555 A G 19 1_555 -0.480 -1.453 3.922 1.786 20.894 26.187 -6.163 1.145 2.171 39.105 -3.343 33.434 2 AA_G2C3:G19C20_AA A 2 ? A 20 ? A 3 ? A 19 ? 1 A C 3 1_555 A G 19 1_555 A G 4 1_555 A U 18 1_555 0.603 -1.612 3.633 -5.433 11.632 21.637 -7.039 -2.943 2.270 28.031 13.093 25.121 3 AA_C3G4:U18G19_AA A 3 ? A 19 ? A 4 ? A 18 ? 1 A G 4 1_555 A U 18 1_555 A U 5 1_555 A A 17 1_555 -0.691 -1.171 4.038 -6.496 19.270 47.664 -2.909 0.268 3.419 22.681 7.646 51.587 4 AA_G4U5:A17U18_AA A 4 ? A 18 ? A 5 ? A 17 ? 1 A G 8 1_555 A C 15 1_555 A G 9 1_555 A C 14 1_555 1.050 -1.813 5.207 5.884 1.977 31.252 -3.883 -0.191 5.191 3.626 -10.788 31.847 5 AA_G8G9:C14C15_AA A 8 ? A 15 ? A 9 ? A 14 ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model AMX500 _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 500 # _atom_sites.entry_id 17RA _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_