data_1A4D # _entry.id 1A4D # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1A4D pdb_00001a4d 10.2210/pdb1a4d/pdb WWPDB D_1000170377 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1998-04-29 2 'Structure model' 1 1 2008-03-24 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-16 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' Other 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1A4D _pdbx_database_status.recvd_initial_deposition_date 1998-01-29 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1A51 _pdbx_database_related.details 'ENSEMBLE OF 9 STRUCTURES' _pdbx_database_related.content_type ensemble # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Dallas, A.' 1 'Moore, P.B.' 2 # _citation.id primary _citation.title ;The loop E-loop D region of Escherichia coli 5S rRNA: the solution structure reveals an unusual loop that may be important for binding ribosomal proteins. ; _citation.journal_abbrev Structure _citation.journal_volume 5 _citation.page_first 1639 _citation.page_last 1653 _citation.year 1997 _citation.journal_id_ASTM STRUE6 _citation.country UK _citation.journal_id_ISSN 0969-2126 _citation.journal_id_CSD 2005 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9438864 _citation.pdbx_database_id_DOI '10.1016/S0969-2126(97)00311-0' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Dallas, A.' 1 ? primary 'Moore, P.B.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man ;RNA (5'-R(*GP*GP*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*GP*UP*C)-3') ; 6857.093 1 ? ? 'LOOP D/LOOP E ARM' ? 2 polymer man ;RNA (5'-R(P*UP*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*GP*CP*C)-3') ; 6397.871 1 ? ? 'LOOP D/LOOP E ARM' ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polyribonucleotide no no GGCCGAUGGUAGUGUGGGGUC GGCCGAUGGUAGUGUGGGGUC A ? 2 polyribonucleotide no no UCCCCAUGCGAGAGUAGGCC UCCCCAUGCGAGAGUAGGCC B ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 C n 1 5 G n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 U n 1 11 A n 1 12 G n 1 13 U n 1 14 G n 1 15 U n 1 16 G n 1 17 G n 1 18 G n 1 19 G n 1 20 U n 1 21 C n 2 1 U n 2 2 C n 2 3 C n 2 4 C n 2 5 C n 2 6 A n 2 7 U n 2 8 G n 2 9 C n 2 10 G n 2 11 A n 2 12 G n 2 13 A n 2 14 G n 2 15 U n 2 16 A n 2 17 G n 2 18 G n 2 19 C n 2 20 C n # loop_ _entity_src_gen.entity_id _entity_src_gen.pdbx_src_id _entity_src_gen.pdbx_alt_source_flag _entity_src_gen.pdbx_seq_type _entity_src_gen.pdbx_beg_seq_num _entity_src_gen.pdbx_end_seq_num _entity_src_gen.gene_src_common_name _entity_src_gen.gene_src_genus _entity_src_gen.pdbx_gene_src_gene _entity_src_gen.gene_src_species _entity_src_gen.gene_src_strain _entity_src_gen.gene_src_tissue _entity_src_gen.gene_src_tissue_fraction _entity_src_gen.gene_src_details _entity_src_gen.pdbx_gene_src_fragment _entity_src_gen.pdbx_gene_src_scientific_name _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id _entity_src_gen.pdbx_gene_src_variant _entity_src_gen.pdbx_gene_src_cell_line _entity_src_gen.pdbx_gene_src_atcc _entity_src_gen.pdbx_gene_src_organ _entity_src_gen.pdbx_gene_src_organelle _entity_src_gen.pdbx_gene_src_cell _entity_src_gen.pdbx_gene_src_cellular_location _entity_src_gen.host_org_common_name _entity_src_gen.pdbx_host_org_scientific_name _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id _entity_src_gen.host_org_genus _entity_src_gen.pdbx_host_org_gene _entity_src_gen.pdbx_host_org_organ _entity_src_gen.host_org_species _entity_src_gen.pdbx_host_org_tissue _entity_src_gen.pdbx_host_org_tissue_fraction _entity_src_gen.pdbx_host_org_strain _entity_src_gen.pdbx_host_org_variant _entity_src_gen.pdbx_host_org_cell_line _entity_src_gen.pdbx_host_org_atcc _entity_src_gen.pdbx_host_org_culture_collection _entity_src_gen.pdbx_host_org_cell _entity_src_gen.pdbx_host_org_organelle _entity_src_gen.pdbx_host_org_cellular_location _entity_src_gen.pdbx_host_org_vector_type _entity_src_gen.pdbx_host_org_vector _entity_src_gen.host_org_details _entity_src_gen.expression_system_id _entity_src_gen.plasmid_name _entity_src_gen.plasmid_details _entity_src_gen.pdbx_description 1 1 sample ? ? ? ? Escherichia ? ? ? ? ? ? ? 'Escherichia coli' 562 ? ? ? ? ? ? CYTOPLASM ? 'Escherichia coli' 562 Escherichia ? ? ? ? ? JM101 ? ? ? ? ? ? ? ? ? ? ? PAD3 ? ? 2 1 sample ? ? ? ? Escherichia ? ? ? ? ? ? ? 'Escherichia coli' 562 ? ? ? ? ? ? CYTOPLASM ? 'Escherichia coli' 562 Escherichia ? ? ? ? ? JM101 ? ? ? ? ? ? ? ? ? ? ? PAD3 ? ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 68 68 G G A . n A 1 2 G 2 69 69 G G A . n A 1 3 C 3 70 70 C C A . n A 1 4 C 4 71 71 C C A . n A 1 5 G 5 72 72 G G A . n A 1 6 A 6 73 73 A A A . n A 1 7 U 7 74 74 U U A . n A 1 8 G 8 75 75 G G A . n A 1 9 G 9 76 76 G G A . n A 1 10 U 10 77 77 U U A . n A 1 11 A 11 78 78 A A A . n A 1 12 G 12 79 79 G G A . n A 1 13 U 13 80 80 U U A . n A 1 14 G 14 81 81 G G A . n A 1 15 U 15 82 82 U U A . n A 1 16 G 16 83 83 G G A . n A 1 17 G 17 84 84 G G A . n A 1 18 G 18 85 85 G G A . n A 1 19 G 19 86 86 G G A . n A 1 20 U 20 87 87 U U A . n A 1 21 C 21 88 88 C C A . n B 2 1 U 1 89 89 U U B . n B 2 2 C 2 90 90 C C B . n B 2 3 C 3 91 91 C C B . n B 2 4 C 4 92 92 C C B . n B 2 5 C 5 93 93 C C B . n B 2 6 A 6 94 94 A A B . n B 2 7 U 7 95 95 U U B . n B 2 8 G 8 96 96 G G B . n B 2 9 C 9 97 97 C C B . n B 2 10 G 10 98 98 G G B . n B 2 11 A 11 99 99 A A B . n B 2 12 G 12 100 100 G G B . n B 2 13 A 13 101 101 A A B . n B 2 14 G 14 102 102 G G B . n B 2 15 U 15 103 103 U U B . n B 2 16 A 16 104 104 A A B . n B 2 17 G 17 105 105 G G B . n B 2 18 G 18 106 106 G G B . n B 2 19 C 19 107 107 C C B . n B 2 20 C 20 108 108 C C B . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' . ? 1 X-PLOR refinement . ? 2 X-PLOR phasing . ? 3 # _cell.entry_id 1A4D _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1A4D _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1A4D _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 1A4D _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1A4D _struct.title 'LOOP D/LOOP E ARM OF ESCHERICHIA COLI 5S RRNA, NMR, MINIMIZED AVERAGE STRUCTURE' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1A4D _struct_keywords.pdbx_keywords RNA _struct_keywords.text '5S RRNA, INTERNAL LOOP, CROSS-STRAND STACK, TRANSLATION, RIBOSOME, RIBOSOMAL RNA COMPLEX, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # loop_ _struct_ref.id _struct_ref.entity_id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 1 PDB 1A4D 1A4D ? ? ? 2 2 PDB 1A4D 1A4D ? ? ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 1A4D A 1 ? 21 ? 1A4D 68 ? 88 ? 68 88 2 2 1A4D B 1 ? 20 ? 1A4D 89 ? 108 ? 89 108 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 68 B C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 68 B C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 68 B C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 19 N3 ? ? A G 69 B C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 19 O2 ? ? A G 69 B C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 19 N4 ? ? A G 69 B C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 18 N1 ? ? A C 70 B G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 18 O6 ? ? A C 70 B G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 18 N2 ? ? A C 70 B G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 B G 17 N1 ? ? A C 71 B G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 B G 17 O6 ? ? A C 71 B G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 B G 17 N2 ? ? A C 71 B G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 B A 16 N7 ? ? A G 72 B A 104 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog14 hydrog ? ? A G 5 N3 ? ? ? 1_555 B A 16 N6 ? ? A G 72 B A 104 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 B U 15 O2 ? ? A A 73 B U 103 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A A 6 N7 ? ? ? 1_555 B U 15 N3 ? ? A A 73 B U 103 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 B G 14 N1 ? ? A U 74 B G 102 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A G 8 O6 ? ? ? 1_555 B A 13 N6 ? ? A G 75 B A 101 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 B G 12 O6 ? ? A G 76 B G 100 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog20 hydrog ? ? A U 10 N3 ? ? ? 1_555 B A 11 N7 ? ? A U 77 B A 99 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog21 hydrog ? ? A U 10 O2 ? ? ? 1_555 B A 11 N6 ? ? A U 77 B A 99 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 B G 10 N3 ? ? A A 78 B G 98 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog23 hydrog ? ? A A 11 N7 ? ? ? 1_555 B G 10 N2 ? ? A A 78 B G 98 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog24 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 9 N3 ? ? A G 79 B C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 9 O2 ? ? A G 79 B C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 9 N4 ? ? A G 79 B C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 13 N3 ? ? ? 1_555 B G 8 O6 ? ? A U 80 B G 96 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A U 13 O2 ? ? ? 1_555 B G 8 N1 ? ? A U 80 B G 96 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A G 14 N1 ? ? ? 1_555 B U 7 O2 ? ? A G 81 B U 95 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog30 hydrog ? ? A G 14 O6 ? ? ? 1_555 B U 7 N3 ? ? A G 81 B U 95 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog31 hydrog ? ? A U 15 N3 ? ? ? 1_555 B A 6 N1 ? ? A U 82 B A 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 15 O4 ? ? ? 1_555 B A 6 N6 ? ? A U 82 B A 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 16 N1 ? ? ? 1_555 B C 5 N3 ? ? A G 83 B C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 N2 ? ? ? 1_555 B C 5 O2 ? ? A G 83 B C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 16 O6 ? ? ? 1_555 B C 5 N4 ? ? A G 83 B C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 17 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 84 B C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 17 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 84 B C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 17 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 84 B C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 18 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 85 B C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 18 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 85 B C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 18 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 85 B C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 2 O2 ? ? A G 86 B C 90 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O4 A U 74 ? ? H1 B G 102 ? ? 1.39 2 1 "O3'" A C 88 ? ? P B U 89 ? ? 1.61 # _pdbx_nmr_ensemble.entry_id 1A4D _pdbx_nmr_ensemble.conformers_calculated_total_number 60 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria 'NO NOE, DIHEDRAL VIOLATIONS, LOW OVERALL ENERGY STRUCTURES, GOOD LOCAL GEOMETRY' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 ? 7.2 ? . K 2 283 ? 5.5 ? . K # _pdbx_nmr_refine.entry_id 1A4D _pdbx_nmr_refine.method 'TORSION ANGLE MOLECULAR DYNAMICS' _pdbx_nmr_refine.details 'FOR REFINEMENT DETAILS, SEE JRNL REFERENCE ABOVE.' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR ? BRUNGER 1 'structure solution' X-PLOR ? ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1A4D 'double helix' 1A4D 'a-form double helix' 1A4D 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 B C 20 1_555 -0.394 -0.250 0.044 -0.591 -3.453 0.408 1 A_G68:C108_B A 68 ? B 108 ? 19 1 1 A G 2 1_555 B C 19 1_555 -0.891 -0.446 -0.115 -2.016 0.238 0.789 2 A_G69:C107_B A 69 ? B 107 ? 19 1 1 A C 3 1_555 B G 18 1_555 0.743 -0.371 -0.219 3.121 -0.027 -0.450 3 A_C70:G106_B A 70 ? B 106 ? 19 1 1 A C 4 1_555 B G 17 1_555 0.235 -0.248 -0.278 -5.044 -5.772 2.343 4 A_C71:G105_B A 71 ? B 105 ? 19 1 1 A G 5 1_555 B A 16 1_555 6.909 -3.932 0.188 4.084 -1.328 -4.152 5 A_G72:A104_B A 72 ? B 104 ? 11 10 1 A A 6 1_555 B U 15 1_555 -3.550 -0.999 -0.024 2.893 -10.183 -108.004 6 A_A73:U103_B A 73 ? B 103 ? 24 4 1 A U 7 1_555 B G 14 1_555 -4.202 0.991 -0.426 -4.940 -7.970 -93.929 7 A_U74:G102_B A 74 ? B 102 ? ? 2 1 A G 8 1_555 B A 13 1_555 -2.011 2.182 -0.091 -1.294 -2.028 -70.254 8 A_G75:A101_B A 75 ? B 101 ? ? ? 1 A G 9 1_555 B G 12 1_555 4.433 0.927 -0.314 2.719 0.235 -95.070 9 A_G76:G100_B A 76 ? B 100 ? ? ? 1 A U 10 1_555 B A 11 1_555 3.991 -1.669 -0.476 2.902 -6.526 -94.507 10 A_U77:A99_B A 77 ? B 99 ? 24 4 1 A A 11 1_555 B G 10 1_555 -6.756 -4.333 -0.148 3.285 -0.231 0.732 11 A_A78:G98_B A 78 ? B 98 ? 11 9 1 A G 12 1_555 B C 9 1_555 -0.821 -0.440 -0.254 -2.523 -6.682 1.692 12 A_G79:C97_B A 79 ? B 97 ? 19 1 1 A U 13 1_555 B G 8 1_555 1.531 -0.379 0.450 3.373 -7.611 -4.522 13 A_U80:G96_B A 80 ? B 96 ? 28 1 1 A G 14 1_555 B U 7 1_555 -1.089 -0.736 -1.078 -10.735 -8.759 -5.652 14 A_G81:U95_B A 81 ? B 95 ? 28 1 1 A U 15 1_555 B A 6 1_555 0.062 -0.244 0.077 1.555 -6.520 0.644 15 A_U82:A94_B A 82 ? B 94 ? 20 1 1 A G 16 1_555 B C 5 1_555 -0.397 -0.751 0.888 5.085 -16.711 -8.429 16 A_G83:C93_B A 83 ? B 93 ? 19 1 1 A G 17 1_555 B C 4 1_555 -0.344 -0.263 -0.065 -0.547 -9.958 -0.045 17 A_G84:C92_B A 84 ? B 92 ? 19 1 1 A G 18 1_555 B C 3 1_555 -0.979 -0.450 -0.046 -6.985 -5.107 1.452 18 A_G85:C91_B A 85 ? B 91 ? 19 1 1 A G 19 1_555 B C 2 1_555 0.842 2.197 -1.196 -10.354 6.472 53.777 19 A_G86:C90_B A 86 ? B 90 ? ? 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 B C 20 1_555 A G 2 1_555 B C 19 1_555 0.173 -1.655 3.083 -1.261 14.809 37.839 -3.798 -0.370 2.297 21.834 1.859 40.553 1 AA_G68G69:C107C108_BB A 68 ? B 108 ? A 69 ? B 107 ? 1 A G 2 1_555 B C 19 1_555 A C 3 1_555 B G 18 1_555 -0.072 -0.480 3.111 0.938 19.135 34.145 -2.849 0.212 2.505 29.856 -1.463 39.013 2 AA_G69C70:G106C107_BB A 69 ? B 107 ? A 70 ? B 106 ? 1 A C 3 1_555 B G 18 1_555 A C 4 1_555 B G 17 1_555 0.205 -1.903 3.312 1.589 12.950 35.259 -4.510 -0.128 2.491 20.531 -2.518 37.523 3 AA_C70C71:G105G106_BB A 70 ? B 106 ? A 71 ? B 105 ? 1 A C 4 1_555 B G 17 1_555 A G 5 1_555 B A 16 1_555 -0.457 0.038 3.078 0.344 8.763 59.508 -0.369 0.472 3.053 8.776 -0.345 60.092 4 AA_C71G72:A104G105_BB A 71 ? B 105 ? A 72 ? B 104 ? 1 A G 5 1_555 B A 16 1_555 A A 6 1_555 B U 15 1_555 -6.189 -0.634 2.889 -8.307 -2.700 -11.791 3.123 -26.214 -1.285 11.322 -34.839 -14.665 5 AA_G72A73:U103A104_BB A 72 ? B 104 ? A 73 ? B 103 ? 1 A A 6 1_555 B U 15 1_555 A U 7 1_555 B G 14 1_555 0.836 -3.323 3.276 1.206 9.343 56.732 -3.928 -0.809 2.759 9.758 -1.259 57.445 6 AA_A73U74:G102U103_BB A 73 ? B 103 ? A 74 ? B 102 ? 1 A U 7 1_555 B G 14 1_555 A G 8 1_555 B A 13 1_555 1.252 -2.253 3.015 0.414 -0.982 39.545 -3.222 -1.804 3.080 -1.451 -0.611 39.558 7 AA_U74G75:A101G102_BB A 74 ? B 102 ? A 75 ? B 101 ? 1 A G 8 1_555 B A 13 1_555 A G 9 1_555 B G 12 1_555 -0.551 -2.712 3.277 0.684 0.582 59.716 -2.753 0.588 3.247 0.584 -0.686 59.722 8 AA_G75G76:G100A101_BB A 75 ? B 101 ? A 76 ? B 100 ? 1 A G 9 1_555 B G 12 1_555 A U 10 1_555 B A 11 1_555 -0.775 -2.322 3.128 -5.289 -4.102 45.580 -2.616 0.536 3.378 -5.261 6.784 46.043 9 AA_G76U77:A99G100_BB A 76 ? B 100 ? A 77 ? B 99 ? 1 A U 10 1_555 B A 11 1_555 A A 11 1_555 B G 10 1_555 5.491 -0.933 3.134 -0.850 2.188 -18.517 1.688 16.472 3.466 -6.764 -2.629 -18.664 10 AA_U77A78:G98A99_BB A 77 ? B 99 ? A 78 ? B 98 ? 1 A A 11 1_555 B G 10 1_555 A G 12 1_555 B C 9 1_555 -0.202 -0.777 3.250 -4.862 7.182 65.501 -0.999 -0.008 3.166 6.608 4.473 66.009 11 AA_A78G79:C97G98_BB A 78 ? B 98 ? A 79 ? B 97 ? 1 A G 12 1_555 B C 9 1_555 A U 13 1_555 B G 8 1_555 -0.366 -0.659 3.117 -0.393 2.151 43.503 -1.084 0.457 3.086 2.900 0.530 43.556 12 AA_G79U80:G96C97_BB A 79 ? B 97 ? A 80 ? B 96 ? 1 A U 13 1_555 B G 8 1_555 A G 14 1_555 B U 7 1_555 -0.418 -2.192 4.025 6.803 -5.390 18.139 -3.037 5.296 4.080 -15.964 -20.149 20.093 13 AA_U80G81:U95G96_BB A 80 ? B 96 ? A 81 ? B 95 ? 1 A G 14 1_555 B U 7 1_555 A U 15 1_555 B A 6 1_555 0.374 -0.822 2.976 -7.467 -6.271 39.833 -0.543 -1.285 2.953 -9.041 10.765 40.962 14 AA_G81U82:A94U95_BB A 81 ? B 95 ? A 82 ? B 94 ? 1 A U 15 1_555 B A 6 1_555 A G 16 1_555 B C 5 1_555 -0.620 -1.524 2.933 -3.710 -0.576 29.757 -2.837 0.500 3.014 -1.116 7.189 29.988 15 AA_U82G83:C93A94_BB A 82 ? B 94 ? A 83 ? B 93 ? 1 A G 16 1_555 B C 5 1_555 A G 17 1_555 B C 4 1_555 0.415 -1.501 3.637 3.638 -8.108 32.754 -1.043 -0.026 3.910 -14.058 -6.307 33.906 16 AA_G83G84:C92C93_BB A 83 ? B 93 ? A 84 ? B 92 ? 1 A G 17 1_555 B C 4 1_555 A G 18 1_555 B C 3 1_555 0.275 -1.872 3.695 -3.079 -8.887 27.622 -1.362 -1.363 4.036 -17.966 6.224 29.150 17 AA_G84G85:C91C92_BB A 84 ? B 92 ? A 85 ? B 91 ? 1 A G 18 1_555 B C 3 1_555 A G 19 1_555 B C 2 1_555 2.655 -1.076 3.463 4.462 6.503 34.019 -2.860 -3.697 3.514 10.933 -7.502 34.895 18 AA_G85G86:C90C91_BB A 85 ? B 91 ? A 86 ? B 90 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 UNITY Varian 500 2 UNITYPLUS GE 600 3 OMEGA GE 600 # _atom_sites.entry_id 1A4D _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_