data_1F78 # _entry.id 1F78 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1F78 pdb_00001f78 10.2210/pdb1f78/pdb RCSB RCSB011329 ? ? WWPDB D_1000011329 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1F6X '1F6X shows the structure of the free wildtype P4 stem oligoribonucleotide' unspecified PDB 1F6Z '1F6Z shows the structure of the free C70U mutant P4 stem oligoribonucleotide' unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1F78 _pdbx_database_status.recvd_initial_deposition_date 2000-06-26 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Schmitz, M.' 1 'Tinoco Jr., I.' 2 # _citation.id primary _citation.title 'Solution structure and metal-ion binding of the P4 element from bacterial RNase P RNA.' _citation.journal_abbrev RNA _citation.journal_volume 6 _citation.page_first 1212 _citation.page_last 1225 _citation.year 2000 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 10999599 _citation.pdbx_database_id_DOI 10.1017/S1355838200000881 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Schmitz, M.' 1 ? primary 'Tinoco Jr., I.' 2 ? # _cell.entry_id 1F78 _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1F78 _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNASE P RNA RIBOZYME, P4 DOMAIN' 8633.143 1 ? ? 'P4 STEM' ? 2 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAAGUCCGGUCUUCGGACCGGCUUCC _entity_poly.pdbx_seq_one_letter_code_can GGAAGUCCGGUCUUCGGACCGGCUUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 A n 1 5 G n 1 6 U n 1 7 C n 1 8 C n 1 9 G n 1 10 G n 1 11 U n 1 12 C n 1 13 U n 1 14 U n 1 15 C n 1 16 G n 1 17 G n 1 18 A n 1 19 C n 1 20 C n 1 21 G n 1 22 G n 1 23 C n 1 24 U n 1 25 U n 1 26 C n 1 27 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'enzymatically synthesized from DNA ologonucleotide template by T7 RNA polymerase' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1F78 _struct_ref.pdbx_db_accession 1F78 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1F78 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1F78 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6 3' 161.116 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 2 2 '2D NOESY' 3 3 3 '2D NOESY' 4 4 4 '2D NOESY' 5 2 2 DQF-COSY 6 2 2 31P-1H-COSY 7 2 2 13C-1H-HMQC # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 6.5 '100 mM Na' ? K 2 288 ambient 6.5 '100 mM Na' ? K 3 288 ambient 6.5 '100 mM Na, 10 mM Mg' ? K 4 288 ambient 6.5 '100 mM Na, 3 mM Co(NH3)6' ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2 mM P4 RNA; 100 mM sodium chloride; 10 mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' 2 '2 mM P4 RNA; 100 mM sodium chloride; 10 mM phosphate buffer; 99.96% D2O' '99.96% D2O' 3 '2 mM P4 RNA; 100 mM sodium chloride; 10 mM magnesium chloride; 10 mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' 4 '2 mM P4 RNA; 100 mM sodium chloride; 3 mM hexammine cobalt chloride; 10 mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Bruker AMX 600 2 ? Bruker DRX 500 # _pdbx_nmr_refine.entry_id 1F78 _pdbx_nmr_refine.method 'restrained molecular dynamics and simulated annealing' _pdbx_nmr_refine.details ;The average structure is based on superposition of 11 converged structures after refinement. The average RMS deviation between the ensemble and the average structure is 1.7 Angstrom. A total of 266 NOE-derived intramolecular distance constraints, 164 dihedral restraint and 48 distance restraints from hydrogen bonds were used in the refinement. 12 NOE derived intermolecular distance constraints were used to localize the bound cobalt (III) hexammine ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_details.entry_id 1F78 _pdbx_nmr_details.text ;This structure was determined using standard 2D homonuclear techniques and 13C and 31P heteronuclear techniques at natural abundance. Intermolecular NOE crosspeaks between RNA protons and cobalt (III) hexammine protons and derived intermolecular distance constraints were used to determine the site of cobalt (III) hexammine binding in the complex structure ; # _pdbx_nmr_ensemble.entry_id 1F78 _pdbx_nmr_ensemble.conformers_calculated_total_number ? _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria ? # _pdbx_nmr_representative.entry_id 1F78 _pdbx_nmr_representative.conformer_id ? _pdbx_nmr_representative.selection_criteria 'minimized average structure' # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal XwinNMR 3.1 collection Bruker 1 Felix 95 processing MSI 2 X-PLOR 3.84 'structure solution' Brunger 3 X-PLOR 3.84 refinement Brunger 4 # _exptl.entry_id 1F78 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 1F78 _struct.title ;SOLUTION STRUCTURE OF RNASE P RNA (M1 RNA) P4 STEM OLIGORIBONUCLEOTIDE COMPLEXED WITH COBALT (III) HEXAMINE, NMR, MINIMIZED AVERAGE STRUCTURE ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details 'minimized average' # _struct_keywords.entry_id 1F78 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RIBONUCLEASE P, RIBOZYME, TRANSFER RNA PROCESSING, P4 STEM, METAL BINDING SITE, METAL COMPLEX, COBALT (III) HEXAMMINE COMPLEX, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 25 N3 ? ? A A 3 A U 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 25 O4 ? ? A A 3 A U 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 24 N3 ? ? A A 4 A U 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 24 O4 ? ? A A 4 A U 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 7 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 7 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 7 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 18 N1 ? ? A U 11 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 18 N6 ? ? A U 11 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 13 O2 ? ? ? 1_555 A G 16 N1 ? ? A U 13 A G 16 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id NCO _struct_site.pdbx_auth_seq_id 28 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 3 _struct_site.details 'BINDING SITE FOR RESIDUE NCO A 28' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 3 G A 5 ? G A 5 . ? 1_555 ? 2 AC1 3 C A 8 ? C A 8 . ? 1_555 ? 3 AC1 3 G A 21 ? G A 21 . ? 1_555 ? # _database_PDB_matrix.entry_id 1F78 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1F78 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CO H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 C 8 8 8 C C A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 U 24 24 24 U U A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id NCO _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 28 _pdbx_nonpoly_scheme.auth_seq_num 28 _pdbx_nonpoly_scheme.pdb_mon_id NCO _pdbx_nonpoly_scheme.auth_mon_id NCO _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2000-10-09 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' 4 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 5 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 6 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1F78 'double helix' 1F78 'a-form double helix' 1F78 tetraloop 1F78 'bulge loop' 1F78 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 27 1_555 -0.273 -0.339 -0.444 45.755 20.415 -3.047 1 A_G1:C27_A A 1 ? A 27 ? 19 1 1 A G 2 1_555 A C 26 1_555 -0.355 -0.266 0.073 7.996 -2.819 -4.371 2 A_G2:C26_A A 2 ? A 26 ? 19 1 1 A A 3 1_555 A U 25 1_555 0.200 -0.177 -0.824 -2.191 -21.191 -1.003 3 A_A3:U25_A A 3 ? A 25 ? 20 1 1 A A 4 1_555 A U 24 1_555 0.063 0.001 -0.481 -3.528 -5.000 -2.763 4 A_A4:U24_A A 4 ? A 24 ? 20 1 1 A G 5 1_555 A C 23 1_555 -0.222 -0.401 -1.051 2.700 -2.238 -2.327 5 A_G5:C23_A A 5 ? A 23 ? 19 1 1 A C 7 1_555 A G 22 1_555 0.147 -0.186 0.449 -9.964 30.686 2.551 6 A_C7:G22_A A 7 ? A 22 ? 19 1 1 A C 8 1_555 A G 21 1_555 -0.055 -0.547 -1.097 -8.481 7.807 -8.819 7 A_C8:G21_A A 8 ? A 21 ? 19 1 1 A G 9 1_555 A C 20 1_555 0.061 -0.644 -1.285 3.745 4.757 -4.977 8 A_G9:C20_A A 9 ? A 20 ? 19 1 1 A G 10 1_555 A C 19 1_555 -0.375 -0.592 -1.117 -0.140 -19.688 9.943 9 A_G10:C19_A A 10 ? A 19 ? 19 1 1 A U 11 1_555 A A 18 1_555 -0.300 0.020 -0.611 4.173 -5.740 -3.586 10 A_U11:A18_A A 11 ? A 18 ? 20 1 1 A C 12 1_555 A G 17 1_555 0.174 -0.633 1.970 -29.827 16.219 -4.459 11 A_C12:G17_A A 12 ? A 17 ? 19 1 1 A U 13 1_555 A G 16 1_555 1.214 -5.464 0.287 37.976 8.481 -64.596 12 A_U13:G16_A A 13 ? A 16 ? ? 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 27 1_555 A G 2 1_555 A C 26 1_555 -0.665 -0.698 5.728 -3.669 20.922 23.529 -7.887 0.062 3.910 41.964 7.359 31.598 1 AA_G1G2:C26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A G 2 1_555 A C 26 1_555 A A 3 1_555 A U 25 1_555 0.282 -1.553 3.808 5.691 17.634 35.716 -4.424 0.285 2.785 26.656 -8.603 40.097 2 AA_G2A3:U25C26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A A 3 1_555 A U 25 1_555 A A 4 1_555 A U 24 1_555 0.354 -1.165 4.294 -3.587 -13.355 29.424 1.171 -1.509 4.333 -24.651 6.622 32.447 3 AA_A3A4:U24U25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A A 4 1_555 A U 24 1_555 A G 5 1_555 A C 23 1_555 0.055 -1.657 3.280 1.218 16.371 25.602 -6.010 0.107 1.900 32.974 -2.453 30.339 4 AA_A4G5:C23U24_AA A 4 ? A 24 ? A 5 ? A 23 ? 1 A G 5 1_555 A C 23 1_555 A C 7 1_555 A G 22 1_555 -1.968 -0.643 3.629 -13.950 44.253 52.460 -2.474 1.138 2.820 42.078 13.264 68.926 5 AA_G5C7:G22C23_AA A 5 ? A 23 ? A 7 ? A 22 ? 1 A C 7 1_555 A G 22 1_555 A C 8 1_555 A G 21 1_555 -1.054 -0.781 4.457 10.765 14.007 28.635 -4.261 4.061 3.169 25.486 -19.587 33.549 6 AA_C7C8:G21G22_AA A 7 ? A 22 ? A 8 ? A 21 ? 1 A C 8 1_555 A G 21 1_555 A G 9 1_555 A C 20 1_555 0.170 -0.898 3.866 0.936 -0.343 22.689 -2.135 -0.032 3.883 -0.870 -2.377 22.710 7 AA_C8G9:C20G21_AA A 8 ? A 21 ? A 9 ? A 20 ? 1 A G 9 1_555 A C 20 1_555 A G 10 1_555 A C 19 1_555 0.844 -1.150 4.017 1.760 12.584 26.182 -5.504 -1.233 3.188 25.925 -3.627 29.054 8 AA_G9G10:C19C20_AA A 9 ? A 20 ? A 10 ? A 19 ? 1 A G 10 1_555 A C 19 1_555 A U 11 1_555 A A 18 1_555 -0.890 -1.015 3.218 -5.079 20.025 32.120 -3.915 0.767 2.327 32.354 8.206 38.043 9 AA_G10U11:A18C19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A U 11 1_555 A A 18 1_555 A C 12 1_555 A G 17 1_555 -0.641 -2.187 4.218 -18.753 21.719 29.794 -5.852 -1.453 2.244 33.950 29.314 41.138 10 AA_U11C12:G17A18_AA A 11 ? A 18 ? A 12 ? A 17 ? 1 A C 12 1_555 A G 17 1_555 A U 13 1_555 A G 16 1_555 2.092 -2.070 2.543 -23.362 -0.213 98.049 -1.348 -1.632 2.145 -0.140 15.314 100.094 11 AA_C12U13:G16G17_AA A 12 ? A 17 ? A 13 ? A 16 ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'COBALT HEXAMMINE(III)' _pdbx_entity_nonpoly.comp_id NCO #