data_1FQZ # _entry.id 1FQZ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1FQZ pdb_00001fqz 10.2210/pdb1fqz/pdb RCSB RCSB011837 ? ? WWPDB D_1000011837 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2001-01-17 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1FQZ _pdbx_database_status.recvd_initial_deposition_date 2000-09-07 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Klinck, R.' 1 'Westhof, E.' 2 'Walker, S.' 3 'Afshar, M.' 4 'Collier, A.' 5 'Aboul-ela, F.' 6 # _citation.id primary _citation.title 'A potential RNA drug target in the hepatitis C virus internal ribosomal entry site.' _citation.journal_abbrev RNA _citation.journal_volume 6 _citation.page_first 1423 _citation.page_last 1431 _citation.year 2000 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11073218 _citation.pdbx_database_id_DOI 10.1017/S1355838200000935 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Klinck, R.' 1 ? primary 'Westhof, E.' 2 ? primary 'Walker, S.' 3 ? primary 'Afshar, M.' 4 ? primary 'Collier, A.' 5 ? primary 'Aboul-Ela, F.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'HEPATITIS C VIRUS IRES DOMAIN IIID' _entity.formula_weight 8800.279 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GCCGAGUAGUGUUGGGUCGCGAAAGGC _entity_poly.pdbx_seq_one_letter_code_can GCCGAGUAGUGUUGGGUCGCGAAAGGC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 C n 1 3 C n 1 4 G n 1 5 A n 1 6 G n 1 7 U n 1 8 A n 1 9 G n 1 10 U n 1 11 G n 1 12 U n 1 13 U n 1 14 G n 1 15 G n 1 16 G n 1 17 U n 1 18 C n 1 19 G n 1 20 C n 1 21 G n 1 22 A n 1 23 A n 1 24 A n 1 25 G n 1 26 G n 1 27 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'Transcribed using T7 RNA polymerase' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 C 2 2 2 C C A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 U 12 12 12 U U A . n A 1 13 U 13 13 13 U U A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 A 24 24 24 A A A . n A 1 25 G 25 25 25 G G A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n # _cell.entry_id 1FQZ _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1FQZ _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1FQZ _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 1FQZ _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1FQZ _struct.title 'NMR VALIDATED MODEL OF DOMAIN IIID OF HEPATITIS C VIRUS INTERNAL RIBOSOME ENTRY SITE' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1FQZ _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'trans wobble G.U pair, S-turn, sarcin-ricin loop, loop E motif, sheared G.A pair, reverse Hoogsteen A.U pair, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1FQZ _struct_ref.pdbx_db_accession 1FQZ _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1FQZ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1FQZ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 2 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 2 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 2 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A A 24 N7 ? ? A G 4 A A 24 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog11 hydrog ? ? A G 4 N3 ? ? ? 1_555 A A 24 N6 ? ? A G 4 A A 24 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog12 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 23 N7 ? ? A A 5 A A 23 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog13 hydrog ? ? A A 5 N7 ? ? ? 1_555 A A 23 N6 ? ? A A 5 A A 23 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog14 hydrog ? ? A G 6 N2 ? ? ? 1_555 A U 7 O4 ? ? A G 6 A U 7 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog15 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 22 N7 ? ? A U 7 A A 22 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A U 7 O2 ? ? ? 1_555 A A 22 N6 ? ? A U 7 A A 22 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A A 8 N6 ? ? ? 1_555 A G 21 N3 ? ? A A 8 A G 21 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A A 8 N7 ? ? ? 1_555 A G 21 N2 ? ? A A 8 A G 21 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 10 N3 ? ? ? 1_555 A G 19 O6 ? ? A U 10 A G 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog23 hydrog ? ? A U 10 O2 ? ? ? 1_555 A G 19 N1 ? ? A U 10 A G 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 12 N3 ? ? ? 1_555 A G 16 O6 ? ? A U 12 A G 16 1_555 ? ? ? ? ? ? TYPE_27_PAIR ? ? ? hydrog28 hydrog ? ? A U 12 O4 ? ? ? 1_555 A G 16 N1 ? ? A U 12 A G 16 1_555 ? ? ? ? ? ? TYPE_27_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 C2 A U 7 ? ? N3 A U 7 ? ? 1.415 1.373 0.042 0.007 N 2 1 C2 A U 10 ? ? N3 A U 10 ? ? 1.418 1.373 0.045 0.007 N 3 1 C2 A U 13 ? ? N3 A U 13 ? ? 1.419 1.373 0.046 0.007 N 4 1 C2 A U 17 ? ? N3 A U 17 ? ? 1.419 1.373 0.046 0.007 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N3 A G 1 ? ? C2 A G 1 ? ? N2 A G 1 ? ? 126.33 119.90 6.43 0.70 N 2 1 N1 A G 1 ? ? C6 A G 1 ? ? O6 A G 1 ? ? 123.63 119.90 3.73 0.60 N 3 1 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 112.95 108.50 4.45 0.70 N 4 1 N3 A G 4 ? ? C2 A G 4 ? ? N2 A G 4 ? ? 126.62 119.90 6.72 0.70 N 5 1 N1 A A 5 ? ? C6 A A 5 ? ? N6 A A 5 ? ? 125.27 118.60 6.67 0.60 N 6 1 N3 A G 6 ? ? C2 A G 6 ? ? N2 A G 6 ? ? 125.44 119.90 5.54 0.70 N 7 1 N1 A A 8 ? ? C6 A A 8 ? ? N6 A A 8 ? ? 125.24 118.60 6.64 0.60 N 8 1 N3 A G 9 ? ? C2 A G 9 ? ? N2 A G 9 ? ? 126.29 119.90 6.39 0.70 N 9 1 N3 A G 11 ? ? C2 A G 11 ? ? N2 A G 11 ? ? 126.66 119.90 6.76 0.70 N 10 1 N1 A G 11 ? ? C6 A G 11 ? ? O6 A G 11 ? ? 123.69 119.90 3.79 0.60 N 11 1 C5 A G 11 ? ? C6 A G 11 ? ? O6 A G 11 ? ? 124.99 128.60 -3.61 0.60 N 12 1 "O4'" A U 12 ? ? "C1'" A U 12 ? ? N1 A U 12 ? ? 112.81 108.50 4.31 0.70 N 13 1 N3 A G 14 ? ? C2 A G 14 ? ? N2 A G 14 ? ? 126.12 119.90 6.22 0.70 N 14 1 N3 A G 15 ? ? C2 A G 15 ? ? N2 A G 15 ? ? 126.08 119.90 6.18 0.70 N 15 1 N1 A G 15 ? ? C6 A G 15 ? ? O6 A G 15 ? ? 123.53 119.90 3.63 0.60 N 16 1 N3 A G 16 ? ? C2 A G 16 ? ? N2 A G 16 ? ? 126.43 119.90 6.53 0.70 N 17 1 N1 A G 16 ? ? C6 A G 16 ? ? O6 A G 16 ? ? 123.82 119.90 3.92 0.60 N 18 1 C5 A G 16 ? ? C6 A G 16 ? ? O6 A G 16 ? ? 124.93 128.60 -3.67 0.60 N 19 1 N3 A G 19 ? ? C2 A G 19 ? ? N2 A G 19 ? ? 126.39 119.90 6.49 0.70 N 20 1 N1 A G 19 ? ? C6 A G 19 ? ? O6 A G 19 ? ? 123.73 119.90 3.83 0.60 N 21 1 C5 A G 19 ? ? C6 A G 19 ? ? O6 A G 19 ? ? 124.84 128.60 -3.76 0.60 N 22 1 "O4'" A C 20 ? ? "C1'" A C 20 ? ? N1 A C 20 ? ? 112.92 108.50 4.42 0.70 N 23 1 N3 A G 21 ? ? C2 A G 21 ? ? N2 A G 21 ? ? 126.88 119.90 6.98 0.70 N 24 1 N1 A G 21 ? ? C6 A G 21 ? ? O6 A G 21 ? ? 123.52 119.90 3.62 0.60 N 25 1 N1 A A 22 ? ? C6 A A 22 ? ? N6 A A 22 ? ? 125.23 118.60 6.63 0.60 N 26 1 N1 A A 23 ? ? C6 A A 23 ? ? N6 A A 23 ? ? 125.52 118.60 6.92 0.60 N 27 1 N1 A A 24 ? ? C6 A A 24 ? ? N6 A A 24 ? ? 125.47 118.60 6.87 0.60 N 28 1 N3 A G 25 ? ? C2 A G 25 ? ? N2 A G 25 ? ? 126.07 119.90 6.17 0.70 N 29 1 N1 A G 25 ? ? C6 A G 25 ? ? O6 A G 25 ? ? 123.60 119.90 3.70 0.60 N 30 1 N3 A G 26 ? ? C2 A G 26 ? ? N2 A G 26 ? ? 125.99 119.90 6.09 0.70 N 31 1 N1 A G 26 ? ? C6 A G 26 ? ? O6 A G 26 ? ? 123.53 119.90 3.63 0.60 N # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 1 _pdbx_validate_planes.auth_comp_id U _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 12 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.075 _pdbx_validate_planes.type 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 1FQZ _pdbx_nmr_ensemble.conformers_calculated_total_number 1 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with acceptable covalent geometry, structures with favorable non-bond energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '1.2 mM RNA, 8mM sodium phosphate buffer pH 6.6' '90% H2O/10% D2O' 2 '1.2 mM RNA, 8mM sodium phosphate buffer pH 6.6' '100% D2O' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 278 ambient 6.6 '8mM Na phosphate' ? K 2 298 ambient 6.6 '8mM Na phosphate' ? K 3 303 ambient 6.6 '8mM Na phosphate' ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 1 2 '2D NOESY' 3 2 2 '2D NOESY' 4 2 3 '2D NOESY' # _pdbx_nmr_refine.entry_id 1FQZ _pdbx_nmr_refine.method ;Using a motif-based approach, a model was constructed from X-ray and NMR structures of 6 known RNA motifs: (i) double helix, (ii) sheared G.A base pair, (iii) eukaryotic loop E motif, (iv) S-turn, (v) trans Wobble G.U pair, (vi) U-turn. The resulting energy minimized model was then validated by comparing it with the NOESY data. ; _pdbx_nmr_refine.details ;Motifs (i) to (vi) were obtained from the following sources: (i) idealized A-form coordinates (InsightII, MSI); (ii)&(iii) PDB 430D.pdb; (iv) PDB 1ETG.pdb; (vi) PDB 1QA6.pdb; Motif (v) was constructed manually. ; _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal XwinNMR 2.5 collection Bruker 1 NMRPipe 1.7 processing Delaglio 2 Sparky 3.66 'data analysis' 'Goddard & Kneller' 3 CHARMM 25.2 refinement 'Brooks et al.' 4 'Insight II' 97.0 refinement MSI 5 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1FQZ 'double helix' 1FQZ 'a-form double helix' 1FQZ 'bulge loop' 1FQZ 'mismatched base pair' 1FQZ 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 27 1_555 -1.132 -0.210 0.013 9.480 -2.036 -7.037 1 A_G1:C27_A A 1 ? A 27 ? 19 1 1 A C 2 1_555 A G 26 1_555 1.244 -0.167 -0.332 9.805 -12.096 0.268 2 A_C2:G26_A A 2 ? A 26 ? 19 1 1 A C 3 1_555 A G 25 1_555 1.083 -0.236 -0.282 -3.774 -12.708 -1.699 3 A_C3:G25_A A 3 ? A 25 ? 19 1 1 A G 4 1_555 A A 24 1_555 7.022 -4.575 0.002 -2.074 -8.198 -7.827 4 A_G4:A24_A A 4 ? A 24 ? 11 10 1 A A 5 1_555 A A 23 1_555 -6.412 5.484 0.007 -15.371 2.911 -174.790 5 A_A5:A23_A A 5 ? A 23 ? 2 8 1 A U 7 1_555 A A 22 1_555 4.142 -1.338 -1.508 15.454 -30.792 -105.743 6 A_U7:A22_A A 7 ? A 22 ? 24 4 1 A A 8 1_555 A G 21 1_555 -7.026 -4.316 -0.355 -3.784 3.136 -6.783 7 A_A8:G21_A A 8 ? A 21 ? 11 10 1 A G 9 1_555 A C 20 1_555 -0.763 -0.109 -0.467 -3.117 -5.484 -5.884 8 A_G9:C20_A A 9 ? A 20 ? 19 1 1 A U 10 1_555 A G 19 1_555 1.828 -0.398 -0.089 -6.290 -4.434 -12.489 9 A_U10:G19_A A 10 ? A 19 ? 28 ? 1 A G 11 1_555 A C 18 1_555 -0.368 -0.106 0.403 -4.069 -11.327 -11.009 10 A_G11:C18_A A 11 ? A 18 ? 19 1 1 A U 12 1_555 A G 16 1_555 -0.270 1.318 -0.150 -13.522 -1.044 -159.547 11 A_U12:G16_A A 12 ? A 16 ? 27 ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 27 1_555 A C 2 1_555 A G 26 1_555 0.199 -1.311 3.233 1.594 3.143 44.167 -2.024 -0.119 3.142 4.172 -2.116 44.301 1 AA_G1C2:G26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A C 2 1_555 A G 26 1_555 A C 3 1_555 A G 25 1_555 0.155 -1.911 3.503 2.973 9.141 31.141 -4.992 0.238 2.845 16.539 -5.379 32.555 2 AA_C2C3:G25G26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A C 3 1_555 A G 25 1_555 A G 4 1_555 A A 24 1_555 -0.195 -1.348 3.404 6.120 6.814 59.121 -1.699 0.507 3.213 6.860 -6.162 59.763 3 AA_C3G4:A24G25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A G 4 1_555 A A 24 1_555 A A 5 1_555 A A 23 1_555 -3.624 0.114 0.704 90.924 150.507 140.985 0.000 1.847 0.070 75.356 -45.524 178.611 4 AA_G4A5:A23A24_AA A 4 ? A 24 ? A 5 ? A 23 ? 1 A A 5 1_555 A A 23 1_555 A U 7 1_555 A A 22 1_555 2.589 -1.560 0.851 113.725 127.759 -126.399 0.660 1.403 0.510 -64.238 57.181 -175.965 5 AA_A5U7:A22A23_AA A 5 ? A 23 ? A 7 ? A 22 ? 1 A U 7 1_555 A A 22 1_555 A A 8 1_555 A G 21 1_555 5.559 -0.998 3.758 -0.340 2.515 -6.052 -5.016 46.706 4.136 -22.556 -3.054 -6.562 6 AA_U7A8:G21A22_AA A 7 ? A 22 ? A 8 ? A 21 ? 1 A A 8 1_555 A G 21 1_555 A G 9 1_555 A C 20 1_555 0.257 -1.310 3.427 -2.454 4.884 62.109 -1.496 -0.364 3.315 4.724 2.373 62.325 7 AA_A8G9:C20G21_AA A 8 ? A 21 ? A 9 ? A 20 ? 1 A G 9 1_555 A C 20 1_555 A U 10 1_555 A G 19 1_555 -0.442 -1.696 3.372 -1.144 3.868 41.294 -2.811 0.501 3.218 5.469 1.618 41.482 8 AA_G9U10:G19C20_AA A 9 ? A 20 ? A 10 ? A 19 ? 1 A U 10 1_555 A G 19 1_555 A G 11 1_555 A C 18 1_555 0.120 -1.790 3.173 0.807 3.365 26.571 -4.678 -0.063 2.930 7.282 -1.747 26.791 9 AA_U10G11:C18G19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A G 11 1_555 A C 18 1_555 A U 12 1_555 A G 16 1_555 -1.175 -0.483 3.206 4.742 -3.830 92.788 -0.263 0.897 3.171 -2.642 -3.272 92.942 10 AA_G11U12:G16C18_AA A 11 ? A 18 ? A 12 ? A 16 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Bruker DRX 500 2 ? Bruker DMX 600 # _atom_sites.entry_id 1FQZ _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_