data_1FYP # _entry.id 1FYP # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1FYP pdb_00001fyp 10.2210/pdb1fyp/pdb RCSB RCSB012022 ? ? WWPDB D_1000012022 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2001-03-14 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 4 'Structure model' 'Structure summary' 7 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp 2 4 'Structure model' database_2 3 4 'Structure model' pdbx_nmr_software 4 4 'Structure model' pdbx_struct_assembly 5 4 'Structure model' pdbx_struct_oper_list 6 4 'Structure model' struct_site 7 5 'Structure model' chem_comp_atom 8 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_chem_comp.pdbx_synonyms' 2 4 'Structure model' '_database_2.pdbx_DOI' 3 4 'Structure model' '_database_2.pdbx_database_accession' 4 4 'Structure model' '_pdbx_nmr_software.name' 5 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 6 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 7 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1FYP _pdbx_database_status.recvd_initial_deposition_date 2000-10-02 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1FYO 'Eukaryotic decoding region A-site RNA, free in solution' unspecified PDB 1PBR 'Prokaryotic decoding region A-site RNA, bound to paromomycin' unspecified PDB 1A3M 'Prokaryotic decoding region A-site RNA, free in solution' unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lynch, S.R.' 1 'Puglisi, J.D.' 2 # _citation.id primary _citation.title 'Structural origins of aminoglycoside specificity for prokaryotic ribosomes.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 306 _citation.page_first 1037 _citation.page_last 1058 _citation.year 2001 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11237617 _citation.pdbx_database_id_DOI 10.1006/jmbi.2000.4420 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lynch, S.R.' 1 ? primary 'Puglisi, J.D.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'FRAGMENT OF 18S RIBOSOMAL RNA' 8672.185 1 ? 'U1410A, A1490U' '18S RNA - NUCLEOTIDES 1404-1412, 1488-1497 (E. COLI NUMBERING)' 'EUKARYOTIC DECODING REGION A-SITE RNA' 2 non-polymer syn PAROMOMYCIN 615.628 1 ? ? PAROMOMYCIN ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCGUCGCACCUUCGGGUGAAGUCGCC _entity_poly.pdbx_seq_one_letter_code_can GGCGUCGCACCUUCGGGUGAAGUCGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name PAROMOMYCIN _pdbx_entity_nonpoly.comp_id PAR # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 C n 1 7 G n 1 8 C n 1 9 A n 1 10 C n 1 11 C n 1 12 U n 1 13 U n 1 14 C n 1 15 G n 1 16 G n 1 17 G n 1 18 U n 1 19 G n 1 20 A n 1 21 A n 1 22 G n 1 23 U n 1 24 C n 1 25 G n 1 26 C n 1 27 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'This sequence of 18S RNA occurs in Tetrahymena thermophila' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 PAR non-polymer . PAROMOMYCIN 'PAROMOMYCIN I; AMMINOSIDIN; CATENULIN; CRESTOMYCIN; MONOMYCIN A; NEOMYCIN E' 'C23 H45 N5 O14' 615.628 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 G 7 7 7 G G A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 U 12 12 12 U U A . n A 1 13 U 13 13 13 U U A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 G 25 25 25 G G A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id PAR _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 28 _pdbx_nonpoly_scheme.auth_seq_num 28 _pdbx_nonpoly_scheme.pdb_mon_id PAR _pdbx_nonpoly_scheme.auth_mon_id PAR _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _cell.entry_id 1FYP _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1FYP _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1FYP _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 1FYP _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1FYP _struct.title 'EUKARYOTIC DECODING REGION A-SITE RNA-PAROMOMYCIN COMPLEX' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1FYP _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA-paromomycin complex, aminoglycoside, stem-internal loop-stem-tetraloop, RNA-drug, G-A base pair, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1FYP _struct_ref.pdbx_db_accession 1FYP _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1FYP _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1FYP _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 3 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 4 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 4 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 4 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 6 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 6 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 6 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 7 N1 ? ? ? 1_555 A A 21 N1 ? ? A G 7 A A 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog17 hydrog ? ? A G 7 O6 ? ? ? 1_555 A A 21 N6 ? ? A G 7 A A 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 8 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 8 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 8 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A A 20 N6 ? ? A C 8 A A 20 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog22 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 18 N3 ? ? A A 9 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 18 O4 ? ? A A 9 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 10 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 10 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 10 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 12 O2 ? ? ? 1_555 A G 15 N1 ? ? A U 12 A G 15 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id PAR _struct_site.pdbx_auth_seq_id 28 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 13 _struct_site.details 'BINDING SITE FOR RESIDUE PAR A 28' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 13 G A 2 ? G A 2 . ? 1_555 ? 2 AC1 13 C A 3 ? C A 3 . ? 1_555 ? 3 AC1 13 G A 4 ? G A 4 . ? 1_555 ? 4 AC1 13 U A 5 ? U A 5 . ? 1_555 ? 5 AC1 13 C A 6 ? C A 6 . ? 1_555 ? 6 AC1 13 G A 7 ? G A 7 . ? 1_555 ? 7 AC1 13 G A 17 ? G A 17 . ? 1_555 ? 8 AC1 13 U A 18 ? U A 18 . ? 1_555 ? 9 AC1 13 G A 19 ? G A 19 . ? 1_555 ? 10 AC1 13 A A 20 ? A A 20 . ? 1_555 ? 11 AC1 13 A A 21 ? A A 21 . ? 1_555 ? 12 AC1 13 G A 22 ? G A 22 . ? 1_555 ? 13 AC1 13 U A 23 ? U A 23 . ? 1_555 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 17 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.57 2 28 "HO2'" A A 20 ? ? "O4'" A A 21 ? ? 1.53 # _pdbx_nmr_ensemble.entry_id 1FYP _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 29 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations,structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1FYP _pdbx_nmr_representative.conformer_id 11 _pdbx_nmr_representative.selection_criteria ? # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '3 mM RNA, 3 mM paromomycin, 10 mM Naphosphate, pH 6.3, 13C/15N RNA' _pdbx_nmr_sample_details.solvent_system '10% D2O/ 90% H2O; 100% D2O' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 308 _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.3 _pdbx_nmr_exptl_sample_conditions.ionic_strength '10 mM' _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 DQF-COSY 2 1 1 3D_15N-separated_NOESY 3 1 1 3D_13C-separated_NOESY 4 1 1 '2D NOESY' # _pdbx_nmr_refine.entry_id 1FYP _pdbx_nmr_refine.method 'simulated annealing molecular dynamics' _pdbx_nmr_refine.details '605 NOEs, 122 dihedral constraints, and 36 hydrogen bonds' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal VNMR 6.1 collection ? 1 VNMR 6.1 processing ? 2 Felix 98 processing ? 3 X-PLOR 3.83 refinement Brunger 4 X-PLOR 3.83 'structure solution' Brunger 5 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 PAR C11 C N S 111 PAR O11 O N N 112 PAR C21 C N R 113 PAR N21 N N N 114 PAR C31 C N R 115 PAR O31 O N N 116 PAR C41 C N S 117 PAR O41 O N N 118 PAR C51 C N R 119 PAR O51 O N N 120 PAR C61 C N N 121 PAR O61 O N N 122 PAR C12 C N R 123 PAR N12 N N N 124 PAR C22 C N N 125 PAR C32 C N S 126 PAR N32 N N N 127 PAR C42 C N R 128 PAR C52 C N R 129 PAR O52 O N N 130 PAR C62 C N S 131 PAR O62 O N N 132 PAR C13 C N S 133 PAR C23 C N R 134 PAR O23 O N N 135 PAR C33 C N S 136 PAR O33 O N N 137 PAR C43 C N R 138 PAR O43 O N N 139 PAR C53 C N N 140 PAR O53 O N N 141 PAR C14 C N R 142 PAR C24 C N R 143 PAR N24 N N N 144 PAR C34 C N R 145 PAR O34 O N N 146 PAR C44 C N S 147 PAR O44 O N N 148 PAR C54 C N S 149 PAR O54 O N N 150 PAR C64 C N N 151 PAR N64 N N N 152 PAR H11 H N N 153 PAR H21 H N N 154 PAR HN21 H N N 155 PAR HN22 H N N 156 PAR H31 H N N 157 PAR HO31 H N N 158 PAR H41 H N N 159 PAR HO41 H N N 160 PAR H51 H N N 161 PAR H611 H N N 162 PAR H612 H N N 163 PAR HO61 H N N 164 PAR H12 H N N 165 PAR H121 H N N 166 PAR H122 H N N 167 PAR H221 H N N 168 PAR H222 H N N 169 PAR H32 H N N 170 PAR H321 H N N 171 PAR H322 H N N 172 PAR H42 H N N 173 PAR H52 H N N 174 PAR H62 H N N 175 PAR HO62 H N N 176 PAR H13 H N N 177 PAR H23 H N N 178 PAR HO23 H N N 179 PAR H33 H N N 180 PAR H43 H N N 181 PAR H531 H N N 182 PAR H532 H N N 183 PAR HO53 H N N 184 PAR H14 H N N 185 PAR H24 H N N 186 PAR H241 H N N 187 PAR H242 H N N 188 PAR H34 H N N 189 PAR HO34 H N N 190 PAR H44 H N N 191 PAR HO44 H N N 192 PAR H54 H N N 193 PAR H641 H N N 194 PAR H642 H N N 195 PAR HN61 H N N 196 PAR HN62 H N N 197 U OP3 O N N 198 U P P N N 199 U OP1 O N N 200 U OP2 O N N 201 U "O5'" O N N 202 U "C5'" C N N 203 U "C4'" C N R 204 U "O4'" O N N 205 U "C3'" C N S 206 U "O3'" O N N 207 U "C2'" C N R 208 U "O2'" O N N 209 U "C1'" C N R 210 U N1 N N N 211 U C2 C N N 212 U O2 O N N 213 U N3 N N N 214 U C4 C N N 215 U O4 O N N 216 U C5 C N N 217 U C6 C N N 218 U HOP3 H N N 219 U HOP2 H N N 220 U "H5'" H N N 221 U "H5''" H N N 222 U "H4'" H N N 223 U "H3'" H N N 224 U "HO3'" H N N 225 U "H2'" H N N 226 U "HO2'" H N N 227 U "H1'" H N N 228 U H3 H N N 229 U H5 H N N 230 U H6 H N N 231 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 PAR C11 O11 sing N N 116 PAR C11 C21 sing N N 117 PAR C11 O51 sing N N 118 PAR C11 H11 sing N N 119 PAR O11 C42 sing N N 120 PAR C21 N21 sing N N 121 PAR C21 C31 sing N N 122 PAR C21 H21 sing N N 123 PAR N21 HN21 sing N N 124 PAR N21 HN22 sing N N 125 PAR C31 O31 sing N N 126 PAR C31 C41 sing N N 127 PAR C31 H31 sing N N 128 PAR O31 HO31 sing N N 129 PAR C41 O41 sing N N 130 PAR C41 C51 sing N N 131 PAR C41 H41 sing N N 132 PAR O41 HO41 sing N N 133 PAR C51 O51 sing N N 134 PAR C51 C61 sing N N 135 PAR C51 H51 sing N N 136 PAR C61 O61 sing N N 137 PAR C61 H611 sing N N 138 PAR C61 H612 sing N N 139 PAR O61 HO61 sing N N 140 PAR C12 N12 sing N N 141 PAR C12 C22 sing N N 142 PAR C12 C62 sing N N 143 PAR C12 H12 sing N N 144 PAR N12 H121 sing N N 145 PAR N12 H122 sing N N 146 PAR C22 C32 sing N N 147 PAR C22 H221 sing N N 148 PAR C22 H222 sing N N 149 PAR C32 N32 sing N N 150 PAR C32 C42 sing N N 151 PAR C32 H32 sing N N 152 PAR N32 H321 sing N N 153 PAR N32 H322 sing N N 154 PAR C42 C52 sing N N 155 PAR C42 H42 sing N N 156 PAR C52 O52 sing N N 157 PAR C52 C62 sing N N 158 PAR C52 H52 sing N N 159 PAR O52 C13 sing N N 160 PAR C62 O62 sing N N 161 PAR C62 H62 sing N N 162 PAR O62 HO62 sing N N 163 PAR C13 C23 sing N N 164 PAR C13 O43 sing N N 165 PAR C13 H13 sing N N 166 PAR C23 O23 sing N N 167 PAR C23 C33 sing N N 168 PAR C23 H23 sing N N 169 PAR O23 HO23 sing N N 170 PAR C33 O33 sing N N 171 PAR C33 C43 sing N N 172 PAR C33 H33 sing N N 173 PAR O33 C14 sing N N 174 PAR C43 O43 sing N N 175 PAR C43 C53 sing N N 176 PAR C43 H43 sing N N 177 PAR C53 O53 sing N N 178 PAR C53 H531 sing N N 179 PAR C53 H532 sing N N 180 PAR O53 HO53 sing N N 181 PAR C14 C24 sing N N 182 PAR C14 O54 sing N N 183 PAR C14 H14 sing N N 184 PAR C24 N24 sing N N 185 PAR C24 C34 sing N N 186 PAR C24 H24 sing N N 187 PAR N24 H241 sing N N 188 PAR N24 H242 sing N N 189 PAR C34 O34 sing N N 190 PAR C34 C44 sing N N 191 PAR C34 H34 sing N N 192 PAR O34 HO34 sing N N 193 PAR C44 O44 sing N N 194 PAR C44 C54 sing N N 195 PAR C44 H44 sing N N 196 PAR O44 HO44 sing N N 197 PAR C54 O54 sing N N 198 PAR C54 C64 sing N N 199 PAR C54 H54 sing N N 200 PAR C64 N64 sing N N 201 PAR C64 H641 sing N N 202 PAR C64 H642 sing N N 203 PAR N64 HN61 sing N N 204 PAR N64 HN62 sing N N 205 U OP3 P sing N N 206 U OP3 HOP3 sing N N 207 U P OP1 doub N N 208 U P OP2 sing N N 209 U P "O5'" sing N N 210 U OP2 HOP2 sing N N 211 U "O5'" "C5'" sing N N 212 U "C5'" "C4'" sing N N 213 U "C5'" "H5'" sing N N 214 U "C5'" "H5''" sing N N 215 U "C4'" "O4'" sing N N 216 U "C4'" "C3'" sing N N 217 U "C4'" "H4'" sing N N 218 U "O4'" "C1'" sing N N 219 U "C3'" "O3'" sing N N 220 U "C3'" "C2'" sing N N 221 U "C3'" "H3'" sing N N 222 U "O3'" "HO3'" sing N N 223 U "C2'" "O2'" sing N N 224 U "C2'" "C1'" sing N N 225 U "C2'" "H2'" sing N N 226 U "O2'" "HO2'" sing N N 227 U "C1'" N1 sing N N 228 U "C1'" "H1'" sing N N 229 U N1 C2 sing N N 230 U N1 C6 sing N N 231 U C2 O2 doub N N 232 U C2 N3 sing N N 233 U N3 C4 sing N N 234 U N3 H3 sing N N 235 U C4 O4 doub N N 236 U C4 C5 sing N N 237 U C5 C6 doub N N 238 U C5 H5 sing N N 239 U C6 H6 sing N N 240 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1FYP 'double helix' 1FYP 'a-form double helix' 1FYP 'mismatched base pair' 1FYP 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 27 1_555 -0.286 -0.222 -0.060 3.247 -22.660 -1.816 1 A_G1:C27_A A 1 ? A 27 ? 19 1 1 A G 2 1_555 A C 26 1_555 -0.425 -0.313 0.021 -0.640 -10.567 -4.658 2 A_G2:C26_A A 2 ? A 26 ? 19 1 1 A C 3 1_555 A G 25 1_555 0.566 -0.333 -0.058 9.244 -19.296 -1.687 3 A_C3:G25_A A 3 ? A 25 ? 19 1 1 A G 4 1_555 A C 24 1_555 -0.238 -0.273 -0.036 -21.306 -37.146 -5.591 4 A_G4:C24_A A 4 ? A 24 ? 19 1 1 A C 6 1_555 A G 22 1_555 0.425 -0.330 -0.068 -16.032 -20.148 0.561 5 A_C6:G22_A A 6 ? A 22 ? 19 1 1 A G 7 1_555 A A 21 1_555 0.471 1.277 0.932 -19.146 -0.306 -11.700 6 A_G7:A21_A A 7 ? A 21 ? 8 1 1 A C 8 1_555 A G 19 1_555 0.191 -0.293 0.574 1.833 -20.512 -10.312 7 A_C8:G19_A A 8 ? A 19 ? 19 1 1 A A 9 1_555 A U 18 1_555 0.151 -0.243 0.252 -1.868 -31.325 -11.460 8 A_A9:U18_A A 9 ? A 18 ? 20 1 1 A C 10 1_555 A G 17 1_555 0.092 -0.152 0.103 1.317 -15.274 -3.410 9 A_C10:G17_A A 10 ? A 17 ? 19 1 1 A C 11 1_555 A G 16 1_555 0.474 -0.312 -0.309 8.426 -11.329 -2.421 10 A_C11:G16_A A 11 ? A 16 ? 19 1 1 A U 12 1_555 A G 15 1_555 1.853 -4.892 0.947 -12.693 -32.331 -79.759 11 A_U12:G15_A A 12 ? A 15 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 27 1_555 A G 2 1_555 A C 26 1_555 -1.701 -0.939 2.852 -10.776 12.027 41.902 -2.219 1.349 2.827 16.117 14.440 44.775 1 AA_G1G2:C26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A G 2 1_555 A C 26 1_555 A C 3 1_555 A G 25 1_555 0.281 -1.006 2.856 0.508 3.993 36.492 -2.066 -0.387 2.738 6.352 -0.808 36.706 2 AA_G2C3:G25C26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A C 3 1_555 A G 25 1_555 A G 4 1_555 A C 24 1_555 0.591 -1.263 3.454 5.126 25.259 41.740 -3.418 -0.333 2.416 32.056 -6.505 48.752 3 AA_C3G4:C24G25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A G 4 1_555 A C 24 1_555 A C 6 1_555 A G 22 1_555 -0.827 -2.167 5.563 -0.999 11.653 63.989 -2.824 0.701 5.154 10.901 0.934 64.938 4 AA_G4C6:G22C24_AA A 4 ? A 24 ? A 6 ? A 22 ? 1 A C 6 1_555 A G 22 1_555 A G 7 1_555 A A 21 1_555 0.813 -1.356 2.828 -0.293 10.532 30.080 -4.005 -1.525 2.230 19.554 0.544 31.831 5 AA_C6G7:A21G22_AA A 6 ? A 22 ? A 7 ? A 21 ? 1 A G 7 1_555 A A 21 1_555 A C 8 1_555 A G 19 1_555 1.325 -1.516 3.799 -16.478 16.928 49.043 -2.753 -2.514 2.643 19.163 18.653 54.117 6 AA_G7C8:G19A21_AA A 7 ? A 21 ? A 8 ? A 19 ? 1 A C 8 1_555 A G 19 1_555 A A 9 1_555 A U 18 1_555 -0.166 -1.037 3.004 1.557 13.990 37.127 -2.946 0.403 2.462 21.066 -2.344 39.618 7 AA_C8A9:U18G19_AA A 8 ? A 19 ? A 9 ? A 18 ? 1 A A 9 1_555 A U 18 1_555 A C 10 1_555 A G 17 1_555 0.886 -0.975 3.020 1.031 -3.386 37.082 -1.104 -1.258 3.116 -5.310 -1.616 37.244 8 AA_A9C10:G17U18_AA A 9 ? A 18 ? A 10 ? A 17 ? 1 A C 10 1_555 A G 17 1_555 A C 11 1_555 A G 16 1_555 -0.343 -1.036 2.930 2.117 6.610 31.195 -2.914 0.954 2.632 12.105 -3.877 31.939 9 AA_C10C11:G16G17_AA A 10 ? A 17 ? A 11 ? A 16 ? 1 A C 11 1_555 A G 16 1_555 A U 12 1_555 A G 15 1_555 0.606 -0.814 2.938 9.033 15.309 100.247 -0.733 -0.269 2.864 9.919 -5.853 101.392 10 AA_C11U12:G15G16_AA A 11 ? A 16 ? A 12 ? A 15 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Varian INOVA 500 2 ? Varian INOVA 800 # _atom_sites.entry_id 1FYP _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_