data_1HWQ # _entry.id 1HWQ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1HWQ pdb_00001hwq 10.2210/pdb1hwq/pdb RCSB RCSB012636 ? ? WWPDB D_1000012636 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2001-05-16 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1HWQ _pdbx_database_status.recvd_initial_deposition_date 2001-01-09 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Flinders, J.C.' 1 'Dieckmann, T.' 2 # _citation.id primary _citation.title 'A pH controlled conformational switch in the cleavage site of the VS ribozyme substrate RNA.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 308 _citation.page_first 665 _citation.page_last 679 _citation.year 2001 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11350168 _citation.pdbx_database_id_DOI 10.1006/jmbi.2001.4627 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Flinders, J.' 1 ? primary 'Dieckmann, T.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'VS RIBOZYME SUBSTRATE RNA' _entity.formula_weight 9705.832 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUGCGAAGGGCGUCGUCGCCCCGAGCGCC _entity_poly.pdbx_seq_one_letter_code_can GGUGCGAAGGGCGUCGUCGCCCCGAGCGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 G n 1 5 C n 1 6 G n 1 7 A n 1 8 A n 1 9 G n 1 10 G n 1 11 G n 1 12 C n 1 13 G n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 C n 1 19 G n 1 20 C n 1 21 C n 1 22 C n 1 23 C n 1 24 G n 1 25 A n 1 26 G n 1 27 C n 1 28 G n 1 29 C n 1 30 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'RNA samples were transcribed from synthetic DNA templates using T7 RNA polymerase.' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 G 4 4 4 G G A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 A 7 7 7 A A A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 C 23 23 23 C C A . n A 1 24 G 24 24 24 G G A . n A 1 25 A 25 25 25 A A A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n A 1 28 G 28 28 28 G G A . n A 1 29 C 29 29 29 C C A . n A 1 30 C 30 30 30 C C A . n # _cell.entry_id 1HWQ _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1HWQ _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1HWQ _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 1HWQ _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1HWQ _struct.title 'SOLUTION STRUCTURE OF THE VS RIBOZYME SUBSTRATE STEM-LOOP' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1HWQ _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'VS RIBOZYME, STEM-LOOP, TANDEM GA, PROTONATED ADENINE, A+C BASE PAIR, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1HWQ _struct_ref.pdbx_db_accession 1HWQ _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1HWQ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 30 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1HWQ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 30 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 30 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 1 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 1 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 1 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 2 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 2 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 2 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A G 28 O6 ? ? A U 3 A G 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog8 hydrog ? ? A U 3 O2 ? ? ? 1_555 A G 28 N1 ? ? A U 3 A G 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 4 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 4 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 4 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 5 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 5 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 5 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A A 25 N7 ? ? A G 6 A A 25 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog16 hydrog ? ? A G 6 N3 ? ? ? 1_555 A A 25 N6 ? ? A G 6 A A 25 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog17 hydrog ? ? A A 7 N6 ? ? ? 1_555 A G 24 N3 ? ? A A 7 A G 24 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A A 7 N7 ? ? ? 1_555 A G 24 N2 ? ? A A 7 A G 24 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A A 8 N6 ? ? ? 1_555 A C 23 O2 ? ? A A 8 A C 23 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog20 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 9 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 9 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 9 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 10 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 10 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 10 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H61 A A 8 ? ? O2 A C 23 ? ? 1.34 2 1 "HO2'" A C 22 ? ? "O5'" A C 23 ? ? 1.43 3 1 "HO2'" A G 13 ? ? "O5'" A U 14 ? ? 1.44 4 1 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.47 5 1 "HO2'" A U 14 ? ? "O5'" A C 15 ? ? 1.50 6 1 N3 A C 12 ? ? H21 A G 19 ? ? 1.53 7 2 "HO2'" A G 9 ? ? "O5'" A G 10 ? ? 1.35 8 2 H61 A A 8 ? ? O2 A C 23 ? ? 1.36 9 2 "HO2'" A G 26 ? ? "O5'" A C 27 ? ? 1.48 10 2 "O2'" A G 6 ? ? H61 A A 25 ? ? 1.53 11 2 "H2'" A C 15 ? ? "O4'" A U 17 ? ? 1.56 12 2 H21 A G 4 ? ? N3 A C 27 ? ? 1.58 13 2 "H2'" A C 5 ? ? "O4'" A G 6 ? ? 1.60 14 3 "HO2'" A U 17 ? ? "O5'" A C 18 ? ? 1.36 15 3 H61 A A 8 ? ? O2 A C 23 ? ? 1.38 16 3 "HO2'" A U 14 ? ? O2 A C 15 ? ? 1.51 17 3 N3 A C 12 ? ? H21 A G 19 ? ? 1.51 18 3 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.52 19 4 H61 A A 8 ? ? O2 A C 23 ? ? 1.32 20 4 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.46 21 4 O2 A U 17 ? ? "H2'" A C 18 ? ? 1.48 22 4 "HO2'" A C 23 ? ? "O5'" A G 24 ? ? 1.52 23 4 "O3'" A C 15 ? ? H8 A G 16 ? ? 1.58 24 5 H61 A A 8 ? ? O2 A C 23 ? ? 1.34 25 5 "HO2'" A U 14 ? ? O2 A C 15 ? ? 1.43 26 5 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.49 27 5 N3 A C 12 ? ? H21 A G 19 ? ? 1.52 28 5 "O2'" A G 9 ? ? "H5'" A G 10 ? ? 1.54 29 5 "HO2'" A C 23 ? ? "O5'" A G 24 ? ? 1.56 30 6 H61 A A 8 ? ? O2 A C 23 ? ? 1.31 31 6 "HO2'" A G 6 ? ? "O5'" A A 7 ? ? 1.43 32 6 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.50 33 6 "O2'" A U 17 ? ? H8 A G 19 ? ? 1.53 34 6 "HO2'" A G 13 ? ? "O5'" A U 14 ? ? 1.54 35 6 "HO2'" A G 26 ? ? "O5'" A C 27 ? ? 1.57 36 6 "HO2'" A C 5 ? ? "O5'" A G 6 ? ? 1.57 37 6 N3 A C 12 ? ? H21 A G 19 ? ? 1.58 38 6 "O2'" A U 17 ? ? "H3'" A C 18 ? ? 1.59 39 6 H21 A G 4 ? ? N3 A C 27 ? ? 1.59 40 7 H61 A A 8 ? ? O2 A C 23 ? ? 1.37 41 7 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.55 42 7 N3 A C 12 ? ? H21 A G 19 ? ? 1.58 43 8 H61 A A 8 ? ? O2 A C 23 ? ? 1.38 44 8 "HO2'" A C 15 ? ? "O5'" A G 16 ? ? 1.39 45 8 "O2'" A C 15 ? ? "H3'" A G 16 ? ? 1.44 46 8 "O2'" A C 18 ? ? H8 A G 19 ? ? 1.57 47 9 "HO2'" A G 6 ? ? "O5'" A A 7 ? ? 1.31 48 9 H61 A A 8 ? ? O2 A C 23 ? ? 1.34 49 9 "HO2'" A U 17 ? ? "O5'" A C 18 ? ? 1.39 50 9 "HO2'" A U 14 ? ? O2 A C 15 ? ? 1.40 51 9 N3 A C 12 ? ? H21 A G 19 ? ? 1.51 52 9 "HO2'" A G 26 ? ? "O5'" A C 27 ? ? 1.58 53 9 H21 A G 4 ? ? N3 A C 27 ? ? 1.59 54 10 H61 A A 8 ? ? O2 A C 23 ? ? 1.33 55 10 "H2'" A A 7 ? ? "O4'" A A 8 ? ? 1.57 56 10 H21 A G 4 ? ? N3 A C 27 ? ? 1.57 57 10 N3 A C 12 ? ? H21 A G 19 ? ? 1.60 58 11 H61 A A 8 ? ? O2 A C 23 ? ? 1.30 59 11 "H1'" A U 17 ? ? "O5'" A C 18 ? ? 1.56 60 11 "HO2'" A G 26 ? ? "O5'" A C 27 ? ? 1.59 61 12 H61 A A 8 ? ? O2 A C 23 ? ? 1.32 62 12 "HO2'" A U 14 ? ? O2 A C 15 ? ? 1.36 63 12 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.48 64 12 N3 A C 12 ? ? H21 A G 19 ? ? 1.51 65 13 H61 A A 8 ? ? O2 A C 23 ? ? 1.29 66 13 O2 A U 17 ? ? "H2'" A C 18 ? ? 1.39 67 13 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.55 68 13 N3 A C 12 ? ? H21 A G 19 ? ? 1.58 69 14 "HO2'" A U 17 ? ? "O5'" A C 18 ? ? 1.33 70 14 H61 A A 8 ? ? O2 A C 23 ? ? 1.36 71 14 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.52 72 14 N3 A C 12 ? ? H21 A G 19 ? ? 1.52 73 15 "HO2'" A U 14 ? ? N3 A C 15 ? ? 1.32 74 15 H61 A A 8 ? ? O2 A C 23 ? ? 1.33 75 15 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.50 76 15 N3 A C 12 ? ? H21 A G 19 ? ? 1.59 77 16 H61 A A 8 ? ? O2 A C 23 ? ? 1.34 78 16 "HO2'" A C 15 ? ? "O5'" A U 17 ? ? 1.54 79 16 "O2'" A C 15 ? ? H8 A G 16 ? ? 1.54 80 16 "O2'" A C 18 ? ? H8 A G 19 ? ? 1.56 81 17 H61 A A 8 ? ? O2 A C 23 ? ? 1.34 82 17 "HO2'" A U 17 ? ? "O5'" A C 18 ? ? 1.39 83 17 "O2'" A G 6 ? ? H61 A A 25 ? ? 1.48 84 17 N3 A C 12 ? ? H21 A G 19 ? ? 1.50 85 17 "HO2'" A C 23 ? ? "O5'" A G 24 ? ? 1.51 86 17 "HO2'" A G 13 ? ? "O5'" A U 14 ? ? 1.58 87 18 H61 A A 8 ? ? O2 A C 23 ? ? 1.36 88 18 "HO2'" A C 15 ? ? "O5'" A U 17 ? ? 1.41 89 18 "O2'" A C 18 ? ? H8 A G 19 ? ? 1.44 90 18 "O2'" A C 15 ? ? H8 A G 16 ? ? 1.52 91 18 H21 A G 4 ? ? N3 A C 27 ? ? 1.58 92 19 H61 A A 8 ? ? O2 A C 23 ? ? 1.32 93 19 "O2'" A C 18 ? ? "H5'" A G 19 ? ? 1.51 94 20 H61 A A 8 ? ? O2 A C 23 ? ? 1.34 95 20 "HO2'" A G 9 ? ? "O5'" A G 10 ? ? 1.48 96 20 "O2'" A U 17 ? ? "H2'" A C 18 ? ? 1.52 # _pdbx_nmr_ensemble.entry_id 1HWQ _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1HWQ _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '1.5 mM VS RNA' '90% H2O/10% D2O' 2 '1.5 mM VS RNA' '100% D2O' 3 '1.5 mM VS RNA, 13C, 15N labeled' '100% D2O' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 274 ambient 6.0 '5 mM NaCl' ? K 2 298 ambient 6.0 '5 mM NaCl' ? K 3 298 ambient 6.0 '5 mM NaCl' ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 2 2 '2D NOESY' 3 3 3 3D_13C-separated_NOESY 4 2 2 DQF-COSY # _pdbx_nmr_refine.entry_id 1HWQ _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ;These structures were calculated using a total of 568 restraints; including 335 NOE-derived distance constraints, 158 dihedral angle restraints, 12 planarity restraints, and 63 H-bond distance restraints. ; _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal XwinNMR 2.6 collection Bruker 1 XwinNMR 2.6 processing Bruker 2 XEASY 1.3.13 'data analysis' 'Bartels, C.' 3 CNS 1.0 'structure solution' 'Brunger, A.' 4 CNS 1.0 refinement 'Brunger, A.' 5 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1HWQ 'double helix' 1HWQ 'a-form double helix' 1HWQ 'hairpin loop' 1HWQ 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 30 1_555 0.931 -0.417 0.171 -3.603 -2.478 -0.955 1 A_G1:C30_A A 1 ? A 30 ? 19 1 1 A G 2 1_555 A C 29 1_555 0.924 -0.399 -0.120 1.655 1.358 -0.569 2 A_G2:C29_A A 2 ? A 29 ? 19 1 1 A U 3 1_555 A G 28 1_555 1.763 -0.319 0.037 -0.993 -2.897 5.308 3 A_U3:G28_A A 3 ? A 28 ? 28 1 1 A G 4 1_555 A C 27 1_555 0.950 -0.418 -0.185 1.854 -2.907 -0.174 4 A_G4:C27_A A 4 ? A 27 ? 19 1 1 A C 5 1_555 A G 26 1_555 -0.991 -0.449 -0.337 -1.049 -1.542 -2.344 5 A_C5:G26_A A 5 ? A 26 ? 19 1 1 A G 6 1_555 A A 25 1_555 6.568 -4.591 -0.095 3.555 -7.882 1.047 6 A_G6:A25_A A 6 ? A 25 ? 11 6 1 A A 7 1_555 A G 24 1_555 -6.657 -4.215 0.009 1.164 0.770 2.015 7 A_A7:G24_A A 7 ? A 24 ? 11 9 1 A A 8 1_555 A C 23 1_555 -3.775 -1.348 0.067 -0.703 1.155 -8.616 8 A_A8:C23_A A 8 ? A 23 ? ? 1 1 A G 9 1_555 A C 22 1_555 0.875 -0.410 -0.079 -5.171 -3.057 -1.644 9 A_G9:C22_A A 9 ? A 22 ? 19 1 1 A G 10 1_555 A C 21 1_555 0.908 -0.404 -0.110 3.300 0.485 -1.279 10 A_G10:C21_A A 10 ? A 21 ? 19 1 1 A G 11 1_555 A C 20 1_555 0.938 -0.481 -0.373 2.930 -0.808 0.484 11 A_G11:C20_A A 11 ? A 20 ? 19 1 1 A C 12 1_555 A G 19 1_555 -1.280 -0.646 -0.925 -1.073 4.352 -1.808 12 A_C12:G19_A A 12 ? A 19 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 30 1_555 A G 2 1_555 A C 29 1_555 0.504 -0.478 3.887 0.344 17.464 26.699 -4.558 -0.847 3.022 33.631 -0.662 31.818 1 AA_G1G2:C29C30_AA A 1 ? A 30 ? A 2 ? A 29 ? 1 A G 2 1_555 A C 29 1_555 A U 3 1_555 A G 28 1_555 1.033 -0.423 3.475 5.366 24.922 36.447 -3.030 -0.840 2.778 35.076 -7.553 44.228 2 AA_G2U3:G28C29_AA A 2 ? A 29 ? A 3 ? A 28 ? 1 A U 3 1_555 A G 28 1_555 A G 4 1_555 A C 27 1_555 -0.249 -0.884 3.121 5.061 19.714 25.153 -4.624 1.227 1.877 38.262 -9.822 32.253 3 AA_U3G4:C27G28_AA A 3 ? A 28 ? A 4 ? A 27 ? 1 A G 4 1_555 A C 27 1_555 A C 5 1_555 A G 26 1_555 1.155 -1.483 3.157 3.667 15.462 27.105 -5.293 -1.534 2.154 29.948 -7.103 31.344 4 AA_G4C5:G26C27_AA A 4 ? A 27 ? A 5 ? A 26 ? 1 A C 5 1_555 A G 26 1_555 A G 6 1_555 A A 25 1_555 0.577 0.313 3.647 -1.006 -10.590 69.466 0.688 -0.541 3.567 -9.238 0.877 70.174 5 AA_C5G6:A25G26_AA A 5 ? A 26 ? A 6 ? A 25 ? 1 A G 6 1_555 A A 25 1_555 A A 7 1_555 A G 24 1_555 1.600 -1.386 3.215 6.307 -0.102 -19.211 3.993 7.164 2.556 0.296 18.271 -20.210 6 AA_G6A7:G24A25_AA A 6 ? A 25 ? A 7 ? A 24 ? 1 A A 7 1_555 A G 24 1_555 A A 8 1_555 A C 23 1_555 0.034 -1.248 4.014 1.311 -8.973 45.214 -0.621 0.099 4.175 -11.534 -1.686 46.068 7 AA_A7A8:C23G24_AA A 7 ? A 24 ? A 8 ? A 23 ? 1 A A 8 1_555 A C 23 1_555 A G 9 1_555 A C 22 1_555 -0.491 -0.986 3.782 -0.182 -9.295 51.089 -0.388 0.547 3.896 -10.676 0.208 51.872 8 AA_A8G9:C22C23_AA A 8 ? A 23 ? A 9 ? A 22 ? 1 A G 9 1_555 A C 22 1_555 A G 10 1_555 A C 21 1_555 0.431 -1.195 3.142 -2.448 -1.973 30.675 -1.876 -1.271 3.167 -3.717 4.612 30.832 9 AA_G9G10:C21C22_AA A 9 ? A 22 ? A 10 ? A 21 ? 1 A G 10 1_555 A C 21 1_555 A G 11 1_555 A C 20 1_555 -0.489 -1.844 3.038 1.946 6.648 32.738 -4.161 1.129 2.592 11.633 -3.405 33.443 10 AA_G10G11:C20C21_AA A 10 ? A 21 ? A 11 ? A 20 ? 1 A G 11 1_555 A C 20 1_555 A C 12 1_555 A G 19 1_555 0.335 -2.000 3.252 3.169 -2.122 29.781 -3.416 0.019 3.400 -4.107 -6.133 30.019 11 AA_G11C12:G19C20_AA A 11 ? A 20 ? A 12 ? A 19 ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model DRX _pdbx_nmr_spectrometer.field_strength 600 # _atom_sites.entry_id 1HWQ _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_