data_1JU7 # _entry.id 1JU7 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1JU7 pdb_00001ju7 10.2210/pdb1ju7/pdb RCSB RCSB014190 ? ? WWPDB D_1000014190 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2002-03-20 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1JU7 _pdbx_database_status.recvd_initial_deposition_date 2001-08-23 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'DeJong, E.S.' 1 'Marzluff, W.F.' 2 'Nikonowicz, E.P.' 3 # _citation.id primary _citation.title 'NMR structure and dynamics of the RNA-binding site for the histone mRNA stem-loop binding protein.' _citation.journal_abbrev RNA _citation.journal_volume 8 _citation.page_first 83 _citation.page_last 96 _citation.year 2002 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11871662 _citation.pdbx_database_id_DOI 10.1017/S1355838202013869 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'DeJong, E.S.' 1 ? primary 'Marzluff, W.F.' 2 ? primary 'Nikonowicz, E.P.' 3 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-R(*GP*GP*CP*CP*AP*AP*AP*GP*GP*CP*CP*CP*UP*UP*UP*UP*CP*AP*GP*GP*GP*CP*CP*AP*CP*CP*CP*A)-3'" _entity.formula_weight 8928.382 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ;Histone mRNA 3' stem loop ; # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCCAAAGGCCCUUUUCAGGGCCACCCA _entity_poly.pdbx_seq_one_letter_code_can GGCCAAAGGCCCUUUUCAGGGCCACCCA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 C n 1 5 A n 1 6 A n 1 7 A n 1 8 G n 1 9 G n 1 10 C n 1 11 C n 1 12 C n 1 13 U n 1 14 U n 1 15 U n 1 16 U n 1 17 C n 1 18 A n 1 19 G n 1 20 G n 1 21 G n 1 22 C n 1 23 C n 1 24 A n 1 25 C n 1 26 C n 1 27 C n 1 28 A n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details ;This sequence occurs naturally at the 3' end of the replication-dependent histone mRNAs of vertebrates. This sequence corresponds to the mouse H4-12 gene. ; # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 -6 ? ? ? A . n A 1 2 G 2 -5 ? ? ? A . n A 1 3 C 3 -4 ? ? ? A . n A 1 4 C 4 -3 ? ? ? A . n A 1 5 A 5 -2 ? ? ? A . n A 1 6 A 6 -1 ? ? ? A . n A 1 7 A 7 0 ? ? ? A . n A 1 8 G 8 1 1 G G A . n A 1 9 G 9 2 2 G G A . n A 1 10 C 10 3 3 C C A . n A 1 11 C 11 4 4 C C A . n A 1 12 C 12 5 5 C C A . n A 1 13 U 13 6 6 U U A . n A 1 14 U 14 7 7 U U A . n A 1 15 U 15 8 8 U U A . n A 1 16 U 16 9 9 U U A . n A 1 17 C 17 10 10 C C A . n A 1 18 A 18 11 11 A A A . n A 1 19 G 19 12 12 G G A . n A 1 20 G 20 13 13 G G A . n A 1 21 G 21 14 14 G G A . n A 1 22 C 22 15 15 C C A . n A 1 23 C 23 16 16 C C A . n A 1 24 A 24 17 ? ? ? A . n A 1 25 C 25 18 ? ? ? A . n A 1 26 C 26 19 ? ? ? A . n A 1 27 C 27 20 ? ? ? A . n A 1 28 A 28 21 ? ? ? A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 1 ? P ? A G 8 P 2 1 Y 1 A G 1 ? OP1 ? A G 8 OP1 3 1 Y 1 A G 1 ? OP2 ? A G 8 OP2 4 2 Y 1 A G 1 ? P ? A G 8 P 5 2 Y 1 A G 1 ? OP1 ? A G 8 OP1 6 2 Y 1 A G 1 ? OP2 ? A G 8 OP2 7 3 Y 1 A G 1 ? P ? A G 8 P 8 3 Y 1 A G 1 ? OP1 ? A G 8 OP1 9 3 Y 1 A G 1 ? OP2 ? A G 8 OP2 10 4 Y 1 A G 1 ? P ? A G 8 P 11 4 Y 1 A G 1 ? OP1 ? A G 8 OP1 12 4 Y 1 A G 1 ? OP2 ? A G 8 OP2 13 5 Y 1 A G 1 ? P ? A G 8 P 14 5 Y 1 A G 1 ? OP1 ? A G 8 OP1 15 5 Y 1 A G 1 ? OP2 ? A G 8 OP2 16 6 Y 1 A G 1 ? P ? A G 8 P 17 6 Y 1 A G 1 ? OP1 ? A G 8 OP1 18 6 Y 1 A G 1 ? OP2 ? A G 8 OP2 19 7 Y 1 A G 1 ? P ? A G 8 P 20 7 Y 1 A G 1 ? OP1 ? A G 8 OP1 21 7 Y 1 A G 1 ? OP2 ? A G 8 OP2 22 8 Y 1 A G 1 ? P ? A G 8 P 23 8 Y 1 A G 1 ? OP1 ? A G 8 OP1 24 8 Y 1 A G 1 ? OP2 ? A G 8 OP2 25 9 Y 1 A G 1 ? P ? A G 8 P 26 9 Y 1 A G 1 ? OP1 ? A G 8 OP1 27 9 Y 1 A G 1 ? OP2 ? A G 8 OP2 28 10 Y 1 A G 1 ? P ? A G 8 P 29 10 Y 1 A G 1 ? OP1 ? A G 8 OP1 30 10 Y 1 A G 1 ? OP2 ? A G 8 OP2 # _cell.entry_id 1JU7 _cell.length_a ? _cell.length_b ? _cell.length_c ? _cell.angle_alpha ? _cell.angle_beta ? _cell.angle_gamma ? _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _exptl.entry_id 1JU7 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _database_PDB_matrix.entry_id 1JU7 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1JU7 _struct.title 'NMR Solution Structure of the RNA Hairpin Binding Site for the Histone Stem-loop Binding Protein' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1JU7 _struct_keywords.pdbx_keywords RNA _struct_keywords.text ;hairpin, tetraloop, 3' stack, RNA ; # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_code X13235 _struct_ref.db_name GB _struct_ref.entity_id 1 _struct_ref.pdbx_db_accession 51308 _struct_ref.pdbx_align_begin 573 _struct_ref.pdbx_seq_one_letter_code AACAAAAGGCCCUUUUCAGGGCCACCCA _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1JU7 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 51308 _struct_ref_seq.db_align_beg 573 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 600 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg -6 _struct_ref_seq.pdbx_auth_seq_align_end 21 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 1JU7 G A 1 ? GB 51308 A 573 'SEE REMARK 999' -6 1 1 1JU7 G A 2 ? GB 51308 A 574 'SEE REMARK 999' -5 2 1 1JU7 C A 4 ? GB 51308 A 576 'SEE REMARK 999' -3 3 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 1 A C 16 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog2 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 2 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 2 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 2 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 3 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 3 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 3 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 4 A G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 4 A G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 4 A G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 5 A G 12 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog12 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 18 N1 ? ? A U 6 A A 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 18 N6 ? ? A U 6 A A 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.41 2 3 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.52 3 4 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.36 4 5 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.32 5 5 "HO2'" A C 3 ? ? "O5'" A C 4 ? ? 1.38 6 7 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.39 7 8 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.53 8 9 "HO2'" A C 5 ? ? "O5'" A U 6 ? ? 1.35 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.66 113.10 4.56 0.50 N 2 1 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.49 106.40 -2.91 0.40 N 3 1 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.57 113.10 4.47 0.50 N 4 1 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.56 106.40 -2.84 0.40 N 5 1 "C3'" A C 10 ? ? "C2'" A C 10 ? ? "C1'" A C 10 ? ? 106.31 101.50 4.81 0.80 N 6 1 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.46 113.80 3.66 0.50 N 7 1 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.58 113.10 4.48 0.50 N 8 1 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.63 106.40 -2.77 0.40 N 9 1 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.55 113.10 4.45 0.50 N 10 1 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.61 106.40 -2.79 0.40 N 11 1 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.61 113.10 4.51 0.50 N 12 1 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.55 106.40 -2.85 0.40 N 13 2 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.62 113.10 4.52 0.50 N 14 2 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.50 106.40 -2.90 0.40 N 15 2 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.67 113.10 4.57 0.50 N 16 2 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.51 106.40 -2.89 0.40 N 17 2 "C3'" A U 7 ? ? "C2'" A U 7 ? ? "C1'" A U 7 ? ? 106.37 101.50 4.87 0.80 N 18 2 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.55 113.80 3.75 0.50 N 19 2 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.67 113.10 4.57 0.50 N 20 2 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.52 106.40 -2.88 0.40 N 21 2 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.63 113.10 4.53 0.50 N 22 2 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.50 106.40 -2.90 0.40 N 23 2 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.57 113.10 4.47 0.50 N 24 2 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.49 106.40 -2.91 0.40 N 25 3 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.53 113.10 4.43 0.50 N 26 3 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.58 106.40 -2.82 0.40 N 27 3 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.68 113.10 4.58 0.50 N 28 3 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.48 106.40 -2.92 0.40 N 29 3 "C3'" A U 7 ? ? "C2'" A U 7 ? ? "C1'" A U 7 ? ? 106.33 101.50 4.83 0.80 N 30 3 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.57 113.80 3.77 0.50 N 31 3 C8 A A 11 ? ? N9 A A 11 ? ? C4 A A 11 ? ? 103.32 105.80 -2.48 0.40 N 32 3 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.48 113.10 4.38 0.50 N 33 3 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.67 106.40 -2.73 0.40 N 34 3 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.74 113.10 4.64 0.50 N 35 3 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.53 106.40 -2.87 0.40 N 36 3 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.52 113.10 4.42 0.50 N 37 3 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.52 106.40 -2.88 0.40 N 38 4 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.55 113.10 4.45 0.50 N 39 4 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.50 106.40 -2.90 0.40 N 40 4 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.65 113.10 4.55 0.50 N 41 4 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.42 106.40 -2.98 0.40 N 42 4 "C3'" A C 10 ? ? "C2'" A C 10 ? ? "C1'" A C 10 ? ? 106.32 101.50 4.82 0.80 N 43 4 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.49 113.80 3.69 0.50 N 44 4 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.55 113.10 4.45 0.50 N 45 4 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.60 106.40 -2.80 0.40 N 46 4 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.65 113.10 4.55 0.50 N 47 4 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.47 106.40 -2.93 0.40 N 48 4 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.50 113.10 4.40 0.50 N 49 4 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.66 106.40 -2.74 0.40 N 50 5 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.66 113.10 4.56 0.50 N 51 5 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.51 106.40 -2.89 0.40 N 52 5 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.58 113.10 4.48 0.50 N 53 5 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.52 106.40 -2.88 0.40 N 54 5 "C3'" A C 10 ? ? "C2'" A C 10 ? ? "C1'" A C 10 ? ? 106.30 101.50 4.80 0.80 N 55 5 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.57 113.80 3.77 0.50 N 56 5 C8 A A 11 ? ? N9 A A 11 ? ? C4 A A 11 ? ? 103.35 105.80 -2.45 0.40 N 57 5 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.59 113.10 4.49 0.50 N 58 5 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.51 106.40 -2.89 0.40 N 59 5 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.63 113.10 4.53 0.50 N 60 5 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.56 106.40 -2.84 0.40 N 61 5 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.53 113.10 4.43 0.50 N 62 5 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.63 106.40 -2.77 0.40 N 63 6 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.63 113.10 4.53 0.50 N 64 6 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.55 106.40 -2.85 0.40 N 65 6 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.68 113.10 4.58 0.50 N 66 6 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.46 106.40 -2.94 0.40 N 67 6 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.55 113.80 3.75 0.50 N 68 6 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.57 113.10 4.47 0.50 N 69 6 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.58 106.40 -2.82 0.40 N 70 6 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.58 113.10 4.48 0.50 N 71 6 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.54 106.40 -2.86 0.40 N 72 6 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.53 113.10 4.43 0.50 N 73 6 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.51 106.40 -2.89 0.40 N 74 7 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.48 113.10 4.38 0.50 N 75 7 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.55 106.40 -2.85 0.40 N 76 7 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.74 113.10 4.64 0.50 N 77 7 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.40 106.40 -3.00 0.40 N 78 7 "C3'" A C 10 ? ? "C2'" A C 10 ? ? "C1'" A C 10 ? ? 106.34 101.50 4.84 0.80 N 79 7 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.56 113.80 3.76 0.50 N 80 7 C8 A A 11 ? ? N9 A A 11 ? ? C4 A A 11 ? ? 103.37 105.80 -2.43 0.40 N 81 7 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.62 113.10 4.52 0.50 N 82 7 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.53 106.40 -2.87 0.40 N 83 7 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.53 113.10 4.43 0.50 N 84 7 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.56 106.40 -2.84 0.40 N 85 7 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.52 113.10 4.42 0.50 N 86 7 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.67 106.40 -2.73 0.40 N 87 8 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.54 113.10 4.44 0.50 N 88 8 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.56 106.40 -2.84 0.40 N 89 8 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.68 113.10 4.58 0.50 N 90 8 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.46 106.40 -2.94 0.40 N 91 8 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.53 113.80 3.73 0.50 N 92 8 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.64 113.10 4.54 0.50 N 93 8 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.54 106.40 -2.86 0.40 N 94 8 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.54 113.10 4.44 0.50 N 95 8 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.59 106.40 -2.81 0.40 N 96 8 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.58 113.10 4.48 0.50 N 97 8 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.54 106.40 -2.86 0.40 N 98 9 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.61 113.10 4.51 0.50 N 99 9 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.53 106.40 -2.87 0.40 N 100 9 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.64 113.10 4.54 0.50 N 101 9 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.54 106.40 -2.86 0.40 N 102 9 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.54 113.80 3.74 0.50 N 103 9 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.63 113.10 4.53 0.50 N 104 9 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.48 106.40 -2.92 0.40 N 105 9 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.69 113.10 4.59 0.50 N 106 9 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.47 106.40 -2.93 0.40 N 107 9 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.54 113.10 4.44 0.50 N 108 9 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.55 106.40 -2.85 0.40 N 109 10 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.70 113.10 4.60 0.50 N 110 10 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.47 106.40 -2.93 0.40 N 111 10 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.57 113.10 4.47 0.50 N 112 10 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.57 106.40 -2.83 0.40 N 113 10 "C3'" A U 8 ? ? "C2'" A U 8 ? ? "C1'" A U 8 ? ? 106.49 101.50 4.99 0.80 N 114 10 N7 A A 11 ? ? C8 A A 11 ? ? N9 A A 11 ? ? 117.52 113.80 3.72 0.50 N 115 10 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.63 113.10 4.53 0.50 N 116 10 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.58 106.40 -2.82 0.40 N 117 10 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.68 113.10 4.58 0.50 N 118 10 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.49 106.40 -2.91 0.40 N 119 10 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 117.62 113.10 4.52 0.50 N 120 10 C8 A G 14 ? ? N9 A G 14 ? ? C4 A G 14 ? ? 103.48 106.40 -2.92 0.40 N # _pdbx_nmr_ensemble.entry_id 1JU7 _pdbx_nmr_ensemble.conformers_calculated_total_number 60 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with acceptable covalent geometry, structures with the least restraint violations, structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1JU7 _pdbx_nmr_representative.conformer_id 5 _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2.3 mM U-13C; 20 mM KPi, 20 mM KCl, 0.02 mM EDTA, pH 6.8' '100% D2O' 2 '2.5 mM U-15N; 20 mM KPi, 20 mM KCl, 0.02 mM EDTA, pH 6.8' '10% D2O, 90% H2O' 3 '2.0 mM U-13C,C5-2H; 20 mM KPi, 20 mM KCl, 0.02 mM EDTA, pH 6.8' '100% D2O' 4 '2.8 mM unlabeled 20 mM KPi, 20 mM KCl, 0.02 mM EDTA, pH 6.8' '100% D2O' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 301 ambient 6.8 '100 mM' ? K 2 280 ambient 6.8 '100 mM' ? K 3 301 ambient 6.8 '100 mM' ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 4 1 NOESY 2 1 1 3D_13C-separated_NOESY 3 2 2 3D_15N-separated_NOESY 4 3 3 3D_13C-separated_NOESY 5 2 1 DQF-COSY 6 4 1 HetCor # _pdbx_nmr_details.entry_id 1JU7 _pdbx_nmr_details.text 'This structure was determined using a variety of 2D and 3D homo- and hetero-nuclear NMR methods.' # _pdbx_nmr_refine.entry_id 1JU7 _pdbx_nmr_refine.method 'simulated annealing and molecular dynamics' _pdbx_nmr_refine.details ;Calculations were performed using 232 conformationally restrictive NOE derived distance constraints and 55 backbone and 15 ribose torsion angle constraints. Base pair constraints were introduced for six base pairs using heavy atom-heavy atom constraints. Coordinates are for the hairpin domain only. 5' flanking (ggccaaa) and 3' flanking (accca) coordinates are not included with this deposition. Few constraints were obtained for these very dynamic regions and although they were included as part of the structure calculation, their conformations appear to be randomly distributed. ; _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal Felix 980 processing MSI-Biosym 1 X-PLOR 3.851 refinement 'Brunger, A.' 2 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A G -6 ? A G 1 2 1 Y 1 A G -5 ? A G 2 3 1 Y 1 A C -4 ? A C 3 4 1 Y 1 A C -3 ? A C 4 5 1 Y 1 A A -2 ? A A 5 6 1 Y 1 A A -1 ? A A 6 7 1 Y 1 A A 0 ? A A 7 8 1 Y 1 A A 17 ? A A 24 9 1 Y 1 A C 18 ? A C 25 10 1 Y 1 A C 19 ? A C 26 11 1 Y 1 A C 20 ? A C 27 12 1 Y 1 A A 21 ? A A 28 13 2 Y 1 A G -6 ? A G 1 14 2 Y 1 A G -5 ? A G 2 15 2 Y 1 A C -4 ? A C 3 16 2 Y 1 A C -3 ? A C 4 17 2 Y 1 A A -2 ? A A 5 18 2 Y 1 A A -1 ? A A 6 19 2 Y 1 A A 0 ? A A 7 20 2 Y 1 A A 17 ? A A 24 21 2 Y 1 A C 18 ? A C 25 22 2 Y 1 A C 19 ? A C 26 23 2 Y 1 A C 20 ? A C 27 24 2 Y 1 A A 21 ? A A 28 25 3 Y 1 A G -6 ? A G 1 26 3 Y 1 A G -5 ? A G 2 27 3 Y 1 A C -4 ? A C 3 28 3 Y 1 A C -3 ? A C 4 29 3 Y 1 A A -2 ? A A 5 30 3 Y 1 A A -1 ? A A 6 31 3 Y 1 A A 0 ? A A 7 32 3 Y 1 A A 17 ? A A 24 33 3 Y 1 A C 18 ? A C 25 34 3 Y 1 A C 19 ? A C 26 35 3 Y 1 A C 20 ? A C 27 36 3 Y 1 A A 21 ? A A 28 37 4 Y 1 A G -6 ? A G 1 38 4 Y 1 A G -5 ? A G 2 39 4 Y 1 A C -4 ? A C 3 40 4 Y 1 A C -3 ? A C 4 41 4 Y 1 A A -2 ? A A 5 42 4 Y 1 A A -1 ? A A 6 43 4 Y 1 A A 0 ? A A 7 44 4 Y 1 A A 17 ? A A 24 45 4 Y 1 A C 18 ? A C 25 46 4 Y 1 A C 19 ? A C 26 47 4 Y 1 A C 20 ? A C 27 48 4 Y 1 A A 21 ? A A 28 49 5 Y 1 A G -6 ? A G 1 50 5 Y 1 A G -5 ? A G 2 51 5 Y 1 A C -4 ? A C 3 52 5 Y 1 A C -3 ? A C 4 53 5 Y 1 A A -2 ? A A 5 54 5 Y 1 A A -1 ? A A 6 55 5 Y 1 A A 0 ? A A 7 56 5 Y 1 A A 17 ? A A 24 57 5 Y 1 A C 18 ? A C 25 58 5 Y 1 A C 19 ? A C 26 59 5 Y 1 A C 20 ? A C 27 60 5 Y 1 A A 21 ? A A 28 61 6 Y 1 A G -6 ? A G 1 62 6 Y 1 A G -5 ? A G 2 63 6 Y 1 A C -4 ? A C 3 64 6 Y 1 A C -3 ? A C 4 65 6 Y 1 A A -2 ? A A 5 66 6 Y 1 A A -1 ? A A 6 67 6 Y 1 A A 0 ? A A 7 68 6 Y 1 A A 17 ? A A 24 69 6 Y 1 A C 18 ? A C 25 70 6 Y 1 A C 19 ? A C 26 71 6 Y 1 A C 20 ? A C 27 72 6 Y 1 A A 21 ? A A 28 73 7 Y 1 A G -6 ? A G 1 74 7 Y 1 A G -5 ? A G 2 75 7 Y 1 A C -4 ? A C 3 76 7 Y 1 A C -3 ? A C 4 77 7 Y 1 A A -2 ? A A 5 78 7 Y 1 A A -1 ? A A 6 79 7 Y 1 A A 0 ? A A 7 80 7 Y 1 A A 17 ? A A 24 81 7 Y 1 A C 18 ? A C 25 82 7 Y 1 A C 19 ? A C 26 83 7 Y 1 A C 20 ? A C 27 84 7 Y 1 A A 21 ? A A 28 85 8 Y 1 A G -6 ? A G 1 86 8 Y 1 A G -5 ? A G 2 87 8 Y 1 A C -4 ? A C 3 88 8 Y 1 A C -3 ? A C 4 89 8 Y 1 A A -2 ? A A 5 90 8 Y 1 A A -1 ? A A 6 91 8 Y 1 A A 0 ? A A 7 92 8 Y 1 A A 17 ? A A 24 93 8 Y 1 A C 18 ? A C 25 94 8 Y 1 A C 19 ? A C 26 95 8 Y 1 A C 20 ? A C 27 96 8 Y 1 A A 21 ? A A 28 97 9 Y 1 A G -6 ? A G 1 98 9 Y 1 A G -5 ? A G 2 99 9 Y 1 A C -4 ? A C 3 100 9 Y 1 A C -3 ? A C 4 101 9 Y 1 A A -2 ? A A 5 102 9 Y 1 A A -1 ? A A 6 103 9 Y 1 A A 0 ? A A 7 104 9 Y 1 A A 17 ? A A 24 105 9 Y 1 A C 18 ? A C 25 106 9 Y 1 A C 19 ? A C 26 107 9 Y 1 A C 20 ? A C 27 108 9 Y 1 A A 21 ? A A 28 109 10 Y 1 A G -6 ? A G 1 110 10 Y 1 A G -5 ? A G 2 111 10 Y 1 A C -4 ? A C 3 112 10 Y 1 A C -3 ? A C 4 113 10 Y 1 A A -2 ? A A 5 114 10 Y 1 A A -1 ? A A 6 115 10 Y 1 A A 0 ? A A 7 116 10 Y 1 A A 17 ? A A 24 117 10 Y 1 A C 18 ? A C 25 118 10 Y 1 A C 19 ? A C 26 119 10 Y 1 A C 20 ? A C 27 120 10 Y 1 A A 21 ? A A 28 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1JU7 'double helix' 1JU7 'hairpin loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 8 1_555 A C 23 1_555 0.029 0.437 0.430 32.905 5.687 7.622 1 A_G1:C16_A A 1 ? A 16 ? ? 1 1 A G 9 1_555 A C 22 1_555 -0.200 -0.198 -0.506 -38.216 18.692 -3.032 2 A_G2:C15_A A 2 ? A 15 ? 19 1 1 A C 10 1_555 A G 21 1_555 -0.079 0.321 -0.214 2.158 29.461 -0.994 3 A_C3:G14_A A 3 ? A 14 ? 19 1 1 A C 11 1_555 A G 20 1_555 -0.200 0.429 -0.340 18.429 7.798 2.478 4 A_C4:G13_A A 4 ? A 13 ? 19 1 1 A C 12 1_555 A G 19 1_555 0.082 0.240 0.166 15.084 19.510 10.312 5 A_C5:G12_A A 5 ? A 12 ? ? 1 1 A U 13 1_555 A A 18 1_555 -1.005 0.020 -1.522 21.959 -22.020 -5.080 6 A_U6:A11_A A 6 ? A 11 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 8 1_555 A C 23 1_555 A G 9 1_555 A C 22 1_555 -0.563 -2.537 6.293 -3.611 45.986 34.641 -6.810 0.263 1.975 54.869 4.308 57.112 1 AA_G1G2:C15C16_AA A 1 ? A 16 ? A 2 ? A 15 ? 1 A G 9 1_555 A C 22 1_555 A C 10 1_555 A G 21 1_555 -0.060 -1.041 2.886 1.777 0.994 14.671 -4.775 1.550 2.782 3.870 -6.915 14.811 2 AA_G2C3:G14C15_AA A 2 ? A 15 ? A 3 ? A 14 ? 1 A C 10 1_555 A G 21 1_555 A C 11 1_555 A G 20 1_555 0.807 -1.996 3.564 0.736 7.857 20.755 -8.113 -1.823 2.663 20.862 -1.954 22.190 3 AA_C3C4:G13G14_AA A 3 ? A 14 ? A 4 ? A 13 ? 1 A C 11 1_555 A G 20 1_555 A C 12 1_555 A G 19 1_555 -0.427 -1.936 3.934 -5.561 21.523 24.763 -7.050 -0.197 1.790 41.146 10.631 33.161 4 AA_C4C5:G12G13_AA A 4 ? A 13 ? A 5 ? A 12 ? 1 A C 12 1_555 A G 19 1_555 A U 13 1_555 A A 18 1_555 -1.141 -1.966 3.213 9.149 14.423 22.989 -6.479 3.894 1.255 31.244 -19.820 28.570 5 AA_C5U6:A11G12_AA A 5 ? A 12 ? A 6 ? A 11 ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model AMX _pdbx_nmr_spectrometer.field_strength 500 # _atom_sites.entry_id 1JU7 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_