data_1L3D # _entry.id 1L3D # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.376 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1L3D pdb_00001l3d 10.2210/pdb1l3d/pdb NDB UR0021 ? ? RCSB RCSB015603 ? ? WWPDB D_1000015603 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 437D '437D is the same RNA pseudoknot structure at 1.6 Angstrom resolution' unspecified PDB 1L2X 'Atomic Resolution Crystal Structure of a Viral RNA Pseudoknot' unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1L3D _pdbx_database_status.recvd_initial_deposition_date 2002-02-26 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Egli, M.' 1 'Minasov, G.' 2 'Su, L.' 3 'Rich, A.' 4 # _citation.id primary _citation.title 'Metal ions and flexibility in a viral RNA pseudoknot at atomic resolution.' _citation.journal_abbrev Proc.Natl.Acad.Sci.USA _citation.journal_volume 99 _citation.page_first 4302 _citation.page_last 4307 _citation.year 2002 _citation.journal_id_ASTM PNASA6 _citation.country US _citation.journal_id_ISSN 0027-8424 _citation.journal_id_CSD 0040 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 11904368 _citation.pdbx_database_id_DOI 10.1073/pnas.062055599 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Egli, M.' 1 ? primary 'Minasov, G.' 2 ? primary 'Su, L.' 3 ? primary 'Rich, A.' 4 ? # _cell.entry_id 1L3D _cell.length_a 107.810 _cell.length_b 107.810 _cell.length_c 107.810 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 24 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1L3D _symmetry.space_group_name_H-M 'I 21 3' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 199 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA pseudoknot' 9245.484 1 ? ? ? 'Cubic crystal form' 2 water nat water 18.015 14 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GCGCGGCACCGUCCGCGGAACAAACGG' _entity_poly.pdbx_seq_one_letter_code_can GGCGCGGCACCGUCCGCGGAACAAACGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 C n 1 4 G n 1 5 C n 1 6 G n 1 7 G n 1 8 C n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 U n 1 14 C n 1 15 C n 1 16 G n 1 17 C n 1 18 G n 1 19 G n 1 20 A n 1 21 A n 1 22 C n 1 23 A n 1 24 A n 1 25 A n 1 26 C n 1 27 G n 1 28 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'RNA SEQUENCE TAKEN FROM BEET WESTERN YELLOW VIRUS' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1L3D _struct_ref.pdbx_db_accession 1L3D _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1L3D _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1L3D _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 28 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 28 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.entry_id 1L3D _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_percent_sol 78.22 _exptl_crystal.density_Matthews 5.65 _exptl_crystal.description ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.temp 277.0 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 5.0 _exptl_crystal_grow.pdbx_details 'ammonium sulfate, sodium citrate, pH 5.0, VAPOR DIFFUSION, SITTING DROP, temperature 277.0K' _exptl_crystal_grow.pdbx_pH_range . # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.details 1 1 1 '(NH4)2SO4' ? ? ? 1 2 1 'sodium citrate' ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 100.0 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector 'IMAGE PLATE' _diffrn_detector.type MARRESEARCH _diffrn_detector.pdbx_collection_date 1997-06-17 _diffrn_detector.details mirrors # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator graphite _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.0800 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'SSRL BEAMLINE BL1-5' _diffrn_source.pdbx_synchrotron_site SSRL _diffrn_source.pdbx_synchrotron_beamline BL1-5 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.0800 # _reflns.entry_id 1L3D _reflns.observed_criterion_sigma_I -3.0 _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 30.0 _reflns.d_resolution_high 2.85 _reflns.number_obs 5034 _reflns.number_all 5034 _reflns.percent_possible_obs 100.0 _reflns.pdbx_Rmerge_I_obs 0.0540000 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 39.5 _reflns.B_iso_Wilson_estimate 63.1 _reflns.pdbx_redundancy 9.2 _reflns.R_free_details ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _reflns_shell.d_res_high 2.85 _reflns_shell.d_res_low 2.95 _reflns_shell.percent_possible_all 100.0 _reflns_shell.Rmerge_I_obs 0.2860000 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs 9.3 _reflns_shell.pdbx_redundancy 8.9 _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all 486 _reflns_shell.pdbx_diffrn_id ? _reflns_shell.pdbx_ordinal 1 # _refine.entry_id 1L3D _refine.ls_number_reflns_obs 4989 _refine.ls_number_reflns_all 4989 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 0.0 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.ls_d_res_low 20.0 _refine.ls_d_res_high 2.85 _refine.ls_percent_reflns_obs 99.7 _refine.ls_R_factor_obs ? _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2710000 _refine.ls_R_factor_R_free 0.2750000 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free 514 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.B_iso_mean 43.3 _refine.aniso_B[1][1] 1.768 _refine.aniso_B[2][2] 1.768 _refine.aniso_B[3][3] 1.768 _refine.aniso_B[1][2] 0.0 _refine.aniso_B[1][3] 0.0 _refine.aniso_B[2][3] 0.0 _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.details ;Crystallographic conjugate gradient minimization refinement using maximum likelihood target for amplitudes ; _refine.pdbx_starting_model 'PDB entry 437D' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model Isotropic _refine.pdbx_stereochemistry_target_values 'G. Parkinson et al., Acta Cryst. (1996) D52, 57-64' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.correlation_coeff_Fo_to_Fc ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_SU_ML ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 677 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.number_atoms_solvent 14 _refine_hist.number_atoms_total 691 _refine_hist.d_res_high 2.85 _refine_hist.d_res_low 20.0 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.009 ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg 1.0 ? ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.d_res_high 2.85 _refine_ls_shell.d_res_low 2.98 _refine_ls_shell.number_reflns_R_work ? _refine_ls_shell.R_factor_R_work 0.4270000 _refine_ls_shell.percent_reflns_obs 99.7 _refine_ls_shell.R_factor_R_free 0.4430000 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.number_reflns_R_free 65 _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # _struct.entry_id 1L3D _struct.title 'Low Resolution Crystal Structure of a Viral RNA Pseudoknot' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1L3D _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'Pseudoknot, frameshifting, viral RNA, flexibility, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.621 ? ? hydrog1 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 3 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 3 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 3 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 17 O2 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog5 hydrog ? ? A G 4 N2 ? ? ? 1_555 A A 20 N3 ? ? A G 4 A A 20 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog6 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 5 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 5 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 5 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 15 N3 ? ? A G 6 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 15 O2 ? ? A G 6 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 6 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 14 N3 A ? A G 7 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 14 O2 A ? A G 7 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 7 O6 ? ? ? 1_555 A C 14 N4 A ? A G 7 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 7 N2 ? ? ? 1_555 A A 24 N1 ? ? A G 7 A A 24 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog16 hydrog ? ? A G 7 N3 ? ? ? 1_555 A A 24 N6 ? ? A G 7 A A 24 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog17 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 12 N7 A ? A C 8 A G 12 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog18 hydrog ? ? A C 8 O2 ? ? ? 1_555 A C 26 N4 ? ? A C 8 A C 26 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog19 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 10 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 10 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 10 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 11 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 11 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 11 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N1 A ? ? 1_555 A C 26 N3 ? ? A G 12 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N2 A ? ? 1_555 A C 26 O2 ? ? A G 12 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 O6 A ? ? 1_555 A C 26 N4 ? ? A G 12 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 14 O2 A ? ? 1_555 A A 25 N6 ? ? A C 14 A A 25 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog29 hydrog ? ? A C 15 O2 ? ? ? 1_555 A A 23 N6 ? ? A C 15 A A 23 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _database_PDB_matrix.entry_id 1L3D _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1L3D _atom_sites.fract_transf_matrix[1][1] 0.009276 _atom_sites.fract_transf_matrix[1][2] -0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.009276 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009276 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 G 7 7 7 G G A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 C 14 14 14 C C A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 A 21 21 21 A A A . n A 1 22 C 22 22 22 C C A . n A 1 23 A 23 23 23 A A A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 HOH 1 29 29 HOH TIP A . B 2 HOH 2 30 30 HOH TIP A . B 2 HOH 3 31 31 HOH TIP A . B 2 HOH 4 32 32 HOH TIP A . B 2 HOH 5 33 33 HOH TIP A . B 2 HOH 6 34 34 HOH TIP A . B 2 HOH 7 35 35 HOH TIP A . B 2 HOH 8 36 36 HOH TIP A . B 2 HOH 9 37 37 HOH TIP A . B 2 HOH 10 38 38 HOH TIP A . B 2 HOH 11 39 39 HOH TIP A . B 2 HOH 12 40 40 HOH TIP A . B 2 HOH 13 41 41 HOH TIP A . B 2 HOH 14 42 42 HOH TIP A . # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id GTP _pdbx_struct_mod_residue.label_seq_id 1 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id GTP _pdbx_struct_mod_residue.auth_seq_id 1 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id G _pdbx_struct_mod_residue.details "GUANOSINE-5'-TRIPHOSPHATE" # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2002-03-22 2 'Structure model' 1 1 2008-04-28 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2023-08-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 4 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_initial_refinement_model 5 4 'Structure model' struct_conn # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal AMoRE phasing . ? 1 CNS refinement . ? 2 DENZO 'data reduction' . ? 3 SCALEPACK 'data scaling' . ? 4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 U OP3 O N N 162 U P P N N 163 U OP1 O N N 164 U OP2 O N N 165 U "O5'" O N N 166 U "C5'" C N N 167 U "C4'" C N R 168 U "O4'" O N N 169 U "C3'" C N S 170 U "O3'" O N N 171 U "C2'" C N R 172 U "O2'" O N N 173 U "C1'" C N R 174 U N1 N N N 175 U C2 C N N 176 U O2 O N N 177 U N3 N N N 178 U C4 C N N 179 U O4 O N N 180 U C5 C N N 181 U C6 C N N 182 U HOP3 H N N 183 U HOP2 H N N 184 U "H5'" H N N 185 U "H5''" H N N 186 U "H4'" H N N 187 U "H3'" H N N 188 U "HO3'" H N N 189 U "H2'" H N N 190 U "HO2'" H N N 191 U "H1'" H N N 192 U H3 H N N 193 U H5 H N N 194 U H6 H N N 195 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 U OP3 P sing N N 168 U OP3 HOP3 sing N N 169 U P OP1 doub N N 170 U P OP2 sing N N 171 U P "O5'" sing N N 172 U OP2 HOP2 sing N N 173 U "O5'" "C5'" sing N N 174 U "C5'" "C4'" sing N N 175 U "C5'" "H5'" sing N N 176 U "C5'" "H5''" sing N N 177 U "C4'" "O4'" sing N N 178 U "C4'" "C3'" sing N N 179 U "C4'" "H4'" sing N N 180 U "O4'" "C1'" sing N N 181 U "C3'" "O3'" sing N N 182 U "C3'" "C2'" sing N N 183 U "C3'" "H3'" sing N N 184 U "O3'" "HO3'" sing N N 185 U "C2'" "O2'" sing N N 186 U "C2'" "C1'" sing N N 187 U "C2'" "H2'" sing N N 188 U "O2'" "HO2'" sing N N 189 U "C1'" N1 sing N N 190 U "C1'" "H1'" sing N N 191 U N1 C2 sing N N 192 U N1 C6 sing N N 193 U C2 O2 doub N N 194 U C2 N3 sing N N 195 U N3 C4 sing N N 196 U N3 H3 sing N N 197 U C4 O4 doub N N 198 U C4 C5 sing N N 199 U C5 C6 doub N N 200 U C5 H5 sing N N 201 U C6 H6 sing N N 202 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1L3D 'double helix' 1L3D 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 3 1_555 A G 18 1_555 0.439 -0.405 0.214 10.360 -7.471 -3.277 1 A_C3:G18_A A 3 ? A 18 ? 19 1 1 A G 4 1_555 A C 17 1_555 -0.895 -0.037 0.054 -1.103 -18.766 11.994 2 A_G4:C17_A A 4 ? A 17 ? ? 1 1 A C 5 1_555 A G 16 1_555 -0.443 -0.215 0.004 1.991 -14.788 -0.317 3 A_C5:G16_A A 5 ? A 16 ? 19 1 1 A G 6 1_555 A C 15 1_555 0.545 -0.470 -0.086 -9.713 -5.112 -3.246 4 A_G6:C15_A A 6 ? A 15 ? 19 1 1 A G 7 1_555 A C 14 1_555 -0.004 -0.271 -0.198 -5.501 -8.703 -9.991 5 A_G7:C14_A A 7 ? A 14 ? 19 1 1 A C 26 1_555 A G 12 1_555 0.586 -0.068 0.012 4.505 -16.674 6.537 6 A_C26:G12_A A 26 ? A 12 ? 19 1 1 A G 27 1_555 A C 11 1_555 -0.696 -0.364 0.562 -8.471 -15.796 -3.862 7 A_G27:C11_A A 27 ? A 11 ? 19 1 1 A G 28 1_555 A C 10 1_555 -0.116 -0.418 0.581 -1.161 -13.716 -3.368 8 A_G28:C10_A A 28 ? A 10 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 3 1_555 A G 18 1_555 A G 4 1_555 A C 17 1_555 0.987 -1.663 3.387 0.745 10.813 29.177 -5.076 -1.705 2.641 20.589 -1.418 31.084 1 AA_C3G4:C17G18_AA A 3 ? A 18 ? A 4 ? A 17 ? 1 A G 4 1_555 A C 17 1_555 A C 5 1_555 A G 16 1_555 -0.767 -1.532 3.139 -2.571 1.921 33.151 -2.979 0.929 3.097 3.358 4.494 33.302 2 AA_G4C5:G16C17_AA A 4 ? A 17 ? A 5 ? A 16 ? 1 A C 5 1_555 A G 16 1_555 A G 6 1_555 A C 15 1_555 -0.163 -1.753 3.523 0.503 11.013 32.816 -4.642 0.351 2.804 18.842 -0.861 34.570 3 AA_C5G6:C15G16_AA A 5 ? A 16 ? A 6 ? A 15 ? 1 A G 6 1_555 A C 15 1_555 A G 7 1_555 A C 14 1_555 -0.075 -1.913 3.091 2.335 3.074 31.393 -4.032 0.534 2.882 5.655 -4.294 31.623 4 AA_G6G7:C14C15_AA A 6 ? A 15 ? A 7 ? A 14 ? 1 A G 7 1_555 A C 14 1_555 A C 26 1_555 A G 12 1_555 -5.745 -0.362 3.764 9.207 -5.337 93.776 -0.141 4.101 3.335 -3.646 -6.290 94.238 5 AA_G7C26:G12C14_AA A 7 ? A 14 ? A 26 ? A 12 ? 1 A C 26 1_555 A G 12 1_555 A G 27 1_555 A C 11 1_555 -0.660 -2.011 3.355 -8.596 10.314 23.616 -6.736 -0.634 2.380 22.976 19.149 27.119 6 AA_C26G27:C11G12_AA A 26 ? A 12 ? A 27 ? A 11 ? 1 A G 27 1_555 A C 11 1_555 A G 28 1_555 A C 10 1_555 0.187 -1.909 2.996 4.080 -0.272 37.612 -2.913 0.194 3.012 -0.420 -6.306 37.826 7 AA_G27G28:C10C11_AA A 27 ? A 11 ? A 28 ? A 10 ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name water _pdbx_entity_nonpoly.comp_id HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 437D _pdbx_initial_refinement_model.details 'PDB entry 437D' #