data_1M82 # _entry.id 1M82 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1M82 pdb_00001m82 10.2210/pdb1m82/pdb RCSB RCSB016712 ? ? WWPDB D_1000016712 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1M82 _pdbx_database_status.recvd_initial_deposition_date 2002-07-24 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Park, C.-J.' 1 'Bae, S.-H.' 2 'Lee, M.-K.' 3 'Varani, G.' 4 'Choi, B.-S.' 5 # _citation.id primary _citation.title ;Solution structure of the influenza A virus cRNA promoter: implications for differential recognition of viral promoter structures by RNA-dependent RNA polymerase ; _citation.journal_abbrev 'NUCLEIC ACIDS RES.' _citation.journal_volume 31 _citation.page_first 2824 _citation.page_last 2832 _citation.year 2003 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 12771209 _citation.pdbx_database_id_DOI 10.1093/nar/gkg387 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Park, C.-J.' 1 ? primary 'Bae, S.-H.' 2 ? primary 'Lee, M.-K.' 3 ? primary 'Varani, G.' 4 ? primary 'Choi, B.-S.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (25-MER): THE COMPLEMENTARY RNA PROMOTER OF INFLUENZA A VIRUS' _entity.formula_weight 7983.740 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details 'CONSERVED INTERNAL LOOP OF THE COMPLEMENTARY RNA PROMOTER OF THE INFLUENZA A VIRUS' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAAGCAGGCUUCGGCCUUGUUUCC _entity_poly.pdbx_seq_one_letter_code_can GGAAGCAGGCUUCGGCCUUGUUUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 A n 1 5 G n 1 6 C n 1 7 A n 1 8 G n 1 9 G n 1 10 C n 1 11 U n 1 12 U n 1 13 C n 1 14 G n 1 15 G n 1 16 C n 1 17 C n 1 18 U n 1 19 U n 1 20 G n 1 21 U n 1 22 U n 1 23 U n 1 24 C n 1 25 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'This sequence occurs naturally in complementary RNA of the influenza A virus genome segments.' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1M82 _struct_ref.pdbx_db_accession 1M82 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1M82 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 25 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1M82 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 25 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 25 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 2 1 '2D NOESY' 2 1 2 '2D NOESY' 3 1 2 '2D TOCSY' 4 1 2 DQF-COSY 5 3 2 '2D NOESY' 6 4 2 '2D NOESY' 7 1 2 HETCOR 8 1 2 '3D 13C NOESY-HSQC' 9 1 2 '3D HCCH-COSY' 10 1 2 '3D HCCH-COSY-TOCSY' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 300 ambient 6.0 '20mM NaPi 0.1mM EDTA' ? K 2 280 ambient 6.0 '20mM NaPi 0.1mM EDTA' ? K 3 290 ambient 6.0 '20mM NaPi 0.1mM EDTA' ? K 4 310 ambient 6.0 '20mM NaPi 0.1mM EDTA' ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 ;1mM influenza A virus cRNA promoter (25mer) 20mM phosphate buffer(pH 6.0)0.1mM EDTA ; '90% H2O/10% D2O' 2 ;1mM influenza A virus cRNA promoter (25mer) U-15N, 13C; 20mM phosphate buffer(pH 6.0)0.1mM EDTA ; '100% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Bruker DMX 600 2 ? Bruker DMX 800 3 ? Bruker AMX 500 4 ? Varian INOVA 600 # _pdbx_nmr_refine.entry_id 1M82 _pdbx_nmr_refine.method 'torsion angle dynamics' _pdbx_nmr_refine.details ;The structures are based on a total of 834 restraints, 592 are NOE-derived distance restraints, 140 torsion angle restraints, 54 planarity restraints and 48 base-pair restraints. ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_details.entry_id 1M82 _pdbx_nmr_details.text 'The structure was determined using 3D heteronuclear nmr spectroscopy.' # _pdbx_nmr_ensemble.entry_id 1M82 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 31 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations,structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1M82 _pdbx_nmr_representative.conformer_id 21 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal Felix 95 processing Biosym,inc. 1 VNMR 6.1c collection 'Varian, inc.' 2 CNS 1.0 'structure solution' Brunger 3 CNS 1.0 refinement Brunger 4 # _exptl.entry_id 1M82 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.crystal_id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 1M82 _struct.title 'SOLUTION STRUCTURE OF THE COMPLEMENTARY RNA PROMOTER OF INFLUENZA A VIRUS' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1M82 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'asymmetric internal loop, A-form helix, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 1 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 1 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 1 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 2 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 2 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 2 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 3 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 3 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 4 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 4 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 4 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 4 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N1 ? ? ? 1_555 A U 21 O2 ? ? A G 5 A U 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A U 21 N3 ? ? A G 5 A U 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 6 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 6 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 6 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 17 N3 ? ? A G 8 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 17 O2 ? ? A G 8 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 17 N4 ? ? A G 8 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 16 N3 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 16 O2 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 15 N1 ? ? A C 10 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 15 O6 ? ? A C 10 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 15 N2 ? ? A C 10 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 11 O2 ? ? ? 1_555 A G 14 N1 ? ? A U 11 A G 14 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog28 hydrog ? ? A U 11 N3 ? ? ? 1_555 A G 15 O6 ? ? A U 11 A G 15 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A U 11 O2 ? ? ? 1_555 A G 15 N1 ? ? A U 11 A G 15 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1M82 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1M82 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 C 6 6 6 C C A . n A 1 7 A 7 7 7 A A A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 U 12 12 12 U U A . n A 1 13 C 13 13 13 C C A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 C 16 16 16 C C A . n A 1 17 C 17 17 17 C C A . n A 1 18 U 18 18 18 U U A . n A 1 19 U 19 19 19 U U A . n A 1 20 G 20 20 20 G G A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2003-06-03 2 'Structure model' 1 1 2008-04-28 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 4 O2 A U 11 ? ? H1 A G 14 ? ? 1.58 2 6 "H2'" A G 14 ? ? "O4'" A G 15 ? ? 1.58 3 8 O2 A U 11 ? ? H1 A G 14 ? ? 1.59 4 14 O2 A U 11 ? ? H1 A G 14 ? ? 1.57 5 17 O2 A U 11 ? ? H1 A G 14 ? ? 1.60 6 21 O2 A U 11 ? ? H1 A G 14 ? ? 1.58 7 28 H61 A A 7 ? ? O4 A U 19 ? ? 1.38 8 28 O2 A C 17 ? ? H5 A U 18 ? ? 1.58 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1M82 'double helix' 1M82 'a-form double helix' 1M82 tetraloop 1M82 'mismatched base pair' 1M82 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 25 1_555 -0.751 -0.387 0.402 3.140 1.867 -1.665 1 A_G1:C25_A A 1 ? A 25 ? 19 1 1 A G 2 1_555 A C 24 1_555 -0.801 -0.453 -0.120 12.779 -5.979 -0.439 2 A_G2:C24_A A 2 ? A 24 ? 19 1 1 A A 3 1_555 A U 23 1_555 0.014 -0.668 -1.503 4.824 -3.668 -2.206 3 A_A3:U23_A A 3 ? A 23 ? 20 1 1 A A 4 1_555 A U 22 1_555 -0.560 -0.342 -0.431 11.672 1.671 6.770 4 A_A4:U22_A A 4 ? A 22 ? 20 1 1 A G 5 1_555 A U 21 1_555 -1.981 -0.345 -0.523 11.409 -7.744 11.325 5 A_G5:U21_A A 5 ? A 21 ? 28 1 1 A C 6 1_555 A G 20 1_555 -0.341 -0.150 -0.260 -5.642 1.220 -0.795 6 A_C6:G20_A A 6 ? A 20 ? 19 1 1 A G 8 1_555 A C 17 1_555 0.214 -0.175 0.587 8.004 -4.233 -2.599 7 A_G8:C17_A A 8 ? A 17 ? 19 1 1 A G 9 1_555 A C 16 1_555 0.604 -0.417 -1.380 -10.234 5.694 -5.313 8 A_G9:C16_A A 9 ? A 16 ? 19 1 1 A C 10 1_555 A G 15 1_555 -0.252 -0.515 -1.346 11.309 4.979 -7.497 9 A_C10:G15_A A 10 ? A 15 ? 19 1 1 A U 11 1_555 A G 14 1_555 0.588 -3.487 -0.174 19.468 -8.798 -122.830 10 A_U11:G14_A A 11 ? A 14 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 25 1_555 A G 2 1_555 A C 24 1_555 0.004 -0.806 3.290 -0.073 6.065 37.047 -2.035 -0.016 3.124 9.468 0.114 37.523 1 AA_G1G2:C24C25_AA A 1 ? A 25 ? A 2 ? A 24 ? 1 A G 2 1_555 A C 24 1_555 A A 3 1_555 A U 23 1_555 -0.092 -0.903 4.116 3.931 -2.191 36.858 -1.049 0.809 4.130 -3.449 -6.189 37.122 2 AA_G2A3:U23C24_AA A 2 ? A 24 ? A 3 ? A 23 ? 1 A A 3 1_555 A U 23 1_555 A A 4 1_555 A U 22 1_555 -0.245 -0.981 3.340 -7.702 7.506 29.511 -3.222 -0.990 2.976 14.156 14.526 31.369 3 AA_A3A4:U22U23_AA A 3 ? A 23 ? A 4 ? A 22 ? 1 A A 4 1_555 A U 22 1_555 A G 5 1_555 A U 21 1_555 0.685 -1.546 3.211 -3.699 12.410 25.284 -5.627 -2.136 2.115 26.266 7.829 28.359 4 AA_A4G5:U21U22_AA A 4 ? A 22 ? A 5 ? A 21 ? 1 A G 5 1_555 A U 21 1_555 A C 6 1_555 A G 20 1_555 -1.045 -1.814 3.710 -5.031 7.733 42.982 -3.237 0.870 3.445 10.410 6.773 43.915 5 AA_G5C6:G20U21_AA A 5 ? A 21 ? A 6 ? A 20 ? 1 A G 8 1_555 A C 17 1_555 A G 9 1_555 A C 16 1_555 0.054 -1.334 4.530 6.082 12.744 31.251 -4.909 1.169 3.672 22.287 -10.636 34.221 6 AA_G8G9:C16C17_AA A 8 ? A 17 ? A 9 ? A 16 ? 1 A G 9 1_555 A C 16 1_555 A C 10 1_555 A G 15 1_555 -0.218 -1.610 2.989 0.023 -0.837 29.828 -2.966 0.428 3.032 -1.626 -0.045 29.839 7 AA_G9C10:G15C16_AA A 9 ? A 16 ? A 10 ? A 15 ? 1 A C 10 1_555 A G 15 1_555 A U 11 1_555 A G 14 1_555 -0.664 -1.330 3.165 5.282 17.421 96.254 -1.157 0.524 2.928 11.620 -3.523 97.541 8 AA_C10U11:G14G15_AA A 10 ? A 15 ? A 11 ? A 14 ? #