data_1N66 # _entry.id 1N66 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1N66 pdb_00001n66 10.2210/pdb1n66/pdb RCSB RCSB017567 ? ? WWPDB D_1000017567 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2003-08-19 2 'Structure model' 1 1 2008-04-28 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1N66 _pdbx_database_status.recvd_initial_deposition_date 2002-11-08 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 255D ;CRYSTAL STRUCTURE OF AN RNA DOUBLE HELIX INCORPORATING A TRACK OF NON-WATSON-CRICK BASE PAIRS ; unspecified PDB 1ZIF 'NMR structure with GAAA tetraloop' unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lescrinier, E.M.' 1 'Tessari, M.' 2 'van Kuppeveld, F.J.' 3 'Melchers, W.J.' 4 'Hilbers, C.W.' 5 'Heus, H.A.' 6 # _citation.id primary _citation.title ;Structure of the Pyrimidine-rich Internal Loop in the Poliovirus 3'-UTR: The Importance of Maintaining Pseudo-2-fold Symmetry in RNA Helices Containing Two Adjacent Non-canonical Base-pairs. ; _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 331 _citation.page_first 759 _citation.page_last 769 _citation.year 2003 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 12909008 _citation.pdbx_database_id_DOI '10.1016/S0022-2836(03)00787-3' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lescrinier, E.M.' 1 ? primary 'Tessari, M.' 2 ? primary 'van Kuppeveld, F.J.' 3 ? primary 'Melchers, W.J.' 4 ? primary 'Hilbers, C.W.' 5 ? primary 'Heus, H.A.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;internal loop in the Y-domain of poliovirus 3'UTR ; _entity.formula_weight 7034.227 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGACCUCUCGAAAGAGUUGUCC _entity_poly.pdbx_seq_one_letter_code_can GGACCUCUCGAAAGAGUUGUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 C n 1 6 U n 1 7 C n 1 8 U n 1 9 C n 1 10 G n 1 11 A n 1 12 A n 1 13 A n 1 14 G n 1 15 A n 1 16 G n 1 17 U n 1 18 U n 1 19 G n 1 20 U n 1 21 C n 1 22 C n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 C 5 5 5 C C A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n # _cell.entry_id 1N66 _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1N66 _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1N66 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _database_PDB_matrix.entry_id 1N66 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1N66 _struct.title ;Structure of the pyrimidine-rich internal loop in the Y-domain of poliovirus 3'UTR ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1N66 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA internal loop, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1N66 _struct_ref.pdbx_db_accession 1N66 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1N66 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1N66 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 20 N3 ? ? A A 3 A U 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 20 O4 ? ? A A 3 A U 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 4 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 4 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 4 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 O2 ? ? ? 1_555 A U 18 N3 ? ? A C 5 A U 18 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog13 hydrog ? ? A U 6 N3 ? ? ? 1_555 A U 17 O2 ? ? A U 6 A U 17 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog14 hydrog ? ? A U 6 O4 ? ? ? 1_555 A U 17 N3 ? ? A U 6 A U 17 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog15 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N3 ? ? ? 1_555 A A 15 N6 ? ? A C 9 A A 15 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog24 hydrog ? ? A G 10 N2 ? ? ? 1_555 A A 13 N7 ? ? A G 10 A A 13 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H3 A U 6 ? ? O2 A U 17 ? ? 1.36 2 1 H21 A G 1 ? ? O2 A C 22 ? ? 1.51 3 1 O2 A C 5 ? ? H3 A U 18 ? ? 1.52 4 1 H21 A G 10 ? ? OP2 A A 13 ? ? 1.55 5 1 H22 A G 10 ? ? N7 A A 13 ? ? 1.57 6 2 H21 A G 10 ? ? OP2 A A 13 ? ? 1.39 7 2 H22 A G 10 ? ? N7 A A 13 ? ? 1.43 8 2 H3 A U 6 ? ? O2 A U 17 ? ? 1.48 9 2 O4 A U 6 ? ? H3 A U 17 ? ? 1.50 10 2 H21 A G 1 ? ? O2 A C 22 ? ? 1.51 11 2 O2 A C 4 ? ? H21 A G 19 ? ? 1.55 12 3 H3 A U 6 ? ? O2 A U 17 ? ? 1.41 13 3 O2 A C 5 ? ? H3 A U 18 ? ? 1.48 14 3 H21 A G 10 ? ? OP2 A A 13 ? ? 1.48 15 3 "HO2'" A U 18 ? ? "O4'" A G 19 ? ? 1.51 16 3 H21 A G 1 ? ? O2 A C 22 ? ? 1.51 17 3 H1 A G 2 ? ? N3 A C 21 ? ? 1.57 18 3 H22 A G 10 ? ? N7 A A 13 ? ? 1.57 19 3 O2 A C 4 ? ? H21 A G 19 ? ? 1.58 20 4 O4 A U 6 ? ? H3 A U 17 ? ? 1.48 21 4 H21 A G 10 ? ? OP2 A A 13 ? ? 1.50 22 4 H22 A G 10 ? ? N7 A A 13 ? ? 1.54 23 4 H21 A G 1 ? ? O2 A C 22 ? ? 1.56 24 4 O6 A G 1 ? ? H41 A C 22 ? ? 1.57 25 4 O2 A C 7 ? ? H21 A G 16 ? ? 1.59 26 5 H21 A G 1 ? ? O2 A C 22 ? ? 1.48 27 5 O2 A C 5 ? ? H3 A U 18 ? ? 1.48 28 5 H3 A U 6 ? ? O2 A U 17 ? ? 1.49 29 5 H21 A G 10 ? ? OP2 A A 13 ? ? 1.50 30 5 O2 A C 4 ? ? H21 A G 19 ? ? 1.56 31 5 O6 A G 2 ? ? H41 A C 21 ? ? 1.58 32 5 H1 A G 2 ? ? N3 A C 21 ? ? 1.58 33 5 H22 A G 10 ? ? N7 A A 13 ? ? 1.58 34 6 H3 A U 6 ? ? O2 A U 17 ? ? 1.48 35 6 H21 A G 1 ? ? O2 A C 22 ? ? 1.49 36 6 O2 A C 5 ? ? H3 A U 18 ? ? 1.51 37 6 H1 A G 2 ? ? N3 A C 21 ? ? 1.53 38 6 O6 A G 2 ? ? H41 A C 21 ? ? 1.54 39 6 O4 A U 6 ? ? H3 A U 17 ? ? 1.56 40 6 H21 A G 2 ? ? O2 A C 21 ? ? 1.59 41 6 O2 A C 4 ? ? H21 A G 19 ? ? 1.60 42 6 H21 A G 10 ? ? OP2 A A 13 ? ? 1.60 43 7 H22 A G 10 ? ? N7 A A 13 ? ? 1.44 44 7 H21 A G 1 ? ? O2 A C 22 ? ? 1.47 45 7 H21 A G 10 ? ? OP2 A A 13 ? ? 1.48 46 7 O4 A U 6 ? ? H3 A U 17 ? ? 1.48 47 7 O2 A C 5 ? ? H3 A U 18 ? ? 1.56 48 7 O6 A G 2 ? ? H41 A C 21 ? ? 1.57 49 7 H1 A G 2 ? ? N3 A C 21 ? ? 1.59 50 8 O2 A C 5 ? ? H3 A U 18 ? ? 1.41 51 8 H3 A U 6 ? ? O2 A U 17 ? ? 1.42 52 8 H21 A G 1 ? ? O2 A C 22 ? ? 1.49 53 8 O2 A C 4 ? ? H21 A G 19 ? ? 1.56 54 8 H1 A G 2 ? ? N3 A C 21 ? ? 1.57 55 9 H3 A U 6 ? ? O2 A U 17 ? ? 1.43 56 9 O2 A C 5 ? ? H3 A U 18 ? ? 1.47 57 9 H21 A G 1 ? ? O2 A C 22 ? ? 1.55 58 9 H22 A G 10 ? ? N7 A A 13 ? ? 1.56 59 9 H21 A G 10 ? ? OP2 A A 13 ? ? 1.57 60 9 O2 A C 4 ? ? H21 A G 19 ? ? 1.57 61 10 "HO2'" A G 10 ? ? OP1 A A 11 ? ? 1.48 62 10 H22 A G 10 ? ? N7 A A 13 ? ? 1.49 63 10 H3 A U 6 ? ? O2 A U 17 ? ? 1.53 64 10 H21 A G 1 ? ? O2 A C 22 ? ? 1.53 65 10 O2 A C 4 ? ? H21 A G 19 ? ? 1.55 66 10 O2 A C 5 ? ? H3 A U 18 ? ? 1.57 67 10 H1 A G 2 ? ? N3 A C 21 ? ? 1.59 68 11 H3 A U 6 ? ? O2 A U 17 ? ? 1.41 69 11 O2 A C 5 ? ? H3 A U 18 ? ? 1.47 70 11 H21 A G 1 ? ? O2 A C 22 ? ? 1.52 71 12 H21 A G 10 ? ? OP2 A A 13 ? ? 1.38 72 12 H22 A G 10 ? ? N7 A A 13 ? ? 1.43 73 12 H21 A G 1 ? ? O2 A C 22 ? ? 1.47 74 12 H1 A G 2 ? ? N3 A C 21 ? ? 1.53 75 12 O2 A C 4 ? ? H21 A G 19 ? ? 1.54 76 12 O4 A U 6 ? ? H3 A U 17 ? ? 1.55 77 12 O6 A G 2 ? ? H41 A C 21 ? ? 1.56 78 12 O2 A C 5 ? ? H3 A U 18 ? ? 1.56 79 12 H1 A G 1 ? ? N3 A C 22 ? ? 1.60 80 13 O4 A U 6 ? ? H3 A U 17 ? ? 1.42 81 13 H21 A G 1 ? ? O2 A C 22 ? ? 1.51 82 13 H41 A C 9 ? ? O6 A G 14 ? ? 1.59 83 13 O2 A C 4 ? ? H21 A G 19 ? ? 1.60 84 14 H3 A U 6 ? ? O2 A U 17 ? ? 1.42 85 14 H1 A G 2 ? ? N3 A C 21 ? ? 1.53 86 14 O2 A C 5 ? ? H3 A U 18 ? ? 1.53 87 14 H21 A G 1 ? ? O2 A C 22 ? ? 1.53 88 14 O6 A G 2 ? ? H41 A C 21 ? ? 1.54 89 14 H21 A G 10 ? ? OP2 A A 13 ? ? 1.57 90 14 H22 A G 10 ? ? N7 A A 13 ? ? 1.59 91 14 O6 A G 1 ? ? H41 A C 22 ? ? 1.59 92 14 O2 A C 4 ? ? H21 A G 19 ? ? 1.60 93 15 O4 A U 6 ? ? H3 A U 17 ? ? 1.46 94 15 H21 A G 1 ? ? O2 A C 22 ? ? 1.50 95 15 H21 A G 10 ? ? OP2 A A 13 ? ? 1.51 96 15 H3 A U 6 ? ? O2 A U 17 ? ? 1.51 97 15 O2 A C 5 ? ? H3 A U 18 ? ? 1.55 98 15 H22 A G 10 ? ? N7 A A 13 ? ? 1.59 99 15 O2 A C 7 ? ? H21 A G 16 ? ? 1.59 100 16 O2 A C 5 ? ? H3 A U 18 ? ? 1.36 101 16 H3 A U 6 ? ? O2 A U 17 ? ? 1.40 102 16 O2 A C 4 ? ? H21 A G 19 ? ? 1.52 103 16 H21 A G 1 ? ? O2 A C 22 ? ? 1.58 104 17 O4 A U 6 ? ? H3 A U 17 ? ? 1.48 105 17 H3 A U 6 ? ? O2 A U 17 ? ? 1.48 106 17 H21 A G 10 ? ? OP2 A A 13 ? ? 1.49 107 17 H22 A G 10 ? ? N7 A A 13 ? ? 1.56 108 18 "HO2'" A G 1 ? ? OP1 A G 2 ? ? 1.39 109 18 H21 A G 10 ? ? OP2 A A 13 ? ? 1.45 110 18 H3 A U 6 ? ? O2 A U 17 ? ? 1.49 111 18 O6 A G 2 ? ? H41 A C 21 ? ? 1.49 112 18 O2 A C 5 ? ? H3 A U 18 ? ? 1.51 113 18 H21 A G 2 ? ? O2 A C 21 ? ? 1.56 114 18 H22 A G 10 ? ? N7 A A 13 ? ? 1.58 115 18 O2 A C 4 ? ? H21 A G 19 ? ? 1.58 116 19 H21 A G 1 ? ? O2 A C 22 ? ? 1.46 117 19 H3 A U 6 ? ? O2 A U 17 ? ? 1.56 118 19 H21 A G 10 ? ? OP2 A A 13 ? ? 1.56 119 19 O2 A C 4 ? ? H21 A G 19 ? ? 1.59 120 20 O2 A C 4 ? ? H21 A G 19 ? ? 1.49 121 20 H3 A U 6 ? ? O2 A U 17 ? ? 1.52 122 20 H22 A G 10 ? ? N7 A A 13 ? ? 1.53 123 20 H21 A G 1 ? ? O2 A C 22 ? ? 1.54 # _pdbx_nmr_ensemble.entry_id 1N66 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1N66 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '3mM RNA' D2O 2 '3mM RNA' D2O 3 '3mM RNA' '90% H2O/10% D2O' 4 '1-2mM RNA, U-13C,15N, C-13C,15N' D2O # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 5.8 ? ? K 2 288 ambient 5.5 ? ? K 3 273 ambient 5.5 ? ? K 4 288 ambient 5.5 ? ? K # _pdbx_nmr_refine.entry_id 1N66 _pdbx_nmr_refine.method ;torsion angle dynamics followed by conjugate gradient minimization ; _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal VNMR 6.1 collection Varian 1 NMRPipe 2.1 processing Delaglio 2 XEASY 1.2.0 'data analysis' ETH-Zurich 3 X-PLOR 3.851 refinement Brunger 4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1N66 'double helix' 1N66 'a-form double helix' 1N66 tetraloop 1N66 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 22 1_555 -0.534 -0.544 0.009 -9.344 -9.935 -1.242 1 A_G1:C22_A A 1 ? A 22 ? 19 1 1 A G 2 1_555 A C 21 1_555 -0.569 -0.587 -0.019 7.895 -14.217 0.319 2 A_G2:C21_A A 2 ? A 21 ? 19 1 1 A A 3 1_555 A U 20 1_555 -0.102 -0.095 0.307 31.810 2.590 -1.764 3 A_A3:U20_A A 3 ? A 20 ? 20 1 1 A C 4 1_555 A G 19 1_555 0.297 -0.503 -1.112 5.421 3.687 0.050 4 A_C4:G19_A A 4 ? A 19 ? 19 1 1 A C 5 1_555 A U 18 1_555 2.534 -1.450 -0.648 -13.858 18.443 35.199 5 A_C5:U18_A A 5 ? A 18 ? ? ? 1 A U 6 1_555 A U 17 1_555 -2.896 -1.802 0.208 -32.016 -16.736 28.306 6 A_U6:U17_A A 6 ? A 17 ? 16 1 1 A C 7 1_555 A G 16 1_555 1.059 -0.324 -0.607 -0.921 -12.511 14.946 7 A_C7:G16_A A 7 ? A 16 ? 19 1 1 A U 8 1_555 A A 15 1_555 0.525 -0.346 -0.065 -0.888 8.651 -1.168 8 A_U8:A15_A A 8 ? A 15 ? 20 1 1 A C 9 1_555 A G 14 1_555 0.197 -0.559 -1.386 13.576 -14.249 4.461 9 A_C9:G14_A A 9 ? A 14 ? 19 1 1 A G 10 1_555 A A 13 1_555 6.566 -5.455 0.087 1.691 -1.138 -14.867 10 A_G10:A13_A A 10 ? A 13 ? ? 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 22 1_555 A G 2 1_555 A C 21 1_555 -0.935 -1.082 2.771 -4.275 3.043 37.746 -1.985 0.972 2.764 4.676 6.569 38.096 1 AA_G1G2:C21C22_AA A 1 ? A 22 ? A 2 ? A 21 ? 1 A G 2 1_555 A C 21 1_555 A A 3 1_555 A U 20 1_555 0.340 -1.172 2.684 -1.825 0.931 37.877 -1.899 -0.713 2.637 1.433 2.809 37.930 2 AA_G2A3:U20C21_AA A 2 ? A 21 ? A 3 ? A 20 ? 1 A A 3 1_555 A U 20 1_555 A C 4 1_555 A G 19 1_555 1.108 -2.114 3.801 9.902 12.443 26.135 -6.706 0.036 2.772 24.808 -19.742 30.521 3 AA_A3C4:G19U20_AA A 3 ? A 20 ? A 4 ? A 19 ? 1 A C 4 1_555 A G 19 1_555 A C 5 1_555 A U 18 1_555 1.774 -1.694 4.522 -12.308 9.828 32.691 -4.418 -4.974 3.063 16.332 20.453 36.194 4 AA_C4C5:U18G19_AA A 4 ? A 19 ? A 5 ? A 18 ? 1 A C 5 1_555 A U 18 1_555 A U 6 1_555 A U 17 1_555 -0.517 -2.918 3.109 -0.150 20.895 15.804 -9.382 1.121 -0.424 53.292 0.383 26.146 5 AA_C5U6:U17U18_AA A 5 ? A 18 ? A 6 ? A 17 ? 1 A U 6 1_555 A U 17 1_555 A C 7 1_555 A G 16 1_555 -0.509 0.046 2.217 7.852 10.707 45.208 -0.532 1.070 2.066 13.585 -9.963 47.020 6 AA_U6C7:G16U17_AA A 6 ? A 17 ? A 7 ? A 16 ? 1 A C 7 1_555 A G 16 1_555 A U 8 1_555 A A 15 1_555 -1.569 -1.184 3.083 -2.198 18.661 27.379 -4.776 2.436 2.008 34.719 4.089 33.105 7 AA_C7U8:A15G16_AA A 7 ? A 16 ? A 8 ? A 15 ? 1 A U 8 1_555 A A 15 1_555 A C 9 1_555 A G 14 1_555 1.604 -0.745 2.775 13.959 9.748 31.524 -2.511 -0.756 2.870 16.521 -23.658 35.725 8 AA_U8C9:G14A15_AA A 8 ? A 15 ? A 9 ? A 14 ? 1 A C 9 1_555 A G 14 1_555 A G 10 1_555 A A 13 1_555 -2.060 -0.258 4.069 -3.870 20.436 50.702 -1.844 1.952 3.849 22.796 4.317 54.540 9 AA_C9G10:A13G14_AA A 9 ? A 14 ? A 10 ? A 13 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Varian INOVA 750 2 ? Varian INOVA 600 3 ? Varian INOVA 500 # _atom_sites.entry_id 1N66 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_