data_1P5M # _entry.id 1P5M # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1P5M pdb_00001p5m 10.2210/pdb1p5m/pdb RCSB RCSB019036 ? ? WWPDB D_1000019036 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2003-11-04 2 'Structure model' 1 1 2008-04-29 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1P5M _pdbx_database_status.recvd_initial_deposition_date 2003-04-27 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lukavsky, P.J.' 1 'Kim, I.' 2 'Otto, G.A.' 3 'Puglisi, J.D.' 4 # _citation.id primary _citation.title 'Structure of HCV IRES domain II determined by NMR.' _citation.journal_abbrev Nat.Struct.Biol. _citation.journal_volume 10 _citation.page_first 1033 _citation.page_last 1038 _citation.year 2003 _citation.journal_id_ASTM NSBIEW _citation.country US _citation.journal_id_ISSN 1072-8368 _citation.journal_id_CSD 2024 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 14578934 _citation.pdbx_database_id_DOI 10.1038/nsb1004 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lukavsky, P.J.' 1 ? primary 'Kim, I.' 2 ? primary 'Otto, G.A.' 3 ? primary 'Puglisi, J.D.' 4 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 55-MER _entity.formula_weight 17625.432 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment 'HCV IRES domain IIa (residues 45-69,98-117)' _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCUGUGAGGAACUACUGUCUUCACGCCUUCGGGAGUGUCGUGCAGCCUCCAGCC _entity_poly.pdbx_seq_one_letter_code_can GGCUGUGAGGAACUACUGUCUUCACGCCUUCGGGAGUGUCGUGCAGCCUCCAGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 U n 1 5 G n 1 6 U n 1 7 G n 1 8 A n 1 9 G n 1 10 G n 1 11 A n 1 12 A n 1 13 C n 1 14 U n 1 15 A n 1 16 C n 1 17 U n 1 18 G n 1 19 U n 1 20 C n 1 21 U n 1 22 U n 1 23 C n 1 24 A n 1 25 C n 1 26 G n 1 27 C n 1 28 C n 1 29 U n 1 30 U n 1 31 C n 1 32 G n 1 33 G n 1 34 G n 1 35 A n 1 36 G n 1 37 U n 1 38 G n 1 39 U n 1 40 C n 1 41 G n 1 42 U n 1 43 G n 1 44 C n 1 45 A n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 C n 1 51 C n 1 52 A n 1 53 G n 1 54 C n 1 55 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'Synthesized by in vitro transcription from linearized plasmid DNA using T7 RNA polymerase' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G GUA A . n A 1 2 G 2 2 2 G GUA A . n A 1 3 C 3 3 3 C CYT A . n A 1 4 U 4 4 4 U URI A . n A 1 5 G 5 5 5 G GUA A . n A 1 6 U 6 6 6 U URI A . n A 1 7 G 7 7 7 G GUA A . n A 1 8 A 8 8 8 A ADE A . n A 1 9 G 9 9 9 G GUA A . n A 1 10 G 10 10 10 G GUA A . n A 1 11 A 11 11 11 A ADE A . n A 1 12 A 12 12 12 A ADE A . n A 1 13 C 13 13 13 C CYT A . n A 1 14 U 14 14 14 U URI A . n A 1 15 A 15 15 15 A ADE A . n A 1 16 C 16 16 16 C CYT A . n A 1 17 U 17 17 17 U URI A . n A 1 18 G 18 18 18 G GUA A . n A 1 19 U 19 19 19 U URI A . n A 1 20 C 20 20 20 C CYT A . n A 1 21 U 21 21 21 U URI A . n A 1 22 U 22 22 22 U URI A . n A 1 23 C 23 23 23 C CYT A . n A 1 24 A 24 24 24 A ADE A . n A 1 25 C 25 25 25 C CYT A . n A 1 26 G 26 26 26 G GUA A . n A 1 27 C 27 27 27 C CYT A . n A 1 28 C 28 28 28 C CYT A . n A 1 29 U 29 29 29 U URI A . n A 1 30 U 30 30 30 U URI A . n A 1 31 C 31 31 31 C CYT A . n A 1 32 G 32 32 32 G GUA A . n A 1 33 G 33 33 33 G GUA A . n A 1 34 G 34 34 34 G GUA A . n A 1 35 A 35 35 35 A ADE A . n A 1 36 G 36 36 36 G GUA A . n A 1 37 U 37 37 37 U URI A . n A 1 38 G 38 38 38 G GUA A . n A 1 39 U 39 39 39 U URI A . n A 1 40 C 40 40 40 C CYT A . n A 1 41 G 41 41 41 G GUA A . n A 1 42 U 42 42 42 U URI A . n A 1 43 G 43 43 43 G GUA A . n A 1 44 C 44 44 44 C CYT A . n A 1 45 A 45 45 45 A ADE A . n A 1 46 G 46 46 46 G GUA A . n A 1 47 C 47 47 47 C CYT A . n A 1 48 C 48 48 48 C CYT A . n A 1 49 U 49 49 49 U URI A . n A 1 50 C 50 50 50 C CYT A . n A 1 51 C 51 51 51 C CYT A . n A 1 52 A 52 52 52 A ADE A . n A 1 53 G 53 53 53 G GUA A . n A 1 54 C 54 54 54 C CYT A . n A 1 55 C 55 55 55 C CYT A . n # _exptl.entry_id 1P5M _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _database_PDB_matrix.entry_id 1P5M _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1P5M _struct.title 'Solution Structure of HCV IRES Domain IIa' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1P5M _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RIBONUCLEIC ACID, HEPATITIS C VIRUS, INTERNAL RIBOSOME ENTRY SITE, tRNA, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1P5M _struct_ref.pdbx_db_accession 1P5M _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1P5M _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 55 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1P5M _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 55 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 55 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 55 O2 ? ? A G 1 A C 55 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog2 hydrog ? ? A G 2 O6 ? ? ? 1_555 A G 53 N1 ? ? A G 2 A G 53 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 54 N3 ? ? A G 2 A C 54 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 53 N1 ? ? A C 3 A G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 53 O6 ? ? A C 3 A G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 53 N2 ? ? A C 3 A G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 52 N1 ? ? A U 4 A A 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 52 N6 ? ? A U 4 A A 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 51 N3 ? ? A G 5 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 51 O2 ? ? A G 5 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 51 N4 ? ? A G 5 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 50 N3 ? ? A G 7 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 50 O2 ? ? A G 7 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 7 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 7 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 49 N3 ? ? A A 8 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 49 O4 ? ? A A 8 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 9 A C 47 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog18 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 9 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 9 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 9 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 10 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 10 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 10 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 46 N1 ? ? A C 16 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 16 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 46 N2 ? ? A C 16 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 45 N1 ? ? A U 17 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 45 N6 ? ? A U 17 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 18 N1 ? ? ? 1_555 A C 44 N3 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 18 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 18 O6 ? ? ? 1_555 A C 44 N4 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 19 N3 ? ? ? 1_555 A G 43 O6 ? ? A U 19 A G 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog33 hydrog ? ? A U 19 O2 ? ? ? 1_555 A G 43 N1 ? ? A U 19 A G 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog34 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 41 N1 ? ? A C 20 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 41 O6 ? ? A C 20 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 41 N2 ? ? A C 20 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 21 N3 ? ? ? 1_555 A C 40 N3 ? ? A U 21 A C 40 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog38 hydrog ? ? A U 21 O4 ? ? ? 1_555 A C 40 N4 ? ? A U 21 A C 40 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog39 hydrog ? ? A U 22 O4 ? ? ? 1_555 A U 39 N3 ? ? A U 22 A U 39 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog40 hydrog ? ? A C 23 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 23 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 24 N1 ? ? ? 1_555 A U 37 N3 ? ? A A 24 A U 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 24 N6 ? ? ? 1_555 A U 37 O4 ? ? A A 24 A U 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 26 O6 ? ? ? 1_555 A A 35 N6 ? ? A G 26 A A 35 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog49 hydrog ? ? A C 27 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 27 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 27 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 27 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 27 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 27 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 28 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 28 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 28 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 28 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 28 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 28 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A U 29 O2 ? ? ? 1_555 A G 32 N1 ? ? A U 29 A G 32 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 18 O6 A G 18 ? ? H41 A C 44 ? ? 1.60 2 19 "HO2'" A G 26 ? ? "O4'" A C 27 ? ? 1.57 3 21 O6 A G 18 ? ? H41 A C 44 ? ? 1.59 # _pdbx_nmr_ensemble.entry_id 1P5M _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 22 _pdbx_nmr_ensemble.conformer_selection_criteria 'lowest restraint violation and total energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1P5M _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 ;1-2mM HCV IRES domain IIa RNA 10mM phosphate buffer 100mM sodium chloride 5mM magnesium chloride ; '96% D2O, 4% H2O' 2 ;1-2mM HCV IRES domain IIa RNA 10mM phosphate buffer 100mM sodium chloride 5mM magnesium chloride ; '100% D2O' 3 ;1mM HCV IRES domain IIa RNA U-15N,13C 10mM phosphate buffer 100mM sodium chloride 5mM magnesium chloride ; '96% D2O, 4% H2O' 4 ;1mM HCV IRES domain IIa RNA U-15N,13C 10mM phosphate buffer 100mM sodium chloride 5mM magnesium chloride ; '100% D2O' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 6.40 '100mM NaCl, 5mM MgCl2' ? K 2 298 ambient 6.40 '100mM NaCl, 5mM MgCl2' ? K 3 303 ambient 6.40 '100mM NaCl, 5mM MgCl2' ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 2 '2D S-NOESY' 2 2 2 '2D NOESY' 3 2 2 DQF-COSY 4 2 2 '2D HP-COSY' 5 4 3 3D_13C-separated_NOESY 6 4 3 '3D HCP' 7 4 3 '3D HMQC TOCSY' # _pdbx_nmr_details.entry_id 1P5M _pdbx_nmr_details.text ;The structure was solved using triple resonance, multidimensional NMR spectroscopy and TROSY-type experiments to measure residual dipolar couplings ; # _pdbx_nmr_refine.entry_id 1P5M _pdbx_nmr_refine.method 'see reference above' _pdbx_nmr_refine.details 'see reference above' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal VNMR 6.1C processing Varian 1 Sparky 3 'data analysis' 'Goddard, Kneller' 2 X-PLOR 3.1 refinement Brunger 3 CNS 1.1 refinement Brunger 4 PALES 1 refinement 'Zweckstetter, Bax' 5 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1P5M 'double helix' 1P5M 'a-form double helix' 1P5M tetraloop 1P5M 'bulge loop' 1P5M 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 55 1_555 -0.501 -0.148 0.385 43.754 -42.911 -2.445 1 A_G1:C55_A A 1 ? A 55 ? ? 1 1 A G 2 1_555 A C 54 1_555 0.502 -0.138 0.326 18.600 -34.850 -16.352 2 A_G2:C54_A A 2 ? A 54 ? ? ? 1 A C 3 1_555 A G 53 1_555 -0.579 -0.108 0.569 10.685 -30.524 1.887 3 A_C3:G53_A A 3 ? A 53 ? 19 1 1 A U 4 1_555 A A 52 1_555 -0.745 -0.122 0.552 15.715 -11.740 -6.044 4 A_U4:A52_A A 4 ? A 52 ? 20 1 1 A G 5 1_555 A C 51 1_555 0.380 -0.035 0.301 -6.240 -25.631 4.877 5 A_G5:C51_A A 5 ? A 51 ? 19 1 1 A G 7 1_555 A C 50 1_555 0.378 -0.005 -0.133 -17.598 -25.779 5.249 6 A_G7:C50_A A 7 ? A 50 ? 19 1 1 A A 8 1_555 A U 49 1_555 -0.215 -0.107 0.189 -20.611 -23.087 11.316 7 A_A8:U49_A A 8 ? A 49 ? 20 1 1 A G 9 1_555 A C 48 1_555 0.553 -0.038 0.100 -12.579 -23.360 4.560 8 A_G9:C48_A A 9 ? A 48 ? 19 1 1 A G 10 1_555 A C 47 1_555 0.464 -0.148 0.597 10.763 -9.433 -6.989 9 A_G10:C47_A A 10 ? A 47 ? 19 1 1 A C 16 1_555 A G 46 1_555 -0.302 -0.083 0.011 7.901 -27.520 4.727 10 A_C16:G46_A A 16 ? A 46 ? 19 1 1 A U 17 1_555 A A 45 1_555 0.708 -0.354 0.546 10.318 -17.800 5.084 11 A_U17:A45_A A 17 ? A 45 ? 20 1 1 A G 18 1_555 A C 44 1_555 0.214 -0.273 -0.294 5.878 -29.082 -6.006 12 A_G18:C44_A A 18 ? A 44 ? 19 1 1 A U 19 1_555 A G 43 1_555 2.196 -0.598 -0.338 -4.471 -16.719 -9.289 13 A_U19:G43_A A 19 ? A 43 ? 28 ? 1 A C 20 1_555 A G 41 1_555 -0.410 -0.140 -0.306 2.550 2.174 -5.579 14 A_C20:G41_A A 20 ? A 41 ? 19 1 1 A U 21 1_555 A C 40 1_555 -0.226 -1.592 -0.208 18.598 -12.085 18.879 15 A_U21:C40_A A 21 ? A 40 ? 18 1 1 A U 22 1_555 A U 39 1_555 -1.066 -1.564 -1.178 -1.887 -29.552 4.149 16 A_U22:U39_A A 22 ? A 39 ? ? ? 1 A C 23 1_555 A G 38 1_555 -0.577 -0.457 -1.337 5.020 -17.741 2.765 17 A_C23:G38_A A 23 ? A 38 ? 19 1 1 A A 24 1_555 A U 37 1_555 -0.325 -0.421 -0.621 0.063 -10.244 -0.455 18 A_A24:U37_A A 24 ? A 37 ? 20 1 1 A C 25 1_555 A G 36 1_555 -0.202 -0.167 -0.926 21.486 -14.962 -0.960 19 A_C25:G36_A A 25 ? A 36 ? 19 1 1 A G 26 1_555 A A 35 1_555 0.244 -3.956 1.955 7.012 -11.140 76.815 20 A_G26:A35_A A 26 ? A 35 ? ? ? 1 A C 27 1_555 A G 34 1_555 -0.371 -0.089 0.152 2.628 7.566 -0.344 21 A_C27:G34_A A 27 ? A 34 ? 19 1 1 A C 28 1_555 A G 33 1_555 -0.361 -0.347 -1.668 26.500 -6.335 -7.180 22 A_C28:G33_A A 28 ? A 33 ? 19 1 1 A U 29 1_555 A G 32 1_555 2.276 -4.053 -0.084 -2.444 -21.814 -79.769 23 A_U29:G32_A A 29 ? A 32 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 55 1_555 A G 2 1_555 A C 54 1_555 -0.721 -0.459 4.044 -1.887 15.795 36.671 -2.900 0.791 3.589 23.778 2.841 39.864 1 AA_G1G2:C54C55_AA A 1 ? A 55 ? A 2 ? A 54 ? 1 A G 2 1_555 A C 54 1_555 A C 3 1_555 A G 53 1_555 1.789 -1.244 2.960 3.449 -5.777 37.375 -1.206 -2.329 3.256 -8.926 -5.329 37.954 2 AA_G2C3:G53C54_AA A 2 ? A 54 ? A 3 ? A 53 ? 1 A C 3 1_555 A G 53 1_555 A U 4 1_555 A A 52 1_555 0.137 -1.348 3.231 -3.781 -7.197 28.853 -1.068 -1.074 3.415 -14.093 7.404 29.953 3 AA_C3U4:A52G53_AA A 3 ? A 53 ? A 4 ? A 52 ? 1 A U 4 1_555 A A 52 1_555 A G 5 1_555 A C 51 1_555 0.345 -1.787 3.604 2.726 2.688 34.465 -3.446 -0.125 3.475 4.520 -4.583 34.671 4 AA_U4G5:C51A52_AA A 4 ? A 52 ? A 5 ? A 51 ? 1 A G 5 1_555 A C 51 1_555 A G 7 1_555 A C 50 1_555 -0.807 -0.879 3.231 0.953 9.196 36.257 -2.526 1.380 2.908 14.490 -1.502 37.379 5 AA_G5G7:C50C51_AA A 5 ? A 51 ? A 7 ? A 50 ? 1 A G 7 1_555 A C 50 1_555 A A 8 1_555 A U 49 1_555 0.190 -0.923 2.896 -1.586 8.528 38.073 -2.262 -0.448 2.628 12.869 2.393 39.013 6 AA_G7A8:U49C50_AA A 7 ? A 50 ? A 8 ? A 49 ? 1 A A 8 1_555 A U 49 1_555 A G 9 1_555 A C 48 1_555 -0.693 -0.677 2.844 -0.322 9.370 32.342 -2.460 1.153 2.560 16.396 0.563 33.639 7 AA_A8G9:C48U49_AA A 8 ? A 49 ? A 9 ? A 48 ? 1 A G 9 1_555 A C 48 1_555 A G 10 1_555 A C 47 1_555 -0.064 -0.734 2.417 -3.943 2.948 33.473 -1.610 -0.356 2.338 5.084 6.801 33.822 8 AA_G9G10:C47C48_AA A 9 ? A 48 ? A 10 ? A 47 ? 1 A C 16 1_555 A G 46 1_555 A U 17 1_555 A A 45 1_555 -0.237 -0.289 3.169 -4.426 16.183 36.883 -2.167 -0.135 2.816 24.108 6.593 40.399 9 AA_C16U17:A45G46_AA A 16 ? A 46 ? A 17 ? A 45 ? 1 A U 17 1_555 A A 45 1_555 A G 18 1_555 A C 44 1_555 -0.693 -0.959 3.043 7.133 17.328 32.768 -3.395 1.860 2.105 28.043 -11.543 37.620 10 AA_U17G18:C44A45_AA A 17 ? A 45 ? A 18 ? A 44 ? 1 A G 18 1_555 A C 44 1_555 A U 19 1_555 A G 43 1_555 0.805 -0.795 3.289 2.630 -2.913 51.025 -0.716 -0.747 3.361 -3.375 -3.048 51.166 11 AA_G18U19:G43C44_AA A 18 ? A 44 ? A 19 ? A 43 ? 1 A U 19 1_555 A G 43 1_555 A C 20 1_555 A G 41 1_555 0.510 -1.679 3.158 -1.859 1.888 26.680 -4.080 -1.552 2.992 4.078 4.016 26.809 12 AA_U19C20:G41G43_AA A 19 ? A 43 ? A 20 ? A 41 ? 1 A C 20 1_555 A G 41 1_555 A U 21 1_555 A C 40 1_555 1.210 0.465 2.992 -2.785 20.597 29.859 -2.005 -2.317 2.645 35.126 4.750 36.245 13 AA_C20U21:C40G41_AA A 20 ? A 41 ? A 21 ? A 40 ? 1 A U 21 1_555 A C 40 1_555 A U 22 1_555 A U 39 1_555 -0.613 -0.712 4.374 9.462 5.801 37.199 -1.997 2.430 3.957 8.855 -14.443 38.763 14 AA_U21U22:U39C40_AA A 21 ? A 40 ? A 22 ? A 39 ? 1 A U 22 1_555 A U 39 1_555 A C 23 1_555 A G 38 1_555 -0.707 -0.497 2.898 -1.495 7.659 35.354 -1.745 0.955 2.761 12.426 2.425 36.178 15 AA_U22C23:G38U39_AA A 22 ? A 39 ? A 23 ? A 38 ? 1 A C 23 1_555 A G 38 1_555 A A 24 1_555 A U 37 1_555 -0.103 0.325 3.657 -5.757 21.579 26.020 -3.441 -0.891 3.022 39.854 10.632 34.164 16 AA_C23A24:U37G38_AA A 23 ? A 38 ? A 24 ? A 37 ? 1 A A 24 1_555 A U 37 1_555 A C 25 1_555 A G 36 1_555 0.692 -0.941 2.663 2.172 -0.266 37.034 -1.450 -0.849 2.705 -0.418 -3.416 37.096 17 AA_A24C25:G36U37_AA A 24 ? A 37 ? A 25 ? A 36 ? 1 A C 25 1_555 A G 36 1_555 A G 26 1_555 A A 35 1_555 -0.651 4.469 -0.509 166.887 -16.200 -179.505 -2.234 -0.327 -0.504 8.100 83.443 -179.947 18 AA_C25G26:A35G36_AA A 25 ? A 36 ? A 26 ? A 35 ? 1 A G 26 1_555 A A 35 1_555 A C 27 1_555 A G 34 1_555 -3.455 -2.814 -3.168 144.670 -90.111 -16.316 0.909 -2.541 0.979 47.224 75.816 -170.536 19 AA_G26C27:G34A35_AA A 26 ? A 35 ? A 27 ? A 34 ? 1 A C 27 1_555 A G 34 1_555 A C 28 1_555 A G 33 1_555 0.032 -1.105 2.736 10.509 1.194 28.165 -2.335 1.735 2.536 2.351 -20.694 30.048 20 AA_C27C28:G33G34_AA A 27 ? A 34 ? A 28 ? A 33 ? 1 A C 28 1_555 A G 33 1_555 A U 29 1_555 A G 32 1_555 1.860 -1.912 3.623 1.935 12.540 101.229 -1.436 -1.167 3.463 8.090 -1.248 101.804 21 AA_C28U29:G32G33_AA A 28 ? A 33 ? A 29 ? A 32 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Varian INOVA 500 2 ? Varian INOVA 800 # _atom_sites.entry_id 1P5M _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_