data_1RMN # _entry.id 1RMN # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.386 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1RMN pdb_00001rmn 10.2210/pdb1rmn/pdb WWPDB D_1000176124 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1995-01-26 2 'Structure model' 1 1 2008-03-24 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2024-02-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_database_status # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1RMN _pdbx_database_status.recvd_initial_deposition_date 1994-10-20 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Tuschl, T.' 1 'Gohlke, C.' 2 'Jovin, T.M.' 3 'Westhof, E.' 4 'Eckstein, F.' 5 # _citation.id primary _citation.title 'A three-dimensional model for the hammerhead ribozyme based on fluorescence measurements.' _citation.journal_abbrev Science _citation.journal_volume 266 _citation.page_first 785 _citation.page_last 789 _citation.year 1994 _citation.journal_id_ASTM SCIEAS _citation.country US _citation.journal_id_ISSN 0036-8075 _citation.journal_id_CSD 0038 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 7973630 _citation.pdbx_database_id_DOI ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tuschl, T.' 1 ? primary 'Gohlke, C.' 2 ? primary 'Jovin, T.M.' 3 ? primary 'Westhof, E.' 4 ? primary 'Eckstein, F.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (49-MER)' _entity.formula_weight 15858.540 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GCGCUCUGAUGAGGCCGCAAGGCCGAAACUGCCGCAAGGCAGUCAGCGC _entity_poly.pdbx_seq_one_letter_code_can GCGCUCUGAUGAGGCCGCAAGGCCGAAACUGCCGCAAGGCAGUCAGCGC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 C n 1 3 G n 1 4 C n 1 5 U n 1 6 C n 1 7 U n 1 8 G n 1 9 A n 1 10 U n 1 11 G n 1 12 A n 1 13 G n 1 14 G n 1 15 C n 1 16 C n 1 17 G n 1 18 C n 1 19 A n 1 20 A n 1 21 G n 1 22 G n 1 23 C n 1 24 C n 1 25 G n 1 26 A n 1 27 A n 1 28 A n 1 29 C n 1 30 U n 1 31 G n 1 32 C n 1 33 C n 1 34 G n 1 35 C n 1 36 A n 1 37 A n 1 38 G n 1 39 G n 1 40 C n 1 41 A n 1 42 G n 1 43 U n 1 44 C n 1 45 A n 1 46 G n 1 47 C n 1 48 G n 1 49 C n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 C 2 2 2 C C A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 A 9 9 9 A A A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 A 12 12 12 A A A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 A 28 28 28 A A A . n A 1 29 C 29 29 29 C C A . n A 1 30 U 30 30 30 U U A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 C 33 33 33 C C A . n A 1 34 G 34 34 34 G G A . n A 1 35 C 35 35 35 C C A . n A 1 36 A 36 36 36 A A A . n A 1 37 A 37 37 37 A A A . n A 1 38 G 38 38 38 G G A . n A 1 39 G 39 39 39 G G A . n A 1 40 C 40 40 40 C C A . n A 1 41 A 41 41 41 A A A . n A 1 42 G 42 42 42 G G A . n A 1 43 U 43 43 43 U U A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 G 46 46 46 G G A . n A 1 47 C 47 47 47 C C A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal NUCLIN/NUCLSQ refinement . ? 1 NUCLIN refinement . ? 2 NUCLSQ refinement . ? 3 # _cell.entry_id 1RMN _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1RMN _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1RMN _exptl.method 'FLUORESCENCE TRANSFER' _exptl.crystals_number ? # _refine.entry_id 1RMN _refine.pdbx_refine_id 'FLUORESCENCE TRANSFER' _refine.ls_d_res_high . _refine.details ;FLUORESCENCE RESONANCE ENERGY TRANSFER (FRET) WAS USED TO STUDY THE STRUCTURE OF THE RIBOZYME IN SOLUTION IN ORDER TO ESTABLISH THE RELATIVE SPATIAL ORIENTATION OF THE THREE CONSTITUENT WATSON-CRICK BASE-PAIRED HELICAL SEGMENTS. ; _refine.pdbx_diffrn_id ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs ? _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low ? _refine.ls_percent_reflns_obs ? _refine.ls_R_factor_obs ? _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work ? _refine.ls_R_factor_R_free ? _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free ? _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _database_PDB_matrix.entry_id 1RMN _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1RMN _struct.title 'A THREE-DIMENSIONAL MODEL FOR THE HAMMERHEAD RIBOZYME BASED ON FLUORESCENCE MEASUREMENTS' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1RMN _struct_keywords.pdbx_keywords 'RIBONUCLEIC ACID(HAMMERHEAD RIBOZYME)' _struct_keywords.text 'RIBONUCLEIC ACID(HAMMERHEAD RIBOZYME)' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1RMN _struct_ref.pdbx_db_accession 1RMN _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1RMN _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 49 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1RMN _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 49 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 49 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 1 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 1 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 1 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 48 N1 ? ? A C 2 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 48 O6 ? ? A C 2 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 48 N2 ? ? A C 2 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 3 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 3 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 3 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 46 N1 ? ? A C 4 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 4 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 46 N2 ? ? A C 4 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 45 N1 ? ? A U 5 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 45 N6 ? ? A U 5 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 8 N2 ? ? ? 1_555 A A 28 N7 ? ? A G 8 A A 28 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 26 N7 ? ? A U 10 A A 26 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 26 N6 ? ? A U 10 A A 26 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog18 hydrog ? ? A A 12 N6 ? ? ? 1_555 A G 25 O6 ? ? A A 12 A G 25 1_555 ? ? ? ? ? ? TYPE_9_PAIR ? ? ? hydrog19 hydrog ? ? A A 12 N7 ? ? ? 1_555 A G 25 N1 ? ? A A 12 A G 25 1_555 ? ? ? ? ? ? TYPE_9_PAIR ? ? ? hydrog20 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 13 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 13 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 13 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 14 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 14 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 14 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 15 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 15 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 15 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 17 N2 ? ? ? 1_555 A A 20 N7 ? ? A G 17 A A 20 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog33 hydrog ? ? A G 17 N3 ? ? ? 1_555 A A 20 N6 ? ? A G 17 A A 20 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog34 hydrog ? ? A A 28 N1 ? ? ? 1_555 A U 43 N3 ? ? A A 28 A U 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 28 N6 ? ? ? 1_555 A U 43 O4 ? ? A A 28 A U 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 29 N3 ? ? ? 1_555 A G 42 N1 ? ? A C 29 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 29 N4 ? ? ? 1_555 A G 42 O6 ? ? A C 29 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 29 O2 ? ? ? 1_555 A G 42 N2 ? ? A C 29 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 30 N3 ? ? ? 1_555 A A 41 N1 ? ? A U 30 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 30 O4 ? ? ? 1_555 A A 41 N6 ? ? A U 30 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 31 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 31 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 31 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 39 N1 ? ? A C 32 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 39 O6 ? ? A C 32 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 39 N2 ? ? A C 32 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 33 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 33 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 33 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 33 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 33 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 33 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 34 N2 ? ? ? 1_555 A A 37 N7 ? ? A G 34 A A 37 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog51 hydrog ? ? A G 34 N3 ? ? ? 1_555 A A 37 N6 ? ? A G 34 A A 37 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A G 1 ? ? "C1'" A G 1 ? ? N9 A G 1 ? ? 112.82 108.50 4.32 0.70 N 2 1 C2 A U 5 ? ? N3 A U 5 ? ? C4 A U 5 ? ? 122.55 127.00 -4.45 0.60 N 3 1 N3 A U 5 ? ? C4 A U 5 ? ? C5 A U 5 ? ? 119.03 114.60 4.43 0.60 N 4 1 "O4'" A U 7 ? ? "C1'" A U 7 ? ? N1 A U 7 ? ? 112.77 108.50 4.27 0.70 N 5 1 C2 A U 7 ? ? N3 A U 7 ? ? C4 A U 7 ? ? 122.33 127.00 -4.67 0.60 N 6 1 N3 A U 7 ? ? C4 A U 7 ? ? C5 A U 7 ? ? 119.21 114.60 4.61 0.60 N 7 1 "O4'" A G 8 ? ? "C1'" A G 8 ? ? N9 A G 8 ? ? 112.91 108.50 4.41 0.70 N 8 1 "O4'" A A 9 ? ? "C1'" A A 9 ? ? N9 A A 9 ? ? 112.83 108.50 4.33 0.70 N 9 1 N1 A A 9 ? ? C2 A A 9 ? ? N3 A A 9 ? ? 126.15 129.30 -3.15 0.50 N 10 1 C2 A U 10 ? ? N3 A U 10 ? ? C4 A U 10 ? ? 122.25 127.00 -4.75 0.60 N 11 1 N3 A U 10 ? ? C4 A U 10 ? ? C5 A U 10 ? ? 119.06 114.60 4.46 0.60 N 12 1 N1 A A 12 ? ? C2 A A 12 ? ? N3 A A 12 ? ? 126.02 129.30 -3.28 0.50 N 13 1 C5 A G 14 ? ? C6 A G 14 ? ? N1 A G 14 ? ? 114.56 111.50 3.06 0.50 N 14 1 N1 A A 19 ? ? C2 A A 19 ? ? N3 A A 19 ? ? 126.19 129.30 -3.11 0.50 N 15 1 N1 A A 20 ? ? C2 A A 20 ? ? N3 A A 20 ? ? 126.22 129.30 -3.08 0.50 N 16 1 C5 A G 22 ? ? C6 A G 22 ? ? N1 A G 22 ? ? 114.54 111.50 3.04 0.50 N 17 1 N1 A A 26 ? ? C2 A A 26 ? ? N3 A A 26 ? ? 126.30 129.30 -3.00 0.50 N 18 1 N1 A A 27 ? ? C2 A A 27 ? ? N3 A A 27 ? ? 126.18 129.30 -3.12 0.50 N 19 1 N1 A A 28 ? ? C2 A A 28 ? ? N3 A A 28 ? ? 126.29 129.30 -3.01 0.50 N 20 1 C2 A U 30 ? ? N3 A U 30 ? ? C4 A U 30 ? ? 122.37 127.00 -4.63 0.60 N 21 1 N3 A U 30 ? ? C4 A U 30 ? ? C5 A U 30 ? ? 119.20 114.60 4.60 0.60 N 22 1 N1 A A 36 ? ? C2 A A 36 ? ? N3 A A 36 ? ? 126.17 129.30 -3.13 0.50 N 23 1 N1 A A 37 ? ? C2 A A 37 ? ? N3 A A 37 ? ? 126.19 129.30 -3.11 0.50 N 24 1 N1 A A 41 ? ? C2 A A 41 ? ? N3 A A 41 ? ? 126.22 129.30 -3.08 0.50 N 25 1 C5 A G 42 ? ? C6 A G 42 ? ? N1 A G 42 ? ? 114.53 111.50 3.03 0.50 N 26 1 C2 A U 43 ? ? N3 A U 43 ? ? C4 A U 43 ? ? 122.15 127.00 -4.85 0.60 N 27 1 N3 A U 43 ? ? C4 A U 43 ? ? C5 A U 43 ? ? 119.38 114.60 4.78 0.60 N 28 1 "O4'" A A 45 ? ? "C1'" A A 45 ? ? N9 A A 45 ? ? 114.35 108.50 5.85 0.70 N 29 1 N1 A A 45 ? ? C2 A A 45 ? ? N3 A A 45 ? ? 126.00 129.30 -3.30 0.50 N 30 1 "O4'" A G 46 ? ? "C1'" A G 46 ? ? N9 A G 46 ? ? 112.81 108.50 4.31 0.70 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1RMN 'double helix' 1RMN 'a-form double helix' 1RMN tetraloop 1RMN 'mismatched base pair' 1RMN 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 49 1_555 -0.078 -0.113 0.078 0.879 15.597 -0.657 1 A_G1:C49_A A 1 ? A 49 ? 19 1 1 A C 2 1_555 A G 48 1_555 0.075 -0.114 0.087 0.230 14.880 -0.700 2 A_C2:G48_A A 2 ? A 48 ? 19 1 1 A G 3 1_555 A C 47 1_555 -0.080 -0.110 0.078 1.721 13.346 -1.093 3 A_G3:C47_A A 3 ? A 47 ? 19 1 1 A C 4 1_555 A G 46 1_555 0.047 -0.107 -0.082 5.291 13.213 -1.257 4 A_C4:G46_A A 4 ? A 46 ? 19 1 1 A U 5 1_555 A A 45 1_555 0.111 -0.093 0.071 13.465 15.896 -1.104 5 A_U5:A45_A A 5 ? A 45 ? 20 1 1 A U 10 1_555 A A 26 1_555 4.032 -1.798 -0.405 -8.752 -11.184 -96.496 6 A_U10:A26_A A 10 ? A 26 ? 24 4 1 A A 12 1_555 A G 25 1_555 2.333 -1.999 -2.489 -19.150 14.567 127.747 7 A_A12:G25_A A 12 ? A 25 ? 9 ? 1 A G 13 1_555 A C 24 1_555 -0.050 -0.146 0.528 -0.897 5.504 -0.771 8 A_G13:C24_A A 13 ? A 24 ? 19 1 1 A G 14 1_555 A C 23 1_555 -0.038 -0.164 0.742 5.829 1.528 -1.981 9 A_G14:C23_A A 14 ? A 23 ? 19 1 1 A C 15 1_555 A G 22 1_555 0.081 -0.114 0.317 -2.660 9.962 -0.610 10 A_C15:G22_A A 15 ? A 22 ? 19 1 1 A C 16 1_555 A G 21 1_555 0.084 -0.115 0.223 -1.389 14.211 -0.138 11 A_C16:G21_A A 16 ? A 21 ? 19 1 1 A G 17 1_555 A A 20 1_555 6.515 -4.294 0.426 26.685 3.597 2.803 12 A_G17:A20_A A 17 ? A 20 ? 11 9 1 A A 28 1_555 A U 43 1_555 -0.134 -0.076 -0.032 -6.772 1.888 -3.453 13 A_A28:U43_A A 28 ? A 43 ? 20 1 1 A C 29 1_555 A G 42 1_555 0.073 -0.111 0.221 -0.797 9.601 -0.853 14 A_C29:G42_A A 29 ? A 42 ? 19 1 1 A U 30 1_555 A A 41 1_555 0.168 -0.105 0.314 -2.162 7.027 -2.399 15 A_U30:A41_A A 30 ? A 41 ? 20 1 1 A G 31 1_555 A C 40 1_555 -0.079 -0.120 0.261 -0.282 12.852 -0.118 16 A_G31:C40_A A 31 ? A 40 ? 19 1 1 A C 32 1_555 A G 39 1_555 0.086 -0.113 0.207 -2.571 13.916 -0.466 17 A_C32:G39_A A 32 ? A 39 ? 19 1 1 A C 33 1_555 A G 38 1_555 0.078 -0.116 0.156 0.399 14.956 -0.199 18 A_C33:G38_A A 33 ? A 38 ? 19 1 1 A G 34 1_555 A A 37 1_555 6.523 -4.276 0.492 27.926 0.432 2.878 19 A_G34:A37_A A 34 ? A 37 ? 11 9 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 49 1_555 A C 2 1_555 A G 48 1_555 -0.294 -2.182 3.426 0.405 8.690 34.633 -4.780 0.536 2.811 14.319 -0.668 35.676 1 AA_G1C2:G48C49_AA A 1 ? A 49 ? A 2 ? A 48 ? 1 A C 2 1_555 A G 48 1_555 A G 3 1_555 A C 47 1_555 -0.038 -1.915 3.298 1.097 8.623 33.931 -4.403 0.218 2.742 14.483 -1.842 34.995 2 AA_C2G3:C47G48_AA A 2 ? A 48 ? A 3 ? A 47 ? 1 A G 3 1_555 A C 47 1_555 A C 4 1_555 A G 46 1_555 -0.206 -1.578 3.256 2.538 10.476 35.337 -3.808 0.644 2.675 16.782 -4.065 36.895 3 AA_G3C4:G46C47_AA A 3 ? A 47 ? A 4 ? A 46 ? 1 A C 4 1_555 A G 46 1_555 A U 5 1_555 A A 45 1_555 0.004 -1.588 3.213 -3.192 0.075 26.715 -3.432 -0.812 3.186 0.162 6.877 26.902 4 AA_C4U5:A45G46_AA A 4 ? A 46 ? A 5 ? A 45 ? 1 A A 12 1_555 A G 25 1_555 A G 13 1_555 A C 24 1_555 2.883 0.944 3.295 -108.849 98.641 -134.935 -0.922 0.957 3.617 -50.127 -55.315 -167.465 5 AA_A12G13:C24G25_AA A 12 ? A 25 ? A 13 ? A 24 ? 1 A G 13 1_555 A C 24 1_555 A G 14 1_555 A C 23 1_555 1.536 -0.849 2.951 0.297 6.998 28.745 -2.962 -2.955 2.689 13.838 -0.586 29.568 6 AA_G13G14:C23C24_AA A 13 ? A 24 ? A 14 ? A 23 ? 1 A G 14 1_555 A C 23 1_555 A C 15 1_555 A G 22 1_555 0.415 -1.710 3.575 0.129 4.195 33.616 -3.652 -0.691 3.345 7.219 -0.223 33.869 7 AA_G14C15:G22C23_AA A 14 ? A 23 ? A 15 ? A 22 ? 1 A C 15 1_555 A G 22 1_555 A C 16 1_555 A G 21 1_555 -0.377 -1.707 3.294 -0.790 7.437 30.707 -4.445 0.554 2.822 13.788 1.465 31.584 8 AA_C15C16:G21G22_AA A 15 ? A 22 ? A 16 ? A 21 ? 1 A C 16 1_555 A G 21 1_555 A G 17 1_555 A A 20 1_555 -0.382 -1.010 3.047 0.917 0.987 50.920 -1.238 0.503 3.021 1.147 -1.066 50.937 9 AA_C16G17:A20G21_AA A 16 ? A 21 ? A 17 ? A 20 ? 1 A A 28 1_555 A U 43 1_555 A C 29 1_555 A G 42 1_555 0.416 -1.847 2.989 -3.187 13.190 36.261 -4.116 -0.949 2.169 20.338 4.913 38.637 10 AA_A28C29:G42U43_AA A 28 ? A 43 ? A 29 ? A 42 ? 1 A C 29 1_555 A G 42 1_555 A U 30 1_555 A A 41 1_555 -0.441 -2.022 3.326 -1.178 7.002 37.649 -3.930 0.529 2.930 10.733 1.806 38.289 11 AA_C29U30:A41G42_AA A 29 ? A 42 ? A 30 ? A 41 ? 1 A U 30 1_555 A A 41 1_555 A G 31 1_555 A C 40 1_555 0.190 -1.864 3.280 -0.592 6.837 34.178 -4.099 -0.402 2.861 11.490 0.995 34.840 12 AA_U30G31:C40A41_AA A 30 ? A 41 ? A 31 ? A 40 ? 1 A G 31 1_555 A C 40 1_555 A C 32 1_555 A G 39 1_555 0.147 -1.989 3.442 0.374 8.035 35.271 -4.325 -0.185 2.934 13.051 -0.608 36.148 13 AA_G31C32:G39C40_AA A 31 ? A 40 ? A 32 ? A 39 ? 1 A C 32 1_555 A G 39 1_555 A C 33 1_555 A G 38 1_555 -0.134 -1.820 3.296 0.156 9.561 30.244 -4.964 0.273 2.613 17.774 -0.289 31.686 14 AA_C32C33:G38G39_AA A 32 ? A 39 ? A 33 ? A 38 ? 1 A C 33 1_555 A G 38 1_555 A G 34 1_555 A A 37 1_555 -0.270 -0.858 2.769 3.400 6.604 51.025 -1.360 0.503 2.625 7.620 -3.923 51.527 15 AA_C33G34:A37G38_AA A 33 ? A 38 ? A 34 ? A 37 ? # _atom_sites.entry_id 1RMN _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_ #