data_1XST # _entry.id 1XST # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1XST pdb_00001xst 10.2210/pdb1xst/pdb RCSB RCSB030726 ? ? WWPDB D_1000030726 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1F6X 'Solution structure of wildtype RNase P RNA P4 oligoribonucleotide' unspecified PDB 1F78 'Solution structure of wildtype RNase P RNA P4 oligoribonucleotide, complexed with cobalt (III) hexammine' unspecified PDB 1XSU 'U69C/C70U mutations' unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1XST _pdbx_database_status.recvd_initial_deposition_date 2004-10-20 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site PDBJ _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _audit_author.name 'Schmitz, M.' _audit_author.pdbx_ordinal 1 # _citation.id primary _citation.title ;Change of RNase P RNA function by single base mutation correlates with perturbation of metal ion binding in P4 as determined by NMR spectroscopy ; _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 32 _citation.page_first 6358 _citation.page_last 6366 _citation.year 2004 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 15576680 _citation.pdbx_database_id_DOI 10.1093/nar/gkh961 # _citation_author.citation_id primary _citation_author.name 'Schmitz, M.' _citation_author.ordinal 1 _citation_author.identifier_ORCID ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (27-MER)' 8656.183 1 ? U69A ? ? 2 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 1 ? ? ? ? # _entity_name_com.entity_id 1 _entity_name_com.name 'RNase P RNA P4 stem' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAAGACCGGUCUUCGGACCGGCUUCC _entity_poly.pdbx_seq_one_letter_code_can GGAAGACCGGUCUUCGGACCGGCUUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 A n 1 5 G n 1 6 A n 1 7 C n 1 8 C n 1 9 G n 1 10 G n 1 11 U n 1 12 C n 1 13 U n 1 14 U n 1 15 C n 1 16 G n 1 17 G n 1 18 A n 1 19 C n 1 20 C n 1 21 G n 1 22 G n 1 23 C n 1 24 U n 1 25 U n 1 26 C n 1 27 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'enzymatically synthesized from DNA oligonucleotide template ny T7 RNA polymerase' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1XST _struct_ref.pdbx_db_accession 1XST _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1XST _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1XST _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6 3' 161.116 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 2 1 '2D NOESY' 3 3 2 '2D NOESY' 4 2 1 DQF-COSY 5 2 1 31P-1H-Hetero-COSY 6 2 1 31P-1H-Hetero-TOCSY-NOESY # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 6.4 '100 mM NaCl' ? K 2 288 ambient 6.4 '100 mM NaCl, 6 mM Co(NH3)6Cl' ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2mM P4 U69A RNA; 100mM NaCl; 10mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' 2 '2mM P4 U69A RNA; 100mM NaCl; 10mM phosphate buffer; 100% D2O' '100% D2O' 3 '2mM P4 U69A RNA; 100mM NaCl; 6mM hexammine cobalt chloride; 10mM phosphate buffer; 90% H2O, 10% D2O' '90% H2O/10% D2O' # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model DMX _pdbx_nmr_spectrometer.field_strength 600 # _pdbx_nmr_refine.entry_id 1XST _pdbx_nmr_refine.method 'restrained molecular dynamics and simulated annealing' _pdbx_nmr_refine.details ;The average structure is based on the superposition of 14 structures after refinement. The average RMS deviation between the ensemble and the average structure is 1.85 Angstrom. A total of 290 NOE-derived distance constraints, 245 dihedral constraints and 48 distance constraints from hydrogen bonds were used in refinement. 15 NOE derived intermolecular distance constraints were used to localize the bound cobalt (III) hexammine. ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_details.entry_id 1XST _pdbx_nmr_details.text ;The structure was determined using standard 2D homonuclear techniques as well as 13C and 31P heteronuclear experiments performed at natural abundance. Intermolecular NOE crosspeaks between RNA protons and cobalt (III) hexammine protons and intermolecular distance constraints derived thereof were used to determine the site of cobalt (III) hexammine binding. ; # _pdbx_nmr_ensemble.entry_id 1XST _pdbx_nmr_ensemble.conformers_calculated_total_number ? _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria ? # _pdbx_nmr_representative.entry_id 1XST _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'minimized average structure' # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal XwinNMR 1.2 collection Bruker 1 NMRPipe 2.1 processing 'F. Delaglio' 2 X-PLOR 3.1 'structure solution' 'A. Bruenger' 3 X-PLOR 3.1 refinement 'A. Bruenger' 4 # _exptl.entry_id 1XST _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 1XST _struct.title 'Solution structure of E.coli RNase P RNA P4 stem, U69A mutation, complexed with cobalt (III) hexammine.' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details 'minimized average' # _struct_keywords.entry_id 1XST _struct_keywords.pdbx_keywords RNA _struct_keywords.text ;Ribonuclease P RNA, Ribozyme, transfer RNA processing, P4 stem, U69A mutant, metal binding site, metal complex, cobalt (III) hexammine complex, RNA ; # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 2 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 25 N3 ? ? A A 3 A U 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 25 O4 ? ? A A 3 A U 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 24 N3 ? ? A A 4 A U 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 24 O4 ? ? A A 4 A U 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N2 ? ? ? 1_555 A A 6 N7 ? ? A G 5 A A 6 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 A C 23 O2 ? ? A A 6 A C 23 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog16 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 7 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 7 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 7 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 8 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 9 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 18 N1 ? ? A U 11 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 18 N6 ? ? A U 11 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 13 O2 ? ? ? 1_555 A G 16 N1 ? ? A U 13 A G 16 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog34 hydrog ? ? A U 13 O2 ? ? ? 1_555 A G 17 N1 ? ? A U 13 A G 17 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id NCO _struct_site.pdbx_auth_seq_id 28 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 3 _struct_site.details 'BINDING SITE FOR RESIDUE NCO A 28' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 3 G A 9 ? G A 9 . ? 1_555 ? 2 AC1 3 C A 20 ? C A 20 . ? 1_555 ? 3 AC1 3 G A 21 ? G A 21 . ? 1_555 ? # _database_PDB_matrix.entry_id 1XST _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1XST _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CO H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 C 8 8 8 C C A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 U 24 24 24 U U A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id NCO _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 28 _pdbx_nonpoly_scheme.auth_seq_num 28 _pdbx_nonpoly_scheme.pdb_mon_id NCO _pdbx_nonpoly_scheme.auth_mon_id NCO _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2004-12-28 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-02 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' 4 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 5 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 6 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1XST 'double helix' 1XST 'a-form double helix' 1XST 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 27 1_555 -0.342 -0.484 -0.555 23.335 0.816 -0.768 1 A_G1:C27_A A 1 ? A 27 ? 19 1 1 A G 2 1_555 A C 26 1_555 -0.302 -0.359 -0.675 10.569 -3.500 2.279 2 A_G2:C26_A A 2 ? A 26 ? 19 1 1 A A 3 1_555 A U 25 1_555 0.059 -0.226 -0.005 7.606 -25.284 -8.627 3 A_A3:U25_A A 3 ? A 25 ? 20 1 1 A A 4 1_555 A U 24 1_555 0.242 -0.090 -0.784 -9.299 -15.951 0.099 4 A_A4:U24_A A 4 ? A 24 ? 20 1 1 A G 5 1_555 A C 23 1_555 -0.329 -0.337 -0.826 -3.983 -7.527 0.819 5 A_G5:C23_A A 5 ? A 23 ? 19 1 1 A C 7 1_555 A G 22 1_555 0.066 -0.304 -0.605 10.645 16.778 -6.861 6 A_C7:G22_A A 7 ? A 22 ? 19 1 1 A C 8 1_555 A G 21 1_555 0.010 -0.359 -0.810 12.944 9.782 -11.129 7 A_C8:G21_A A 8 ? A 21 ? 19 1 1 A G 9 1_555 A C 20 1_555 0.179 -0.425 -1.233 -13.134 3.860 -11.739 8 A_G9:C20_A A 9 ? A 20 ? 19 1 1 A G 10 1_555 A C 19 1_555 -0.235 -0.418 0.630 -18.404 6.265 6.918 9 A_G10:C19_A A 10 ? A 19 ? 19 1 1 A U 11 1_555 A A 18 1_555 -0.381 -0.245 -0.756 -12.933 0.290 -12.326 10 A_U11:A18_A A 11 ? A 18 ? 20 1 1 A C 12 1_555 A G 17 1_555 0.273 -0.501 -0.998 -3.207 -2.263 -1.161 11 A_C12:G17_A A 12 ? A 17 ? 19 1 1 A U 13 1_555 A G 16 1_555 1.301 -5.523 0.068 4.668 -18.953 -87.979 12 A_U13:G16_A A 13 ? A 16 ? ? 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 27 1_555 A G 2 1_555 A C 26 1_555 0.472 -0.989 4.594 -0.736 14.363 26.969 -5.697 -1.092 3.605 28.380 1.455 30.501 1 AA_G1G2:C26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A G 2 1_555 A C 26 1_555 A A 3 1_555 A U 25 1_555 -0.648 -0.987 4.144 -1.375 -2.085 32.693 -1.290 0.845 4.220 -3.697 2.438 32.785 2 AA_G2A3:U25C26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A A 3 1_555 A U 25 1_555 A A 4 1_555 A U 24 1_555 0.522 -0.603 4.634 2.529 -2.160 35.847 -0.537 -0.331 4.686 -3.500 -4.099 35.996 3 AA_A3A4:U24U25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A A 4 1_555 A U 24 1_555 A G 5 1_555 A C 23 1_555 0.290 -1.476 3.514 -1.496 3.837 27.016 -4.117 -1.002 3.256 8.153 3.178 27.322 4 AA_A4G5:C23U24_AA A 4 ? A 24 ? A 5 ? A 23 ? 1 A G 5 1_555 A C 23 1_555 A C 7 1_555 A G 22 1_555 -1.678 -0.693 3.176 1.424 46.112 39.411 -2.795 1.744 1.593 51.604 -1.594 59.967 5 AA_G5C7:G22C23_AA A 5 ? A 23 ? A 7 ? A 22 ? 1 A C 7 1_555 A G 22 1_555 A C 8 1_555 A G 21 1_555 -1.103 -1.728 3.855 1.435 14.950 33.986 -4.862 1.941 2.827 24.166 -2.319 37.067 6 AA_C7C8:G21G22_AA A 7 ? A 22 ? A 8 ? A 21 ? 1 A C 8 1_555 A G 21 1_555 A G 9 1_555 A C 20 1_555 0.060 -1.857 5.488 2.288 -0.175 25.735 -4.073 0.937 5.484 -0.392 -5.124 25.835 7 AA_C8G9:C20G21_AA A 8 ? A 21 ? A 9 ? A 20 ? 1 A G 9 1_555 A C 20 1_555 A G 10 1_555 A C 19 1_555 1.940 -1.840 3.806 -13.150 3.180 29.843 -3.828 -5.760 2.543 5.814 24.040 32.703 8 AA_G9G10:C19C20_AA A 9 ? A 20 ? A 10 ? A 19 ? 1 A G 10 1_555 A C 19 1_555 A U 11 1_555 A A 18 1_555 -2.846 -1.242 3.847 7.561 -12.113 29.146 0.230 6.636 3.275 -22.451 -14.014 32.387 9 AA_G10U11:A18C19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A U 11 1_555 A A 18 1_555 A C 12 1_555 A G 17 1_555 0.786 -1.110 3.442 0.337 17.189 33.313 -3.952 -1.183 2.590 27.802 -0.545 37.376 10 AA_U11C12:G17A18_AA A 11 ? A 18 ? A 12 ? A 17 ? 1 A C 12 1_555 A G 17 1_555 A U 13 1_555 A G 16 1_555 1.401 -0.304 2.890 3.281 12.481 99.825 -0.369 -0.866 2.882 8.133 -2.138 100.435 11 AA_C12U13:G16G17_AA A 12 ? A 17 ? A 13 ? A 16 ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'COBALT HEXAMMINE(III)' _pdbx_entity_nonpoly.comp_id NCO #