data_1Y90 # _entry.id 1Y90 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1Y90 pdb_00001y90 10.2210/pdb1y90/pdb NDB AR0053 ? ? RCSB RCSB031267 ? ? WWPDB D_1000031267 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2004-12-21 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2024-02-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_struct_conn_angle 5 4 'Structure model' struct_conn 6 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_comp_id' 4 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id' 5 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 6 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_comp_id' 7 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_seq_id' 8 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_comp_id' 9 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id' 10 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 11 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_comp_id' 12 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_seq_id' 13 4 'Structure model' '_pdbx_struct_conn_angle.value' 14 4 'Structure model' '_struct_conn.conn_type_id' 15 4 'Structure model' '_struct_conn.id' 16 4 'Structure model' '_struct_conn.pdbx_dist_value' 17 4 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' 18 4 'Structure model' '_struct_conn.pdbx_ptnr1_label_alt_id' 19 4 'Structure model' '_struct_conn.pdbx_ptnr2_label_alt_id' 20 4 'Structure model' '_struct_conn.ptnr1_auth_asym_id' 21 4 'Structure model' '_struct_conn.ptnr1_auth_comp_id' 22 4 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 23 4 'Structure model' '_struct_conn.ptnr1_label_asym_id' 24 4 'Structure model' '_struct_conn.ptnr1_label_atom_id' 25 4 'Structure model' '_struct_conn.ptnr1_label_comp_id' 26 4 'Structure model' '_struct_conn.ptnr1_label_seq_id' 27 4 'Structure model' '_struct_conn.ptnr2_auth_asym_id' 28 4 'Structure model' '_struct_conn.ptnr2_auth_comp_id' 29 4 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 30 4 'Structure model' '_struct_conn.ptnr2_label_asym_id' 31 4 'Structure model' '_struct_conn.ptnr2_label_atom_id' 32 4 'Structure model' '_struct_conn.ptnr2_label_comp_id' 33 4 'Structure model' '_struct_conn.ptnr2_label_seq_id' 34 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 35 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 36 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1Y90 _pdbx_database_status.recvd_initial_deposition_date 2004-12-14 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1Y73 'HIV-1 Dis(Mal) Duplex Pt-Soaked' unspecified PDB 1Y6T 'HIV-1 Dis(Mal) Duplex CoHexa-Soaked' unspecified PDB 1Y6S 'HIV-1 Dis(Mal) Duplex Ba-Soaked' unspecified PDB 1NLC 'HIV-1 Dis(Mal) Duplex Zn-Soaked' unspecified PDB 1O3Z 'HIV-1 Dis(Mal) Duplex RuHexa-Soaked' unspecified PDB 462D 'HIV-1 Dis(Mal) Duplex Mg-Native' unspecified PDB 1Y95 . unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Ennifar, E.' 1 'Walter, P.' 2 'Dumas, P.' 3 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'A crystallographic study of the binding of 13 metal ions to two related RNA duplexes' 'Nucleic Acids Res.' 31 2671 2682 2003 NARHAD UK 0305-1048 0389 ? 12736317 10.1093/nar/gkg350 1 'The crystal structure of the dimerization initiation site of genomic HIV-1 RNA reveals an extended duplex with two adenine bulges' 'Structure Fold.Des.' 7 1439 1449 1999 FODEFH UK 0969-2126 1263 ? 10574792 '10.1016/S0969-2126(00)80033-7' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Ennifar, E.' 1 ? primary 'Walter, P.' 2 ? primary 'Dumas, P.' 3 ? 1 'Ennifar, E.' 4 ? 1 'Yusupov, M.' 5 ? 1 'Walter, P.' 6 ? 1 'Marquet, R.' 7 ? 1 'Ehresmann, B.' 8 ? 1 'Ehresmann, C.' 9 ? 1 'Dumas, P.' 10 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn "5'-R(*CP*(5BU)P*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP*AP*G)-3'" 7481.368 2 ? ? ? 'HIV-1 DIS RNA' 2 non-polymer syn 'MANGANESE (II) ION' 54.938 12 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'C(5BU)UGCUGAGGUGCACACAGCAAG' _entity_poly.pdbx_seq_one_letter_code_can CUUGCUGAGGUGCACACAGCAAG _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'MANGANESE (II) ION' _pdbx_entity_nonpoly.comp_id MN # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 5BU n 1 3 U n 1 4 G n 1 5 C n 1 6 U n 1 7 G n 1 8 A n 1 9 G n 1 10 G n 1 11 U n 1 12 G n 1 13 C n 1 14 A n 1 15 C n 1 16 A n 1 17 C n 1 18 A n 1 19 G n 1 20 C n 1 21 A n 1 22 A n 1 23 G n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 5BU 'RNA linking' n "5-BROMO-URIDINE-5'-MONOPHOSPHATE" ? 'C9 H12 Br N2 O9 P' 403.077 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 MN non-polymer . 'MANGANESE (II) ION' ? 'Mn 2' 54.938 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 1 1 C C A . n A 1 2 5BU 2 2 2 5BU 5BU A . n A 1 3 U 3 3 3 U U A . n A 1 4 G 4 4 4 G G A . n A 1 5 C 5 5 5 C C A . n A 1 6 U 6 6 6 U U A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 A 16 16 16 A A A . n A 1 17 C 17 17 17 C C A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 G 23 23 23 G G A . n B 1 1 C 1 1 1 C C B . n B 1 2 5BU 2 2 2 5BU 5BU B . n B 1 3 U 3 3 3 U U B . n B 1 4 G 4 4 4 G G B . n B 1 5 C 5 5 5 C C B . n B 1 6 U 6 6 6 U U B . n B 1 7 G 7 7 7 G G B . n B 1 8 A 8 8 8 A A B . n B 1 9 G 9 9 9 G G B . n B 1 10 G 10 10 10 G G B . n B 1 11 U 11 11 11 U U B . n B 1 12 G 12 12 12 G G B . n B 1 13 C 13 13 13 C C B . n B 1 14 A 14 14 14 A A B . n B 1 15 C 15 15 15 C C B . n B 1 16 A 16 16 16 A A B . n B 1 17 C 17 17 17 C C B . n B 1 18 A 18 18 18 A A B . n B 1 19 G 19 19 19 G G B . n B 1 20 C 20 20 20 C C B . n B 1 21 A 21 21 21 A A B . n B 1 22 A 22 22 22 A A B . n B 1 23 G 23 23 23 G G B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 MN 1 101 101 MN MN A . D 2 MN 1 107 107 MN MN A . E 2 MN 1 109 109 MN MN A . F 2 MN 1 110 110 MN MN A . G 2 MN 1 111 111 MN MN A . H 2 MN 1 102 102 MN MN B . I 2 MN 1 103 103 MN MN B . J 2 MN 1 104 104 MN MN B . K 2 MN 1 105 105 MN MN B . L 2 MN 1 106 106 MN MN B . M 2 MN 1 108 108 MN MN B . N 2 MN 1 112 112 MN MN B . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal CNS refinement 0.4 ? 1 DENZO 'data reduction' . ? 2 SCALEPACK 'data scaling' . ? 3 CNS phasing . ? 4 # _cell.entry_id 1Y90 _cell.length_a 59.080 _cell.length_b 59.080 _cell.length_c 63.659 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 12 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1Y90 _symmetry.space_group_name_H-M 'P 31 2 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 152 _symmetry.space_group_name_Hall ? # _exptl.entry_id 1Y90 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.14 _exptl_crystal.density_percent_sol 50 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.temp 310 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_details 'MPD, spermine, KCl, MgCl2, Na Cacodylate, pH 7.0, VAPOR DIFFUSION, SITTING DROP, temperature 310K' _exptl_crystal_grow.pdbx_pH_range . # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 MPD ? ? ? 1 2 1 spermine ? ? ? 1 3 1 KCl ? ? ? 1 4 1 MgCl2 ? ? ? 1 5 1 'Na Cacodylate' ? ? ? 1 6 1 H2O ? ? ? 1 7 2 MPD ? ? ? 1 8 2 KCl ? ? ? 1 9 2 MgCl2 ? ? ? 1 10 2 'Na Cacodylate' ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 120 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector 'IMAGE PLATE' _diffrn_detector.type MACSCIENCE _diffrn_detector.pdbx_collection_date ? _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator mirror _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.54 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source 'ROTATING ANODE' _diffrn_source.type ENRAF-NONIUS _diffrn_source.pdbx_synchrotron_site ? _diffrn_source.pdbx_synchrotron_beamline ? _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.54 # _reflns.entry_id 1Y90 _reflns.observed_criterion_sigma_I 0 _reflns.observed_criterion_sigma_F 0 _reflns.d_resolution_low 15 _reflns.d_resolution_high 3.08 _reflns.number_obs 2446 _reflns.number_all ? _reflns.percent_possible_obs 96.7 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value 0.052 _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 3.0 _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _reflns_shell.d_res_high 3.08 _reflns_shell.d_res_low ? _reflns_shell.percent_possible_all 92.1 _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value 0.112 _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.pdbx_redundancy ? _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_diffrn_id ? _reflns_shell.pdbx_ordinal 1 # _refine.entry_id 1Y90 _refine.ls_number_reflns_obs 2373 _refine.ls_number_reflns_all 2446 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 0.0 _refine.pdbx_data_cutoff_high_absF 439218.88 _refine.pdbx_data_cutoff_low_absF 0.000000 _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 10.00 _refine.ls_d_res_high 3.08 _refine.ls_percent_reflns_obs 95.8 _refine.ls_R_factor_obs 0.194 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.194 _refine.ls_R_factor_R_free 0.244 _refine.ls_R_factor_R_free_error 0.018 _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 7.9 _refine.ls_number_reflns_R_free 187 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean 47.0 _refine.aniso_B[1][1] 0.98 _refine.aniso_B[2][2] 0.98 _refine.aniso_B[3][3] -1.95 _refine.aniso_B[1][2] 2.11 _refine.aniso_B[1][3] 0.00 _refine.aniso_B[2][3] 0.00 _refine.solvent_model_details 'FLAT MODEL' _refine.solvent_model_param_ksol 0.262868 _refine.solvent_model_param_bsol 16.3725 _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'FOURIER SYNTHESIS' _refine.pdbx_isotropic_thermal_model RESTRAINED _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_analyze.entry_id 1Y90 _refine_analyze.Luzzati_coordinate_error_obs 0.33 _refine_analyze.Luzzati_sigma_a_obs 0.23 _refine_analyze.Luzzati_d_res_low_obs 10.00 _refine_analyze.Luzzati_coordinate_error_free 0.41 _refine_analyze.Luzzati_sigma_a_free 0.28 _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1050 _refine_hist.pdbx_number_atoms_ligand 12 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1062 _refine_hist.d_res_high 3.08 _refine_hist.d_res_low 10.00 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.004 ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg 0.8 ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d 10.6 ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d 1.33 ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_scbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_scangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_total_number_of_bins_used 6 _refine_ls_shell.d_res_high 3.08 _refine_ls_shell.d_res_low 3.27 _refine_ls_shell.number_reflns_R_work 345 _refine_ls_shell.R_factor_R_work 0.255 _refine_ls_shell.percent_reflns_obs 92.9 _refine_ls_shell.R_factor_R_free 0.271 _refine_ls_shell.R_factor_R_free_error 0.047 _refine_ls_shell.percent_reflns_R_free 8.7 _refine_ls_shell.number_reflns_R_free 33 _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # loop_ _pdbx_xplor_file.serial_no _pdbx_xplor_file.param_file _pdbx_xplor_file.topol_file _pdbx_xplor_file.pdbx_refine_id 1 DNA-RNA_REP.PARAM.UPDATE2 DNA-RNA.TOP 'X-RAY DIFFRACTION' 2 WATER_REP.PARAM WATER.TOP 'X-RAY DIFFRACTION' 3 ION.PARAM ION.TOP 'X-RAY DIFFRACTION' # _database_PDB_matrix.entry_id 1Y90 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1Y90 _struct.title 'HIV-1 Dis(Mal) Duplex Mn-Soaked' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1Y90 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'HIV-1, RNA, metal ions, bulge' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? I N N 2 ? J N N 2 ? K N N 2 ? L N N 2 ? M N N 2 ? N N N 2 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1Y90 _struct_ref.pdbx_db_accession 1Y90 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 1Y90 A 1 ? 23 ? 1Y90 1 ? 23 ? 1 23 2 1 1Y90 B 1 ? 23 ? 1Y90 1 ? 23 ? 1 23 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.pdbx_parent_biol_id ? _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A C 1 "O3'" ? ? ? 1_555 A 5BU 2 P ? ? A C 1 A 5BU 2 1_555 ? ? ? ? ? ? ? 1.605 ? ? covale2 covale both ? A 5BU 2 "O3'" ? ? ? 1_555 A U 3 P ? ? A 5BU 2 A U 3 1_555 ? ? ? ? ? ? ? 1.602 ? ? covale3 covale both ? B C 1 "O3'" ? ? ? 1_555 B 5BU 2 P ? ? B C 1 B 5BU 2 1_555 ? ? ? ? ? ? ? 1.609 ? ? covale4 covale both ? B 5BU 2 "O3'" ? ? ? 1_555 B U 3 P ? ? B 5BU 2 B U 3 1_555 ? ? ? ? ? ? ? 1.607 ? ? metalc1 metalc ? ? A A 8 OP2 ? ? ? 1_555 D MN . MN ? ? A A 8 A MN 107 1_555 ? ? ? ? ? ? ? 2.426 ? ? metalc2 metalc ? ? A G 9 N7 ? ? ? 1_555 D MN . MN ? ? A G 9 A MN 107 1_555 ? ? ? ? ? ? ? 2.564 ? ? metalc3 metalc ? ? A G 9 OP1 ? ? ? 1_555 H MN . MN ? ? A G 9 B MN 102 1_555 ? ? ? ? ? ? ? 2.513 ? ? metalc4 metalc ? ? B G 4 O6 ? ? ? 1_555 J MN . MN ? ? B G 4 B MN 104 1_555 ? ? ? ? ? ? ? 2.688 ? ? metalc5 metalc ? ? B A 8 OP2 B ? ? 1_555 L MN . MN ? ? B A 8 B MN 106 1_555 ? ? ? ? ? ? ? 2.332 ? ? metalc6 metalc ? ? B A 8 OP2 A ? ? 1_555 L MN . MN ? ? B A 8 B MN 106 1_555 ? ? ? ? ? ? ? 2.603 ? ? metalc7 metalc ? ? B G 9 OP1 B ? ? 1_555 H MN . MN ? ? B G 9 B MN 102 1_555 ? ? ? ? ? ? ? 2.255 ? ? metalc8 metalc ? ? B G 9 OP2 A ? ? 1_555 H MN . MN ? ? B G 9 B MN 102 1_555 ? ? ? ? ? ? ? 2.483 ? ? metalc9 metalc ? ? B G 9 N7 B ? ? 1_555 L MN . MN ? ? B G 9 B MN 106 1_555 ? ? ? ? ? ? ? 2.223 ? ? metalc10 metalc ? ? B G 9 N7 A ? ? 1_555 L MN . MN ? ? B G 9 B MN 106 1_555 ? ? ? ? ? ? ? 2.349 ? ? hydrog1 hydrog ? ? A C 1 N3 ? ? ? 1_555 B G 23 N1 ? ? A C 1 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 1 N4 ? ? ? 1_555 B G 23 O6 ? ? A C 1 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 1 O2 ? ? ? 1_555 B G 23 N2 ? ? A C 1 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A 5BU 2 N3 ? ? ? 1_555 B A 22 N1 ? ? A 5BU 2 B A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A 5BU 2 O4 ? ? ? 1_555 B A 22 N6 ? ? A 5BU 2 B A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 3 N3 ? ? ? 1_555 B A 21 N1 ? ? A U 3 B A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 O4 ? ? ? 1_555 B A 21 N6 ? ? A U 3 B A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 4 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 4 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 4 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 5 B G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 5 B G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 5 B G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 B A 18 N1 ? ? A U 6 B A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 O4 ? ? ? 1_555 B A 18 N6 ? ? A U 6 B A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 7 N1 ? ? ? 1_555 B C 17 N3 ? ? A G 7 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 7 N2 ? ? ? 1_555 B C 17 O2 ? ? A G 7 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 7 O6 ? ? ? 1_555 B C 17 N4 ? ? A G 7 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 B A 16 N1 ? ? A G 9 B A 16 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog20 hydrog ? ? A G 9 O6 ? ? ? 1_555 B A 16 N6 ? ? A G 9 B A 16 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog21 hydrog ? ? A G 10 N1 ? ? ? 1_555 B C 15 N3 ? ? A G 10 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 10 N2 ? ? ? 1_555 B C 15 O2 ? ? A G 10 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 O6 ? ? ? 1_555 B C 15 N4 ? ? A G 10 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 11 N3 ? ? ? 1_555 B A 14 N1 ? ? A U 11 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 11 O4 ? ? ? 1_555 B A 14 N6 ? ? A U 11 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 13 N3 ? ? A G 12 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 13 O2 ? ? A G 12 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 13 N4 ? ? A G 12 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 13 B G 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 13 B G 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 13 B G 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 14 N1 ? ? ? 1_555 B U 11 N3 ? ? A A 14 B U 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 14 N6 ? ? ? 1_555 B U 11 O4 ? ? A A 14 B U 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 10 N1 ? ? A C 15 B G 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 10 O6 ? ? A C 15 B G 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 10 N2 ? ? A C 15 B G 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 16 N1 ? ? ? 1_555 B G 9 N1 A ? A A 16 B G 9 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog38 hydrog ? ? A A 16 N6 ? ? ? 1_555 B G 9 O6 A ? A A 16 B G 9 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog39 hydrog ? ? A C 17 N3 ? ? ? 1_555 B G 7 N1 A ? A C 17 B G 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 17 N4 ? ? ? 1_555 B G 7 O6 A ? A C 17 B G 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 17 O2 ? ? ? 1_555 B G 7 N2 A ? A C 17 B G 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A A 18 N1 ? ? ? 1_555 B U 6 N3 ? ? A A 18 B U 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 18 N6 ? ? ? 1_555 B U 6 O4 ? ? A A 18 B U 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 5 N3 ? ? A G 19 B C 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 5 O2 ? ? A G 19 B C 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 5 N4 ? ? A G 19 B C 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 20 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 20 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 20 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A A 21 N1 ? ? ? 1_555 B U 3 N3 ? ? A A 21 B U 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 21 N6 ? ? ? 1_555 B U 3 O4 ? ? A A 21 B U 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 22 N1 ? ? ? 1_555 B 5BU 2 N3 ? ? A A 22 B 5BU 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 22 N6 ? ? ? 1_555 B 5BU 2 O4 ? ? A A 22 B 5BU 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 23 N1 ? ? ? 1_555 B C 1 N3 ? ? A G 23 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 23 N2 ? ? ? 1_555 B C 1 O2 ? ? A G 23 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 23 O6 ? ? ? 1_555 B C 1 N4 ? ? A G 23 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? D MN . ? A MN 107 ? 1_555 N7 ? A G 9 ? A G 9 ? 1_555 78.8 ? 2 OP1 ? A G 9 ? A G 9 ? 1_555 MN ? H MN . ? B MN 102 ? 1_555 OP1 B B G 9 ? B G 9 ? 1_555 138.4 ? 3 OP1 ? A G 9 ? A G 9 ? 1_555 MN ? H MN . ? B MN 102 ? 1_555 OP2 A B G 9 ? B G 9 ? 1_555 157.9 ? 4 OP1 B B G 9 ? B G 9 ? 1_555 MN ? H MN . ? B MN 102 ? 1_555 OP2 A B G 9 ? B G 9 ? 1_555 42.9 ? 5 OP2 B B A 8 ? B A 8 ? 1_555 MN ? L MN . ? B MN 106 ? 1_555 OP2 A B A 8 ? B A 8 ? 1_555 13.2 ? 6 OP2 B B A 8 ? B A 8 ? 1_555 MN ? L MN . ? B MN 106 ? 1_555 N7 B B G 9 ? B G 9 ? 1_555 71.2 ? 7 OP2 A B A 8 ? B A 8 ? 1_555 MN ? L MN . ? B MN 106 ? 1_555 N7 B B G 9 ? B G 9 ? 1_555 58.1 ? 8 OP2 B B A 8 ? B A 8 ? 1_555 MN ? L MN . ? B MN 106 ? 1_555 N7 A B G 9 ? B G 9 ? 1_555 82.3 ? 9 OP2 A B A 8 ? B A 8 ? 1_555 MN ? L MN . ? B MN 106 ? 1_555 N7 A B G 9 ? B G 9 ? 1_555 69.3 ? 10 N7 B B G 9 ? B G 9 ? 1_555 MN ? L MN . ? B MN 106 ? 1_555 N7 A B G 9 ? B G 9 ? 1_555 13.2 ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software B MN 102 ? 3 'BINDING SITE FOR RESIDUE MN B 102' AC2 Software B MN 104 ? 2 'BINDING SITE FOR RESIDUE MN B 104' AC3 Software B MN 105 ? 2 'BINDING SITE FOR RESIDUE MN B 105' AC4 Software B MN 106 ? 2 'BINDING SITE FOR RESIDUE MN B 106' AC5 Software A MN 107 ? 2 'BINDING SITE FOR RESIDUE MN A 107' AC6 Software B MN 108 ? 1 'BINDING SITE FOR RESIDUE MN B 108' AC7 Software A MN 109 ? 1 'BINDING SITE FOR RESIDUE MN A 109' AC8 Software A MN 110 ? 1 'BINDING SITE FOR RESIDUE MN A 110' AC9 Software B MN 112 ? 1 'BINDING SITE FOR RESIDUE MN B 112' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 3 G A 9 ? G A 9 . ? 1_555 ? 2 AC1 3 A B 8 ? A B 8 . ? 1_555 ? 3 AC1 3 G B 9 ? G B 9 . ? 1_555 ? 4 AC2 2 U B 3 ? U B 3 . ? 1_555 ? 5 AC2 2 G B 4 ? G B 4 . ? 1_555 ? 6 AC3 2 U B 6 ? U B 6 . ? 1_555 ? 7 AC3 2 G B 7 ? G B 7 . ? 1_555 ? 8 AC4 2 A B 8 ? A B 8 . ? 1_555 ? 9 AC4 2 G B 9 ? G B 9 . ? 1_555 ? 10 AC5 2 A A 8 ? A A 8 . ? 1_555 ? 11 AC5 2 G A 9 ? G A 9 . ? 1_555 ? 12 AC6 1 G B 12 ? G B 12 . ? 1_555 ? 13 AC7 1 A A 21 ? A A 21 . ? 3_764 ? 14 AC8 1 A A 22 ? A A 22 . ? 1_555 ? 15 AC9 1 A B 22 ? A B 22 . ? 1_555 ? # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 1 _pdbx_validate_planes.auth_comp_id U _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 3 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.067 _pdbx_validate_planes.type 'SIDE CHAIN' # loop_ _pdbx_validate_polymer_linkage.id _pdbx_validate_polymer_linkage.PDB_model_num _pdbx_validate_polymer_linkage.auth_atom_id_1 _pdbx_validate_polymer_linkage.auth_asym_id_1 _pdbx_validate_polymer_linkage.auth_comp_id_1 _pdbx_validate_polymer_linkage.auth_seq_id_1 _pdbx_validate_polymer_linkage.PDB_ins_code_1 _pdbx_validate_polymer_linkage.label_alt_id_1 _pdbx_validate_polymer_linkage.auth_atom_id_2 _pdbx_validate_polymer_linkage.auth_asym_id_2 _pdbx_validate_polymer_linkage.auth_comp_id_2 _pdbx_validate_polymer_linkage.auth_seq_id_2 _pdbx_validate_polymer_linkage.PDB_ins_code_2 _pdbx_validate_polymer_linkage.label_alt_id_2 _pdbx_validate_polymer_linkage.dist 1 1 "O3'" B U 6 ? ? P B G 7 ? B 2.60 2 1 "O3'" B G 9 ? A P B G 10 ? ? 2.62 # loop_ _pdbx_struct_mod_residue.id _pdbx_struct_mod_residue.label_asym_id _pdbx_struct_mod_residue.label_comp_id _pdbx_struct_mod_residue.label_seq_id _pdbx_struct_mod_residue.auth_asym_id _pdbx_struct_mod_residue.auth_comp_id _pdbx_struct_mod_residue.auth_seq_id _pdbx_struct_mod_residue.PDB_ins_code _pdbx_struct_mod_residue.parent_comp_id _pdbx_struct_mod_residue.details 1 A 5BU 2 A 5BU 2 ? U "5-BROMO-URIDINE-5'-MONOPHOSPHATE" 2 B 5BU 2 B 5BU 2 ? U "5-BROMO-URIDINE-5'-MONOPHOSPHATE" # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 5BU P P N N 1 5BU OP1 O N N 2 5BU OP2 O N N 3 5BU OP3 O N N 4 5BU "O5'" O N N 5 5BU "C5'" C N N 6 5BU "C4'" C N R 7 5BU "O4'" O N N 8 5BU "C3'" C N S 9 5BU "O3'" O N N 10 5BU "C2'" C N R 11 5BU "O2'" O N N 12 5BU "C1'" C N R 13 5BU N1 N N N 14 5BU C2 C N N 15 5BU O2 O N N 16 5BU N3 N N N 17 5BU C4 C N N 18 5BU O4 O N N 19 5BU C5 C N N 20 5BU C6 C N N 21 5BU BR BR N N 22 5BU HOP2 H N N 23 5BU HOP3 H N N 24 5BU "H5'" H N N 25 5BU "H5''" H N N 26 5BU "H4'" H N N 27 5BU "H3'" H N N 28 5BU "HO3'" H N N 29 5BU "H2'" H N N 30 5BU "HO2'" H N N 31 5BU "H1'" H N N 32 5BU H3 H N N 33 5BU H6 H N N 34 A OP3 O N N 35 A P P N N 36 A OP1 O N N 37 A OP2 O N N 38 A "O5'" O N N 39 A "C5'" C N N 40 A "C4'" C N R 41 A "O4'" O N N 42 A "C3'" C N S 43 A "O3'" O N N 44 A "C2'" C N R 45 A "O2'" O N N 46 A "C1'" C N R 47 A N9 N Y N 48 A C8 C Y N 49 A N7 N Y N 50 A C5 C Y N 51 A C6 C Y N 52 A N6 N N N 53 A N1 N Y N 54 A C2 C Y N 55 A N3 N Y N 56 A C4 C Y N 57 A HOP3 H N N 58 A HOP2 H N N 59 A "H5'" H N N 60 A "H5''" H N N 61 A "H4'" H N N 62 A "H3'" H N N 63 A "HO3'" H N N 64 A "H2'" H N N 65 A "HO2'" H N N 66 A "H1'" H N N 67 A H8 H N N 68 A H61 H N N 69 A H62 H N N 70 A H2 H N N 71 C OP3 O N N 72 C P P N N 73 C OP1 O N N 74 C OP2 O N N 75 C "O5'" O N N 76 C "C5'" C N N 77 C "C4'" C N R 78 C "O4'" O N N 79 C "C3'" C N S 80 C "O3'" O N N 81 C "C2'" C N R 82 C "O2'" O N N 83 C "C1'" C N R 84 C N1 N N N 85 C C2 C N N 86 C O2 O N N 87 C N3 N N N 88 C C4 C N N 89 C N4 N N N 90 C C5 C N N 91 C C6 C N N 92 C HOP3 H N N 93 C HOP2 H N N 94 C "H5'" H N N 95 C "H5''" H N N 96 C "H4'" H N N 97 C "H3'" H N N 98 C "HO3'" H N N 99 C "H2'" H N N 100 C "HO2'" H N N 101 C "H1'" H N N 102 C H41 H N N 103 C H42 H N N 104 C H5 H N N 105 C H6 H N N 106 G OP3 O N N 107 G P P N N 108 G OP1 O N N 109 G OP2 O N N 110 G "O5'" O N N 111 G "C5'" C N N 112 G "C4'" C N R 113 G "O4'" O N N 114 G "C3'" C N S 115 G "O3'" O N N 116 G "C2'" C N R 117 G "O2'" O N N 118 G "C1'" C N R 119 G N9 N Y N 120 G C8 C Y N 121 G N7 N Y N 122 G C5 C Y N 123 G C6 C N N 124 G O6 O N N 125 G N1 N N N 126 G C2 C N N 127 G N2 N N N 128 G N3 N N N 129 G C4 C Y N 130 G HOP3 H N N 131 G HOP2 H N N 132 G "H5'" H N N 133 G "H5''" H N N 134 G "H4'" H N N 135 G "H3'" H N N 136 G "HO3'" H N N 137 G "H2'" H N N 138 G "HO2'" H N N 139 G "H1'" H N N 140 G H8 H N N 141 G H1 H N N 142 G H21 H N N 143 G H22 H N N 144 MN MN MN N N 145 U OP3 O N N 146 U P P N N 147 U OP1 O N N 148 U OP2 O N N 149 U "O5'" O N N 150 U "C5'" C N N 151 U "C4'" C N R 152 U "O4'" O N N 153 U "C3'" C N S 154 U "O3'" O N N 155 U "C2'" C N R 156 U "O2'" O N N 157 U "C1'" C N R 158 U N1 N N N 159 U C2 C N N 160 U O2 O N N 161 U N3 N N N 162 U C4 C N N 163 U O4 O N N 164 U C5 C N N 165 U C6 C N N 166 U HOP3 H N N 167 U HOP2 H N N 168 U "H5'" H N N 169 U "H5''" H N N 170 U "H4'" H N N 171 U "H3'" H N N 172 U "HO3'" H N N 173 U "H2'" H N N 174 U "HO2'" H N N 175 U "H1'" H N N 176 U H3 H N N 177 U H5 H N N 178 U H6 H N N 179 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 5BU P OP1 doub N N 1 5BU P OP2 sing N N 2 5BU P OP3 sing N N 3 5BU P "O5'" sing N N 4 5BU OP2 HOP2 sing N N 5 5BU OP3 HOP3 sing N N 6 5BU "O5'" "C5'" sing N N 7 5BU "C5'" "C4'" sing N N 8 5BU "C5'" "H5'" sing N N 9 5BU "C5'" "H5''" sing N N 10 5BU "C4'" "O4'" sing N N 11 5BU "C4'" "C3'" sing N N 12 5BU "C4'" "H4'" sing N N 13 5BU "O4'" "C1'" sing N N 14 5BU "C3'" "O3'" sing N N 15 5BU "C3'" "C2'" sing N N 16 5BU "C3'" "H3'" sing N N 17 5BU "O3'" "HO3'" sing N N 18 5BU "C2'" "O2'" sing N N 19 5BU "C2'" "C1'" sing N N 20 5BU "C2'" "H2'" sing N N 21 5BU "O2'" "HO2'" sing N N 22 5BU "C1'" N1 sing N N 23 5BU "C1'" "H1'" sing N N 24 5BU N1 C2 sing N N 25 5BU N1 C6 sing N N 26 5BU C2 O2 doub N N 27 5BU C2 N3 sing N N 28 5BU N3 C4 sing N N 29 5BU N3 H3 sing N N 30 5BU C4 O4 doub N N 31 5BU C4 C5 sing N N 32 5BU C5 C6 doub N N 33 5BU C5 BR sing N N 34 5BU C6 H6 sing N N 35 A OP3 P sing N N 36 A OP3 HOP3 sing N N 37 A P OP1 doub N N 38 A P OP2 sing N N 39 A P "O5'" sing N N 40 A OP2 HOP2 sing N N 41 A "O5'" "C5'" sing N N 42 A "C5'" "C4'" sing N N 43 A "C5'" "H5'" sing N N 44 A "C5'" "H5''" sing N N 45 A "C4'" "O4'" sing N N 46 A "C4'" "C3'" sing N N 47 A "C4'" "H4'" sing N N 48 A "O4'" "C1'" sing N N 49 A "C3'" "O3'" sing N N 50 A "C3'" "C2'" sing N N 51 A "C3'" "H3'" sing N N 52 A "O3'" "HO3'" sing N N 53 A "C2'" "O2'" sing N N 54 A "C2'" "C1'" sing N N 55 A "C2'" "H2'" sing N N 56 A "O2'" "HO2'" sing N N 57 A "C1'" N9 sing N N 58 A "C1'" "H1'" sing N N 59 A N9 C8 sing Y N 60 A N9 C4 sing Y N 61 A C8 N7 doub Y N 62 A C8 H8 sing N N 63 A N7 C5 sing Y N 64 A C5 C6 sing Y N 65 A C5 C4 doub Y N 66 A C6 N6 sing N N 67 A C6 N1 doub Y N 68 A N6 H61 sing N N 69 A N6 H62 sing N N 70 A N1 C2 sing Y N 71 A C2 N3 doub Y N 72 A C2 H2 sing N N 73 A N3 C4 sing Y N 74 C OP3 P sing N N 75 C OP3 HOP3 sing N N 76 C P OP1 doub N N 77 C P OP2 sing N N 78 C P "O5'" sing N N 79 C OP2 HOP2 sing N N 80 C "O5'" "C5'" sing N N 81 C "C5'" "C4'" sing N N 82 C "C5'" "H5'" sing N N 83 C "C5'" "H5''" sing N N 84 C "C4'" "O4'" sing N N 85 C "C4'" "C3'" sing N N 86 C "C4'" "H4'" sing N N 87 C "O4'" "C1'" sing N N 88 C "C3'" "O3'" sing N N 89 C "C3'" "C2'" sing N N 90 C "C3'" "H3'" sing N N 91 C "O3'" "HO3'" sing N N 92 C "C2'" "O2'" sing N N 93 C "C2'" "C1'" sing N N 94 C "C2'" "H2'" sing N N 95 C "O2'" "HO2'" sing N N 96 C "C1'" N1 sing N N 97 C "C1'" "H1'" sing N N 98 C N1 C2 sing N N 99 C N1 C6 sing N N 100 C C2 O2 doub N N 101 C C2 N3 sing N N 102 C N3 C4 doub N N 103 C C4 N4 sing N N 104 C C4 C5 sing N N 105 C N4 H41 sing N N 106 C N4 H42 sing N N 107 C C5 C6 doub N N 108 C C5 H5 sing N N 109 C C6 H6 sing N N 110 G OP3 P sing N N 111 G OP3 HOP3 sing N N 112 G P OP1 doub N N 113 G P OP2 sing N N 114 G P "O5'" sing N N 115 G OP2 HOP2 sing N N 116 G "O5'" "C5'" sing N N 117 G "C5'" "C4'" sing N N 118 G "C5'" "H5'" sing N N 119 G "C5'" "H5''" sing N N 120 G "C4'" "O4'" sing N N 121 G "C4'" "C3'" sing N N 122 G "C4'" "H4'" sing N N 123 G "O4'" "C1'" sing N N 124 G "C3'" "O3'" sing N N 125 G "C3'" "C2'" sing N N 126 G "C3'" "H3'" sing N N 127 G "O3'" "HO3'" sing N N 128 G "C2'" "O2'" sing N N 129 G "C2'" "C1'" sing N N 130 G "C2'" "H2'" sing N N 131 G "O2'" "HO2'" sing N N 132 G "C1'" N9 sing N N 133 G "C1'" "H1'" sing N N 134 G N9 C8 sing Y N 135 G N9 C4 sing Y N 136 G C8 N7 doub Y N 137 G C8 H8 sing N N 138 G N7 C5 sing Y N 139 G C5 C6 sing N N 140 G C5 C4 doub Y N 141 G C6 O6 doub N N 142 G C6 N1 sing N N 143 G N1 C2 sing N N 144 G N1 H1 sing N N 145 G C2 N2 sing N N 146 G C2 N3 doub N N 147 G N2 H21 sing N N 148 G N2 H22 sing N N 149 G N3 C4 sing N N 150 U OP3 P sing N N 151 U OP3 HOP3 sing N N 152 U P OP1 doub N N 153 U P OP2 sing N N 154 U P "O5'" sing N N 155 U OP2 HOP2 sing N N 156 U "O5'" "C5'" sing N N 157 U "C5'" "C4'" sing N N 158 U "C5'" "H5'" sing N N 159 U "C5'" "H5''" sing N N 160 U "C4'" "O4'" sing N N 161 U "C4'" "C3'" sing N N 162 U "C4'" "H4'" sing N N 163 U "O4'" "C1'" sing N N 164 U "C3'" "O3'" sing N N 165 U "C3'" "C2'" sing N N 166 U "C3'" "H3'" sing N N 167 U "O3'" "HO3'" sing N N 168 U "C2'" "O2'" sing N N 169 U "C2'" "C1'" sing N N 170 U "C2'" "H2'" sing N N 171 U "O2'" "HO2'" sing N N 172 U "C1'" N1 sing N N 173 U "C1'" "H1'" sing N N 174 U N1 C2 sing N N 175 U N1 C6 sing N N 176 U C2 O2 doub N N 177 U C2 N3 sing N N 178 U N3 C4 sing N N 179 U N3 H3 sing N N 180 U C4 O4 doub N N 181 U C4 C5 sing N N 182 U C5 C6 doub N N 183 U C5 H5 sing N N 184 U C6 H6 sing N N 185 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1Y90 'double helix' 1Y90 'a-form double helix' 1Y90 'bulge loop' 1Y90 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 1 1_555 B G 23 1_555 0.009 -0.415 -0.063 6.887 -16.317 -6.167 1 A_C1:G23_B A 1 ? B 23 ? 19 1 1 A 5BU 2 1_555 B A 22 1_555 -0.582 -0.477 0.054 1.923 -22.520 5.873 2 A_5BU2:A22_B A 2 ? B 22 ? 20 1 1 A U 3 1_555 B A 21 1_555 0.069 -0.098 0.158 2.777 -19.639 6.716 3 A_U3:A21_B A 3 ? B 21 ? 20 1 1 A G 4 1_555 B C 20 1_555 -0.611 -0.108 0.115 -3.029 -13.561 1.458 4 A_G4:C20_B A 4 ? B 20 ? 19 1 1 A C 5 1_555 B G 19 1_555 0.416 -0.244 0.336 -4.904 -11.987 -1.257 5 A_C5:G19_B A 5 ? B 19 ? 19 1 1 A U 6 1_555 B A 18 1_555 -0.390 -0.163 0.465 -12.427 -10.862 -0.766 6 A_U6:A18_B A 6 ? B 18 ? 20 1 1 A G 7 1_555 B C 17 1_555 -0.357 -0.226 0.152 3.172 -12.601 0.676 7 A_G7:C17_B A 7 ? B 17 ? 19 1 1 A G 9 1_555 B A 16 1_555 0.289 1.633 -0.346 27.128 -16.344 -6.131 8 A_G9:A16_B A 9 ? B 16 ? 8 1 1 A G 10 1_555 B C 15 1_555 -0.484 -0.317 0.334 -3.347 -11.617 3.535 9 A_G10:C15_B A 10 ? B 15 ? 19 1 1 A U 11 1_555 B A 14 1_555 -0.277 -0.171 0.025 -2.052 -6.553 -2.621 10 A_U11:A14_B A 11 ? B 14 ? 20 1 1 A G 12 1_555 B C 13 1_555 -0.051 -0.129 -0.269 -7.158 -14.017 1.105 11 A_G12:C13_B A 12 ? B 13 ? 19 1 1 A C 13 1_555 B G 12 1_555 0.404 -0.033 0.492 -4.021 -11.313 0.828 12 A_C13:G12_B A 13 ? B 12 ? 19 1 1 A A 14 1_555 B U 11 1_555 0.223 -0.305 0.719 11.618 -1.090 0.895 13 A_A14:U11_B A 14 ? B 11 ? 20 1 1 A C 15 1_555 B G 10 1_555 -0.142 0.018 0.290 4.292 -11.309 6.157 14 A_C15:G10_B A 15 ? B 10 ? 19 1 1 A A 16 1_555 B G 9 1_555 -0.643 1.399 -0.227 -17.436 -18.399 -1.027 15 A_A16:G9_B A 16 ? B 9 ? 8 1 1 A C 17 1_555 B G 7 1_555 0.330 0.000 0.363 -7.220 -3.107 -1.998 16 A_C17:G7_B A 17 ? B 7 ? 19 1 1 A A 18 1_555 B U 6 1_555 -0.266 -0.303 0.441 12.386 -4.405 5.710 17 A_A18:U6_B A 18 ? B 6 ? 20 1 1 A G 19 1_555 B C 5 1_555 -0.308 -0.390 0.052 8.208 -10.482 -3.375 18 A_G19:C5_B A 19 ? B 5 ? 19 1 1 A C 20 1_555 B G 4 1_555 0.468 -0.186 0.017 -0.952 -14.861 4.713 19 A_C20:G4_B A 20 ? B 4 ? 19 1 1 A A 21 1_555 B U 3 1_555 -0.381 -0.118 0.021 -4.305 -12.047 4.038 20 A_A21:U3_B A 21 ? B 3 ? 20 1 1 A A 22 1_555 B 5BU 2 1_555 -0.056 -0.364 0.328 2.129 -16.645 4.228 21 A_A22:5BU2_B A 22 ? B 2 ? 20 1 1 A G 23 1_555 B C 1 1_555 -0.259 -0.336 0.011 2.478 -10.851 -0.169 22 A_G23:C1_B A 23 ? B 1 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 1 1_555 B G 23 1_555 A 5BU 2 1_555 B A 22 1_555 0.286 -1.314 3.334 -2.626 10.957 36.469 -3.347 -0.758 2.812 17.016 4.079 38.113 1 AA_C15BU2:A22G23_BB A 1 ? B 23 ? A 2 ? B 22 ? 1 A 5BU 2 1_555 B A 22 1_555 A U 3 1_555 B A 21 1_555 -0.034 -0.986 3.213 -2.896 8.447 33.549 -2.883 -0.364 2.881 14.321 4.910 34.684 2 AA_5BU2U3:A21A22_BB A 2 ? B 22 ? A 3 ? B 21 ? 1 A U 3 1_555 B A 21 1_555 A G 4 1_555 B C 20 1_555 0.403 -1.746 3.176 0.390 12.012 28.569 -5.292 -0.689 2.279 23.092 -0.750 30.945 3 AA_U3G4:C20A21_BB A 3 ? B 21 ? A 4 ? B 20 ? 1 A G 4 1_555 B C 20 1_555 A C 5 1_555 B G 19 1_555 -0.319 -1.477 3.351 -0.543 5.708 37.691 -2.980 0.420 3.107 8.773 0.834 38.109 4 AA_G4C5:G19C20_BB A 4 ? B 20 ? A 5 ? B 19 ? 1 A C 5 1_555 B G 19 1_555 A U 6 1_555 B A 18 1_555 0.512 -1.403 3.194 1.337 12.903 29.693 -4.563 -0.708 2.412 23.799 -2.466 32.344 5 AA_C5U6:A18G19_BB A 5 ? B 19 ? A 6 ? B 18 ? 1 A U 6 1_555 B A 18 1_555 A G 7 1_555 B C 17 1_555 0.702 -1.503 2.664 4.830 12.527 32.134 -3.949 -0.623 2.036 21.496 -8.288 34.757 6 AA_U6G7:C17A18_BB A 6 ? B 18 ? A 7 ? B 17 ? 1 A G 7 1_555 B C 17 1_555 A G 9 1_555 B A 16 1_555 -1.672 0.022 2.866 6.660 2.801 41.252 -0.215 2.924 2.574 3.940 -9.366 41.852 7 AA_G7G9:A16C17_BB A 7 ? B 17 ? A 9 ? B 16 ? 1 A G 9 1_555 B A 16 1_555 A G 10 1_555 B C 15 1_555 0.123 -2.379 3.622 -9.962 11.256 34.521 -5.159 -1.487 2.616 17.951 15.887 37.560 8 AA_G9G10:C15A16_BB A 9 ? B 16 ? A 10 ? B 15 ? 1 A G 10 1_555 B C 15 1_555 A U 11 1_555 B A 14 1_555 -0.545 -1.750 3.097 3.330 5.197 34.440 -3.618 1.359 2.749 8.691 -5.568 34.973 9 AA_G10U11:A14C15_BB A 10 ? B 15 ? A 11 ? B 14 ? 1 A U 11 1_555 B A 14 1_555 A G 12 1_555 B C 13 1_555 0.499 -1.605 3.308 4.854 10.787 29.825 -4.741 -0.080 2.631 19.996 -8.998 32.036 10 AA_U11G12:C13A14_BB A 11 ? B 14 ? A 12 ? B 13 ? 1 A G 12 1_555 B C 13 1_555 A C 13 1_555 B G 12 1_555 0.092 -1.426 3.133 -4.913 2.515 32.565 -2.910 -0.944 2.972 4.444 8.683 33.016 11 AA_G12C13:G12C13_BB A 12 ? B 13 ? A 13 ? B 12 ? 1 A C 13 1_555 B G 12 1_555 A A 14 1_555 B U 11 1_555 -0.227 -1.778 2.549 -3.482 2.347 30.174 -3.741 -0.098 2.417 4.481 6.647 30.458 12 AA_C13A14:U11G12_BB A 13 ? B 12 ? A 14 ? B 11 ? 1 A A 14 1_555 B U 11 1_555 A C 15 1_555 B G 10 1_555 0.624 -1.692 3.286 5.488 4.899 32.333 -3.777 -0.186 3.066 8.658 -9.698 33.138 13 AA_A14C15:G10U11_BB A 14 ? B 11 ? A 15 ? B 10 ? 1 A C 15 1_555 B G 10 1_555 A A 16 1_555 B G 9 1_555 -0.240 -1.873 3.221 7.076 13.568 34.022 -4.516 1.201 2.247 21.868 -11.405 37.212 14 AA_C15A16:G9G10_BB A 15 ? B 10 ? A 16 ? B 9 ? 1 A A 16 1_555 B G 9 1_555 A C 17 1_555 B G 7 1_555 0.817 -0.109 3.541 -11.115 -3.941 39.720 0.291 -2.412 3.205 -5.651 15.938 41.366 15 AA_A16C17:G7G9_BB A 16 ? B 9 ? A 17 ? B 7 ? 1 A C 17 1_555 B G 7 1_555 A A 18 1_555 B U 6 1_555 0.288 -1.199 2.445 -2.884 14.077 30.299 -3.634 -0.819 1.703 25.226 5.169 33.461 16 AA_C17A18:U6G7_BB A 17 ? B 7 ? A 18 ? B 6 ? 1 A A 18 1_555 B U 6 1_555 A G 19 1_555 B C 5 1_555 -0.265 -1.477 3.333 2.881 8.710 33.271 -3.792 0.877 2.836 14.863 -4.917 34.478 17 AA_A18G19:C5U6_BB A 18 ? B 6 ? A 19 ? B 5 ? 1 A G 19 1_555 B C 5 1_555 A C 20 1_555 B G 4 1_555 0.996 -1.618 3.505 2.626 2.875 36.671 -2.972 -1.196 3.434 4.554 -4.159 36.870 18 AA_G19C20:G4C5_BB A 19 ? B 5 ? A 20 ? B 4 ? 1 A C 20 1_555 B G 4 1_555 A A 21 1_555 B U 3 1_555 -0.852 -1.558 3.049 0.082 13.973 28.130 -5.058 1.589 2.060 26.759 -0.158 31.347 19 AA_C20A21:U3G4_BB A 20 ? B 4 ? A 21 ? B 3 ? 1 A A 21 1_555 B U 3 1_555 A A 22 1_555 B 5BU 2 1_555 -0.145 -0.637 3.148 -1.559 10.446 31.638 -2.738 0.010 2.806 18.524 2.765 33.312 20 AA_A21A22:5BU2U3_BB A 21 ? B 3 ? A 22 ? B 2 ? 1 A A 22 1_555 B 5BU 2 1_555 A G 23 1_555 B C 1 1_555 0.108 -1.505 3.246 1.880 13.608 31.929 -4.414 0.079 2.426 23.429 -3.236 34.688 21 AA_A22G23:C15BU2_BB A 22 ? B 2 ? A 23 ? B 1 ? # _atom_sites.entry_id 1Y90 _atom_sites.fract_transf_matrix[1][1] 0.016926 _atom_sites.fract_transf_matrix[1][2] 0.009772 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019545 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015709 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol BR C MN N O P # loop_