data_1YG4 # _entry.id 1YG4 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1YG4 pdb_00001yg4 10.2210/pdb1yg4/pdb RCSB RCSB031474 ? ? WWPDB D_1000031474 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1YG3 _pdbx_database_related.details 'The same sequence, 20 lowest energy structures' _pdbx_database_related.content_type unspecified # _pdbx_database_status.entry_id 1YG4 _pdbx_database_status.status_code REL _pdbx_database_status.SG_entry N _pdbx_database_status.status_code_mr REL _pdbx_database_status.recvd_initial_deposition_date 2005-01-04 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Cornish, P.V.' 1 'Hennig, M.' 2 'Giedroc, D.P.' 3 # _citation.id primary _citation.title 'A loop 2 cytidine-stem 1 minor groove interaction as a positive determinant for pseudoknot-stimulated -1 ribosomal frameshifting' _citation.journal_abbrev Proc.Natl.Acad.Sci.USA _citation.journal_volume 102 _citation.page_first 12694 _citation.page_last 12699 _citation.year 2005 _citation.journal_id_ASTM PNASA6 _citation.country US _citation.journal_id_ISSN 0027-8424 _citation.journal_id_CSD 0040 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 16123125 _citation.pdbx_database_id_DOI 10.1073/pnas.0506166102 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Cornish, P.V.' 1 ? primary 'Hennig, M.' 2 ? primary 'Giedroc, D.P.' 3 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'ScYLV RNA pseudoknot' _entity.formula_weight 9000.477 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'AGUGG(CH)GCCGACCACUUAAAAACACCGG' _entity_poly.pdbx_seq_one_letter_code_can AGUGGCGCCGACCACUUAAAAACACCGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 G n 1 3 U n 1 4 G n 1 5 G n 1 6 CH n 1 7 G n 1 8 C n 1 9 C n 1 10 G n 1 11 A n 1 12 C n 1 13 C n 1 14 A n 1 15 C n 1 16 U n 1 17 U n 1 18 A n 1 19 A n 1 20 A n 1 21 A n 1 22 A n 1 23 C n 1 24 A n 1 25 C n 1 26 C n 1 27 G n 1 28 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'In vitro transcription' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1YG4 _struct_ref.pdbx_db_accession 1YG4 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1YG4 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1YG4 _struct_ref_seq.db_align_beg 3 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 30 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 3 _struct_ref_seq.pdbx_auth_seq_align_end 30 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CH 'RNA linking' n ;N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE ; ? 'C9 H15 N3 O8 P 1' 324.204 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D NOESY' 1 2 2 '2D NOESY' 2 3 2 3D_13C-separated_NOESY 2 4 3 'CT-TROSY and CT-antiTROSY' 3 5 3 'J-modulated HSQC' 3 6 2 '2D TOCSY' 2 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 ambient 6.0 '100mM KCl; 5mM MgCl2' ? K 2 298 ambient 6.0 '100mM KCl; 5mM MgCl2' ? K 3 298 ambient 6.0 '100mM KCl; 5mM MgCl2' ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2mM ScYLV pseudoknot, 100mM KCl, 5mM MgCl2, pH6.0' '90% H2O/10% D2O' 2 '2mM ScYLV pseudoknot, 100mM KCl, 5mM MgCl2, pH6.0' '100% D2O' 3 '2mM ScYLV pseudoknot, 100mM KCl, 5mM MgCl2, pH6.0, 12.5mg/ml PF1 phage' '100% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 INOVA Varian 500 ? 2 INOVA Varian 600 ? 3 AVANCE Bruker 900 ? # _pdbx_nmr_refine.entry_id 1YG4 _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 1YG4 _pdbx_nmr_ensemble.conformers_calculated_total_number 25 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria 'averaged structure' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1YG4 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'minimized average structure' # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal processing NMRPipe 97.027.12.56 'F. Delaglio, S. Grzesiek, G.W. Vuister, G. Zhu, J. Pfeifer and A. Bax' 1 'data analysis' Sparky 3.110 'T. D. Goddard and D. G. Kneller' 2 'structure solution' X-PLOR-NIH 2.9.7 'G.M. Clore , J.Kuszewski, C.D. Schwieters, and N.Tjandra' 3 refinement X-PLOR-NIH 2.9.7 'G.M. Clore , J.Kuszewski, C.D. Schwieters, and N.Tjandra' 4 # _exptl.entry_id 1YG4 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 1YG4 _struct.title 'Solution Structure of the ScYLV P1-P2 Frameshifting Pseudoknot, Regularized Average Structure' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details 'minimized average' # _struct_keywords.entry_id 1YG4 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA pseudoknot; ribosomal frameshifting; protonated cytidine, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 5 "O3'" ? ? ? 1_555 A CH 6 P ? ? A G 7 A CH 8 1_555 ? ? ? ? ? ? ? 1.568 ? ? covale2 covale both ? A CH 6 "O3'" ? ? ? 1_555 A G 7 P ? ? A CH 8 A G 9 1_555 ? ? ? ? ? ? ? 1.617 ? ? hydrog1 hydrog ? ? A A 1 N1 ? ? ? 1_555 A U 16 N3 ? ? A A 3 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 1 N6 ? ? ? 1_555 A U 16 O4 ? ? A A 3 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 15 N3 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 15 O2 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 N2 ? ? ? 1_555 A A 18 N1 ? ? A G 4 A A 20 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog7 hydrog ? ? A G 2 N3 ? ? ? 1_555 A A 18 N6 ? ? A G 4 A A 20 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog8 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 14 N1 ? ? A U 5 A A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 14 N6 ? ? A U 5 A A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 13 N3 ? ? A G 6 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 13 O2 ? ? A G 6 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 13 N4 ? ? A G 6 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 4 N2 ? ? ? 1_555 A A 21 N1 ? ? A G 6 A A 23 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog14 hydrog ? ? A G 4 N3 ? ? ? 1_555 A A 21 N6 ? ? A G 6 A A 23 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog15 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 12 N3 ? ? A G 7 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 12 O2 ? ? A G 7 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 12 N4 ? ? A G 7 A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A CH 6 N4 ? ? ? 1_555 A G 10 O6 ? ? A CH 8 A G 12 1_555 ? ? ? ? ? ? 'CH-G PAIR' ? ? ? hydrog19 hydrog ? ? A CH 6 O2 ? ? ? 1_555 A C 26 N4 ? ? A CH 8 A C 28 1_555 ? ? ? ? ? ? 'CH-C MISPAIR' ? ? ? hydrog20 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 10 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 10 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 10 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 11 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 11 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 11 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 12 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 12 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 12 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A A 22 N6 ? ? A C 15 A A 24 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog30 hydrog ? ? A C 13 O2 ? ? ? 1_555 A A 24 N6 ? ? A C 15 A A 26 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog31 hydrog ? ? A A 14 N3 ? ? ? 1_555 A A 20 N6 ? ? A A 16 A A 22 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog32 hydrog ? ? A A 14 N3 ? ? ? 1_555 A A 21 N6 ? ? A A 16 A A 23 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _atom_sites.entry_id 1YG4 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 3 3 A A A . n A 1 2 G 2 4 4 G G A . n A 1 3 U 3 5 5 U U A . n A 1 4 G 4 6 6 G G A . n A 1 5 G 5 7 7 G G A . n A 1 6 CH 6 8 8 CH CH A . n A 1 7 G 7 9 9 G G A . n A 1 8 C 8 10 10 C C A . n A 1 9 C 9 11 11 C C A . n A 1 10 G 10 12 12 G G A . n A 1 11 A 11 13 13 A A A . n A 1 12 C 12 14 14 C C A . n A 1 13 C 13 15 15 C C A . n A 1 14 A 14 16 16 A A A . n A 1 15 C 15 17 17 C C A . n A 1 16 U 16 18 18 U U A . n A 1 17 U 17 19 19 U U A . n A 1 18 A 18 20 20 A A A . n A 1 19 A 19 21 21 A A A . n A 1 20 A 20 22 22 A A A . n A 1 21 A 21 23 23 A A A . n A 1 22 A 22 24 24 A A A . n A 1 23 C 23 25 25 C C A . n A 1 24 A 24 26 26 A A A . n A 1 25 C 25 27 27 C C A . n A 1 26 C 26 28 28 C C A . n A 1 27 G 27 29 29 G G A . n A 1 28 G 28 30 30 G G A . n # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id CH _pdbx_struct_mod_residue.label_seq_id 6 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id CH _pdbx_struct_mod_residue.auth_seq_id 8 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id C _pdbx_struct_mod_residue.details ;N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE ; # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2005-12-13 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-02 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_spectrometer 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_conn # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_spectrometer.model' 4 4 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A G 4 ? ? H62 A A 20 ? ? 1.11 2 1 H42 A CH 8 ? ? O6 A G 12 ? ? 1.55 3 1 "H2'" A G 6 ? ? "O4'" A G 7 ? ? 1.55 4 1 "H4'" A A 21 ? ? OP1 A A 22 ? ? 1.58 5 1 N2 A G 12 ? ? "O4'" A C 14 ? ? 2.18 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "C2'" A G 6 ? ? "C1'" A G 6 ? ? 1.476 1.526 -0.050 0.008 N 2 1 N1 A G 7 ? ? C2 A G 7 ? ? 1.431 1.373 0.058 0.008 N 3 1 C6 A G 7 ? ? N1 A G 7 ? ? 1.346 1.391 -0.045 0.007 N 4 1 N3 A C 11 ? ? C4 A C 11 ? ? 1.287 1.335 -0.048 0.007 N 5 1 "C5'" A G 12 ? ? "C4'" A G 12 ? ? 1.617 1.509 0.108 0.012 N 6 1 "C2'" A C 14 ? ? "C1'" A C 14 ? ? 1.456 1.526 -0.070 0.008 N 7 1 N1 A C 15 ? ? C6 A C 15 ? ? 1.407 1.367 0.040 0.006 N 8 1 "C2'" A A 16 ? ? "C1'" A A 16 ? ? 1.448 1.526 -0.078 0.008 N 9 1 C6 A A 16 ? ? N1 A A 16 ? ? 1.305 1.351 -0.046 0.007 N 10 1 N9 A A 16 ? ? C4 A A 16 ? ? 1.426 1.374 0.052 0.006 N 11 1 "C2'" A U 18 ? ? "C1'" A U 18 ? ? 1.418 1.526 -0.108 0.008 N 12 1 C6 A A 22 ? ? N1 A A 22 ? ? 1.307 1.351 -0.044 0.007 N 13 1 N1 A C 28 ? ? C6 A C 28 ? ? 1.430 1.367 0.063 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A A 3 ? ? "C1'" A A 3 ? ? N9 A A 3 ? ? 114.72 108.50 6.22 0.70 N 2 1 N7 A A 3 ? ? C8 A A 3 ? ? N9 A A 3 ? ? 118.21 113.80 4.41 0.50 N 3 1 C8 A A 3 ? ? N9 A A 3 ? ? C4 A A 3 ? ? 102.80 105.80 -3.00 0.40 N 4 1 "O4'" A G 4 ? ? "C1'" A G 4 ? ? N9 A G 4 ? ? 114.49 108.50 5.99 0.70 N 5 1 C5 A G 4 ? ? N7 A G 4 ? ? C8 A G 4 ? ? 100.98 104.30 -3.32 0.50 N 6 1 N7 A G 4 ? ? C8 A G 4 ? ? N9 A G 4 ? ? 117.10 113.10 4.00 0.50 N 7 1 N9 A G 4 ? ? C4 A G 4 ? ? C5 A G 4 ? ? 108.32 105.40 2.92 0.40 N 8 1 "O4'" A G 6 ? ? "C1'" A G 6 ? ? N9 A G 6 ? ? 122.64 108.50 14.14 0.70 N 9 1 N7 A G 6 ? ? C8 A G 6 ? ? N9 A G 6 ? ? 116.82 113.10 3.72 0.50 N 10 1 N9 A G 6 ? ? C4 A G 6 ? ? C5 A G 6 ? ? 102.91 105.40 -2.49 0.40 N 11 1 "C3'" A G 6 ? ? "O3'" A G 6 ? ? P A G 7 ? ? 128.72 119.70 9.02 1.20 Y 12 1 P A G 7 ? ? "O5'" A G 7 ? ? "C5'" A G 7 ? ? 130.75 120.90 9.85 1.60 N 13 1 "O4'" A G 7 ? ? "C1'" A G 7 ? ? N9 A G 7 ? ? 121.83 108.50 13.33 0.70 N 14 1 N7 A G 7 ? ? C8 A G 7 ? ? N9 A G 7 ? ? 117.66 113.10 4.56 0.50 N 15 1 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.83 113.10 4.73 0.50 N 16 1 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.60 106.40 -2.80 0.40 N 17 1 P A C 11 ? ? "O5'" A C 11 ? ? "C5'" A C 11 ? ? 135.18 120.90 14.28 1.60 N 18 1 "O4'" A G 12 ? ? "C1'" A G 12 ? ? N9 A G 12 ? ? 113.64 108.50 5.14 0.70 N 19 1 C5 A G 12 ? ? N7 A G 12 ? ? C8 A G 12 ? ? 101.28 104.30 -3.02 0.50 N 20 1 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 118.41 113.10 5.31 0.50 N 21 1 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 101.99 106.40 -4.41 0.40 N 22 1 N7 A A 13 ? ? C8 A A 13 ? ? N9 A A 13 ? ? 117.49 113.80 3.69 0.50 N 23 1 "O4'" A A 16 ? ? "C1'" A A 16 ? ? N9 A A 16 ? ? 119.34 108.50 10.84 0.70 N 24 1 N7 A A 16 ? ? C8 A A 16 ? ? N9 A A 16 ? ? 117.49 113.80 3.69 0.50 N 25 1 N9 A A 16 ? ? C4 A A 16 ? ? C5 A A 16 ? ? 102.21 105.80 -3.59 0.40 N 26 1 "O4'" A C 17 ? ? "C1'" A C 17 ? ? N1 A C 17 ? ? 113.36 108.50 4.86 0.70 N 27 1 "C5'" A U 18 ? ? "C4'" A U 18 ? ? "O4'" A U 18 ? ? 115.66 109.80 5.86 0.90 N 28 1 "O4'" A U 18 ? ? "C1'" A U 18 ? ? N1 A U 18 ? ? 112.88 108.50 4.38 0.70 N 29 1 "O4'" A U 19 ? ? "C1'" A U 19 ? ? N1 A U 19 ? ? 113.34 108.50 4.84 0.70 N 30 1 N7 A A 20 ? ? C8 A A 20 ? ? N9 A A 20 ? ? 117.44 113.80 3.64 0.50 N 31 1 "C3'" A A 20 ? ? "O3'" A A 20 ? ? P A A 21 ? ? 131.82 119.70 12.12 1.20 Y 32 1 "C3'" A A 21 ? ? "C2'" A A 21 ? ? "C1'" A A 21 ? ? 106.97 101.50 5.47 0.80 N 33 1 N7 A A 21 ? ? C8 A A 21 ? ? N9 A A 21 ? ? 117.26 113.80 3.46 0.50 N 34 1 C8 A A 21 ? ? N9 A A 21 ? ? C4 A A 21 ? ? 102.97 105.80 -2.83 0.40 N 35 1 N7 A A 22 ? ? C8 A A 22 ? ? N9 A A 22 ? ? 117.63 113.80 3.83 0.50 N 36 1 N7 A A 23 ? ? C8 A A 23 ? ? N9 A A 23 ? ? 116.88 113.80 3.08 0.50 N 37 1 C8 A A 23 ? ? N9 A A 23 ? ? C4 A A 23 ? ? 103.30 105.80 -2.50 0.40 N 38 1 "C5'" A A 24 ? ? "C4'" A A 24 ? ? "O4'" A A 24 ? ? 115.83 109.80 6.03 0.90 N 39 1 "O4'" A A 24 ? ? "C1'" A A 24 ? ? N9 A A 24 ? ? 113.16 108.50 4.66 0.70 N 40 1 N7 A A 24 ? ? C8 A A 24 ? ? N9 A A 24 ? ? 117.25 113.80 3.45 0.50 N 41 1 N7 A A 26 ? ? C8 A A 26 ? ? N9 A A 26 ? ? 118.26 113.80 4.46 0.50 N 42 1 C8 A A 26 ? ? N9 A A 26 ? ? C4 A A 26 ? ? 102.61 105.80 -3.19 0.40 N 43 1 "O4'" A C 27 ? ? "C1'" A C 27 ? ? N1 A C 27 ? ? 113.82 108.50 5.32 0.70 N 44 1 N7 A G 29 ? ? C8 A G 29 ? ? N9 A G 29 ? ? 118.18 113.10 5.08 0.50 N 45 1 C8 A G 29 ? ? N9 A G 29 ? ? C4 A G 29 ? ? 101.33 106.40 -5.07 0.40 N 46 1 N9 A G 29 ? ? C4 A G 29 ? ? C5 A G 29 ? ? 108.11 105.40 2.71 0.40 N 47 1 N7 A G 30 ? ? C8 A G 30 ? ? N9 A G 30 ? ? 116.19 113.10 3.09 0.50 N 48 1 C8 A G 30 ? ? N9 A G 30 ? ? C4 A G 30 ? ? 102.72 106.40 -3.68 0.40 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 A A 3 ? ? 0.085 'SIDE CHAIN' 2 1 G A 4 ? ? 0.071 'SIDE CHAIN' 3 1 U A 5 ? ? 0.072 'SIDE CHAIN' 4 1 G A 6 ? ? 0.081 'SIDE CHAIN' 5 1 G A 7 ? ? 0.094 'SIDE CHAIN' 6 1 C A 10 ? ? 0.091 'SIDE CHAIN' 7 1 C A 11 ? ? 0.084 'SIDE CHAIN' 8 1 G A 12 ? ? 0.075 'SIDE CHAIN' 9 1 C A 14 ? ? 0.090 'SIDE CHAIN' 10 1 C A 15 ? ? 0.104 'SIDE CHAIN' 11 1 A A 16 ? ? 0.106 'SIDE CHAIN' 12 1 C A 17 ? ? 0.087 'SIDE CHAIN' 13 1 U A 18 ? ? 0.088 'SIDE CHAIN' 14 1 A A 23 ? ? 0.054 'SIDE CHAIN' 15 1 G A 29 ? ? 0.081 'SIDE CHAIN' 16 1 G A 30 ? ? 0.079 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1YG4 'double helix' 1YG4 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 1 1_555 A U 16 1_555 0.008 -0.128 0.025 0.684 -1.255 -0.093 1 A_A3:U18_A A 3 ? A 18 ? 20 1 1 A G 2 1_555 A C 15 1_555 -0.055 -0.066 0.070 1.292 -0.145 2.945 2 A_G4:C17_A A 4 ? A 17 ? 19 1 1 A U 3 1_555 A A 14 1_555 -0.099 -0.146 -0.038 -0.460 0.351 -1.810 3 A_U5:A16_A A 5 ? A 16 ? 20 1 1 A G 4 1_555 A C 13 1_555 -0.051 -0.108 0.031 1.845 0.732 -3.863 4 A_G6:C15_A A 6 ? A 15 ? 19 1 1 A G 5 1_555 A C 12 1_555 -0.141 -0.123 -0.067 1.376 1.006 0.304 5 A_G7:C14_A A 7 ? A 14 ? 19 1 1 A C 26 1_555 A G 10 1_555 -0.030 -0.200 0.631 -3.375 -9.463 -7.294 6 A_C28:G12_A A 28 ? A 12 ? 19 1 1 A G 27 1_555 A C 9 1_555 0.033 -0.065 0.117 2.760 0.324 -1.757 7 A_G29:C11_A A 29 ? A 11 ? 19 1 1 A G 28 1_555 A C 8 1_555 -0.054 -0.130 0.107 1.832 -0.685 -3.730 8 A_G30:C10_A A 30 ? A 10 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 1 1_555 A U 16 1_555 A G 2 1_555 A C 15 1_555 0.357 -1.618 2.928 -4.242 18.696 27.098 -5.187 -1.159 1.467 34.898 7.919 33.090 1 AA_A3G4:C17U18_AA A 3 ? A 18 ? A 4 ? A 17 ? 1 A G 2 1_555 A C 15 1_555 A U 3 1_555 A A 14 1_555 -1.180 -1.191 3.235 3.076 16.018 29.861 -4.323 2.459 2.202 28.562 -5.485 33.936 2 AA_G4U5:A16C17_AA A 4 ? A 17 ? A 5 ? A 16 ? 1 A U 3 1_555 A A 14 1_555 A G 4 1_555 A C 13 1_555 0.364 -1.137 2.877 1.279 17.363 29.749 -4.083 -0.457 1.951 30.731 -2.264 34.370 3 AA_U5G6:C15A16_AA A 5 ? A 16 ? A 6 ? A 15 ? 1 A G 4 1_555 A C 13 1_555 A G 5 1_555 A C 12 1_555 1.863 -1.251 3.340 -1.429 14.692 25.049 -5.438 -4.004 2.177 30.706 2.986 29.015 4 AA_G6G7:C14C15_AA A 6 ? A 15 ? A 7 ? A 14 ? 1 A G 5 1_555 A C 12 1_555 A C 26 1_555 A G 10 1_555 -4.402 -0.875 3.497 10.995 -4.599 110.990 -0.474 2.798 3.223 -2.786 -6.660 111.415 5 AA_G7C28:G12C14_AA A 7 ? A 14 ? A 28 ? A 12 ? 1 A C 26 1_555 A G 10 1_555 A G 27 1_555 A C 9 1_555 0.978 -0.581 3.256 5.956 20.688 34.237 -3.142 -0.758 2.635 31.575 -9.091 40.271 6 AA_C28G29:C11G12_AA A 28 ? A 12 ? A 29 ? A 11 ? 1 A G 27 1_555 A C 9 1_555 A G 28 1_555 A C 8 1_555 -0.011 -0.450 3.377 -4.133 12.247 28.102 -3.244 -0.788 2.906 23.699 7.997 30.878 7 AA_G29G30:C10C11_AA A 29 ? A 11 ? A 30 ? A 10 ? #