data_1YNC # _entry.id 1YNC # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1YNC pdb_00001ync 10.2210/pdb1ync/pdb RCSB RCSB031712 ? ? WWPDB D_1000031712 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1YLG '20 structures G19 (G72) in anti conformation' unspecified PDB 1YNE . unspecified PDB 1YNG . unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1YNC _pdbx_database_status.recvd_initial_deposition_date 2005-01-24 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Maris, C.' 1 'Masse, J.' 2 'Allain, F.H.' 3 'Chester, A.' 4 'Navaratnam, N.' 5 # _citation.id primary _citation.title 'NMR structure of the apoB mRNA stem-loop and its interaction with the C to U editing APOBEC1 complementary factor.' _citation.journal_abbrev Rna _citation.journal_volume 11 _citation.page_first 173 _citation.page_last 186 _citation.year 2005 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 15659357 _citation.pdbx_database_id_DOI 10.1261/rna.7190705 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Maris, C.' 1 ? primary 'Masse, J.' 2 ? primary 'Chester, A.' 3 ? primary 'Navaratnam, N.' 4 ? primary 'Allain, F.H.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'apolipoprotein B mRNA' _entity.formula_weight 9890.887 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment 'Editing site of APOB enzyme' _entity.details ? # _entity_name_com.entity_id 1 _entity_name_com.name 'apoB mRNA' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAUAUAUGAUACAAUUUGAUCAGUAUAUCC _entity_poly.pdbx_seq_one_letter_code_can GGAUAUAUGAUACAAUUUGAUCAGUAUAUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 U n 1 5 A n 1 6 U n 1 7 A n 1 8 U n 1 9 G n 1 10 A n 1 11 U n 1 12 A n 1 13 C n 1 14 A n 1 15 A n 1 16 U n 1 17 U n 1 18 U n 1 19 G n 1 20 A n 1 21 U n 1 22 C n 1 23 A n 1 24 G n 1 25 U n 1 26 A n 1 27 U n 1 28 A n 1 29 U n 1 30 C n 1 31 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'In vitro T7 polymerase transcription, The sequence of this RNA naturally exists in Homo sapiens (human)' # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code NM_000384 _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code AUAUAUGAUACAAUUUGAUCAGUAUAU _struct_ref.pdbx_align_begin 3 _struct_ref.pdbx_db_accession 4502152 _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1YNC _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 3 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 29 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 4502152 _struct_ref_seq.db_align_beg 6656 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 6682 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 3 _struct_ref_seq.pdbx_auth_seq_align_end 29 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 1YNC G A 1 ? GB 4502152 ? ? 'see remark 999' 1 1 1 1YNC G A 2 ? GB 4502152 ? ? 'see remark 999' 2 2 1 1YNC C A 30 ? GB 4502152 ? ? 'see remark 999' 30 3 1 1YNC C A 31 ? GB 4502152 ? ? 'see remark 999' 31 4 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D NOESY' 1 2 1 '2D TOCSY' 1 3 1 3D_13C-separated_NOESY 1 4 1 DQF-COSY 1 5 2 HNN_COSY 2 6 1 HCCH-TOCSY 1 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 313 1 5.8 '10 mM Na2HPO4' atm K 2 278 1 5.8 '10 mM Na2HPO4' atm K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2 mM apoB RNA SL31;10 mM NaH2HPO4 adjusted at pH 5.8; Natural abundance labeling; 90% H2O, 10% D2O and only 99.98% D2O' '90% H2O, 10% D2O and only 99.98% D2O' 2 '1.2 mM apoB RNA SL31; 10 mM NaH2HPO4 adjusted at pH 5.8; Selective U 15N&13C labeling; 90% H2O, 10% D2O and only 99.98% D2O' '90% H2O, 10% D2O and only 99.98% D2O' 3 '1.0 mMapoB RNA SL31; 10 mM NaH2HPO4 adjusted at pH 5.8; Selective A 15N&13C labeling; 90% H2O, 10% D2O and only 99.98% D2O' '90% H2O, 10% D2O and only 99.98% D2O' 4 '1.0 mM apoB RNA SL31; 10 mM NaH2HPO4 adjusted at pH 5.8; Selective G&C 15N&13C labeling; 90% H2O, 10% D2O and only 99.98% D2O' '90% H2O, 10% D2O and only 99.98% D2O' 5 '1.5 mM apoB RNA SL31; 10 mM NaH2HPO4 adjusted at pH 5.8; full 15N&C13 labeling; 90% H2O, 10% D2O' '90% H2O/10% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 DRX Bruker 500 ? 2 DRX Bruker 600 ? 3 AVANCE Bruker 900 ? # _pdbx_nmr_refine.entry_id 1YNC _pdbx_nmr_refine.method 'CYANA & AMBER7' _pdbx_nmr_refine.details 'calculation in vacuum condition' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 1YNC _pdbx_nmr_ensemble.conformers_calculated_total_number 50 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria ;back calculated data agree with experimental NOESY spectrum,structures with the least restraint violations,structures with the lowest energy ; _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1YNC _pdbx_nmr_representative.conformer_id 12 _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal 'structure solution' CYANA 2.0 'Guentert, P.' 1 collection XwinNMR 2004 Bruker 2 'data analysis' Sparky 2002 'Goddard, T. D. and Kneller, D. G' 3 'data analysis' X-EASY 2001 'Bartels, C.' 4 refinement Amber 7 'Ponder, J.W. and Case, D.A.' 5 # _exptl.entry_id 1YNC _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_percent_sol ? _exptl_crystal.density_Matthews ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 1YNC _struct.title 'NMR structure of the apoB mRNA stem-loop and its interaction with the C to U editing APOBEC1 complementary factor' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1YNC _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA editing; apoB mRNA; APOBEC1; ACF; NMR structure, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 1 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 1 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 1 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 2 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 2 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 2 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 3 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 3 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 28 N1 ? ? A U 4 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 4 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 27 N3 ? ? A A 5 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 27 O4 ? ? A A 5 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 6 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 6 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 7 N1 ? ? ? 1_555 A G 24 N1 ? ? A A 7 A G 24 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog16 hydrog ? ? A A 7 N6 ? ? ? 1_555 A G 24 O6 ? ? A A 7 A G 24 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog17 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 23 N1 ? ? A U 8 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 23 N6 ? ? A U 8 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 9 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 9 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 9 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 21 N3 ? ? A A 10 A U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 21 O4 ? ? A A 10 A U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 20 N1 ? ? A U 11 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 20 N6 ? ? A U 11 A A 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 12 N6 ? ? ? 1_555 A G 19 N7 ? ? A A 12 A G 19 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1YNC _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1YNC _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 U 4 4 4 U U A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 A 12 12 12 A A A . n A 1 13 C 13 13 13 C C A . n A 1 14 A 14 14 14 A A A . n A 1 15 A 15 15 15 A A A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 C 22 22 22 C C A . n A 1 23 A 23 23 23 A A A . n A 1 24 G 24 24 24 G G A . n A 1 25 U 25 25 25 U U A . n A 1 26 A 26 26 26 A A A . n A 1 27 U 27 27 27 U U A . n A 1 28 A 28 28 28 A A A . n A 1 29 U 29 29 29 U U A . n A 1 30 C 30 30 30 C C A . n A 1 31 C 31 31 31 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2005-02-08 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-02 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_nmr_spectrometer 4 4 'Structure model' pdbx_struct_assembly 5 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' 4 4 'Structure model' '_pdbx_nmr_spectrometer.model' # _pdbx_database_remark.id 999 _pdbx_database_remark.text ;SEQUENCE This entry 1YNC has unedited RNA with C6666 in syn conformation. The edited apoB mRNA sequence leading to the truncated protein has the same accession number since it comes from the same gene. The numbering starts at 6656 on the apoB mRNA sequence but for experimental reason the first and last two nucleotides GG and CC were added, which do not belong to the native sequence, the number starts at 6654. ; # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 2 "HO2'" A A 12 ? ? OP1 A C 13 ? ? 1.52 2 2 "HO2'" A A 14 ? ? "O5'" A A 15 ? ? 1.56 3 2 "HO2'" A G 9 ? ? OP1 A A 10 ? ? 1.58 4 4 "HO2'" A A 15 ? ? OP2 A U 16 ? ? 1.57 5 4 "HO2'" A A 23 ? ? OP1 A G 24 ? ? 1.59 6 5 "HO2'" A A 12 ? ? OP1 A C 13 ? ? 1.54 7 7 "HO2'" A U 8 ? ? OP1 A G 9 ? ? 1.57 8 7 "HO2'" A A 23 ? ? OP1 A G 24 ? ? 1.58 9 7 "HO2'" A A 14 ? ? OP1 A A 15 ? ? 1.59 10 8 "HO2'" A A 14 ? ? OP1 A A 15 ? ? 1.48 11 8 "HO2'" A A 10 ? ? OP1 A U 11 ? ? 1.52 12 8 "HO2'" A A 23 ? ? OP1 A G 24 ? ? 1.53 13 8 "HO2'" A U 8 ? ? OP1 A G 9 ? ? 1.54 14 9 "HO2'" A U 16 ? ? OP2 A U 17 ? ? 1.49 15 9 "HO2'" A A 14 ? ? "O5'" A A 15 ? ? 1.59 16 10 "HO2'" A A 12 ? ? OP1 A C 13 ? ? 1.58 17 10 "HO2'" A A 15 ? ? OP2 A U 16 ? ? 1.60 18 11 "HO2'" A U 16 ? ? OP2 A U 17 ? ? 1.56 19 11 "HO2'" A G 9 ? ? OP1 A A 10 ? ? 1.57 20 12 "HO2'" A U 16 ? ? OP2 A U 17 ? ? 1.54 21 12 "HO2'" A A 15 ? ? "O5'" A U 16 ? ? 1.58 22 13 "HO2'" A U 16 ? ? OP1 A U 17 ? ? 1.55 23 13 "HO2'" A A 14 ? ? OP1 A A 15 ? ? 1.58 24 13 "HO2'" A U 18 ? ? OP2 A G 19 ? ? 1.59 25 14 "HO2'" A U 16 ? ? OP1 A U 17 ? ? 1.57 26 14 "HO2'" A A 23 ? ? OP1 A G 24 ? ? 1.60 27 15 "HO2'" A A 23 ? ? OP1 A G 24 ? ? 1.50 28 15 "HO2'" A U 16 ? ? OP1 A U 17 ? ? 1.59 29 16 "HO2'" A A 12 ? ? OP1 A C 13 ? ? 1.54 30 16 "HO2'" A G 9 ? ? OP1 A A 10 ? ? 1.58 31 16 "HO2'" A U 8 ? ? OP1 A G 9 ? ? 1.58 32 16 "HO2'" A A 23 ? ? OP1 A G 24 ? ? 1.59 33 17 "HO2'" A G 19 ? ? OP1 A A 20 ? ? 1.56 34 18 "HO2'" A U 8 ? ? OP1 A G 9 ? ? 1.54 35 19 "HO2'" A U 8 ? ? OP1 A G 9 ? ? 1.56 36 20 "HO2'" A U 8 ? ? OP1 A G 9 ? ? 1.57 37 20 "HO2'" A U 16 ? ? OP2 A U 17 ? ? 1.57 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.01 108.50 4.51 0.70 N 2 1 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 120.84 117.70 3.14 0.50 N 3 1 "C4'" A C 13 ? ? "C3'" A C 13 ? ? "C2'" A C 13 ? ? 95.84 102.60 -6.76 1.00 N 4 1 "C4'" A A 14 ? ? "C3'" A A 14 ? ? "C2'" A A 14 ? ? 96.50 102.60 -6.10 1.00 N 5 1 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.00 117.70 3.30 0.50 N 6 1 "C3'" A U 16 ? ? "O3'" A U 16 ? ? P A U 17 ? ? 127.20 119.70 7.50 1.20 Y 7 1 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 121.04 117.70 3.34 0.50 N 8 1 "O4'" A G 24 ? ? "C1'" A G 24 ? ? N9 A G 24 ? ? 113.42 108.50 4.92 0.70 N 9 1 N3 A U 25 ? ? C2 A U 25 ? ? O2 A U 25 ? ? 117.56 122.20 -4.64 0.70 N 10 1 "O4'" A U 27 ? ? "C1'" A U 27 ? ? N1 A U 27 ? ? 112.76 108.50 4.26 0.70 N 11 1 C5 A A 28 ? ? C6 A A 28 ? ? N1 A A 28 ? ? 120.81 117.70 3.11 0.50 N 12 2 "C5'" A U 11 ? ? "C4'" A U 11 ? ? "C3'" A U 11 ? ? 106.45 115.20 -8.75 1.40 N 13 3 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 112.70 108.50 4.20 0.70 N 14 3 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 120.88 117.70 3.18 0.50 N 15 3 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 113.07 108.50 4.57 0.70 N 16 3 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 120.93 117.70 3.23 0.50 N 17 4 "O4'" A A 15 ? ? "C1'" A A 15 ? ? N9 A A 15 ? ? 113.54 108.50 5.04 0.70 N 18 4 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 113.42 108.50 4.92 0.70 N 19 5 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 112.86 108.50 4.36 0.70 N 20 5 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 121.12 117.70 3.42 0.50 N 21 5 "O4'" A A 12 ? ? "C1'" A A 12 ? ? N9 A A 12 ? ? 112.73 108.50 4.23 0.70 N 22 5 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 120.75 117.70 3.05 0.50 N 23 5 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.08 117.70 3.38 0.50 N 24 5 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 113.18 108.50 4.68 0.70 N 25 5 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 120.93 117.70 3.23 0.50 N 26 5 "O4'" A U 21 ? ? "C1'" A U 21 ? ? N1 A U 21 ? ? 113.13 108.50 4.63 0.70 N 27 5 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 120.85 117.70 3.15 0.50 N 28 5 N1 A A 23 ? ? C6 A A 23 ? ? N6 A A 23 ? ? 113.71 118.60 -4.89 0.60 N 29 5 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 120.77 117.70 3.07 0.50 N 30 6 C5 A A 3 ? ? C6 A A 3 ? ? N1 A A 3 ? ? 120.77 117.70 3.07 0.50 N 31 6 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.43 108.50 4.93 0.70 N 32 6 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 120.81 117.70 3.11 0.50 N 33 6 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 121.04 117.70 3.34 0.50 N 34 6 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 120.92 117.70 3.22 0.50 N 35 6 "C4'" A C 13 ? ? "C3'" A C 13 ? ? "C2'" A C 13 ? ? 94.97 102.60 -7.63 1.00 N 36 6 "C4'" A A 14 ? ? "C3'" A A 14 ? ? "C2'" A A 14 ? ? 95.00 102.60 -7.60 1.00 N 37 6 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 121.21 117.70 3.51 0.50 N 38 6 "O4'" A U 21 ? ? "C1'" A U 21 ? ? N1 A U 21 ? ? 113.24 108.50 4.74 0.70 N 39 6 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 120.78 117.70 3.08 0.50 N 40 6 "O4'" A U 29 ? ? "C1'" A U 29 ? ? N1 A U 29 ? ? 112.86 108.50 4.36 0.70 N 41 10 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 113.31 108.50 4.81 0.70 N 42 11 C5 A A 3 ? ? C6 A A 3 ? ? N1 A A 3 ? ? 120.70 117.70 3.00 0.50 N 43 11 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.81 108.50 5.31 0.70 N 44 11 C5 A A 5 ? ? C6 A A 5 ? ? N1 A A 5 ? ? 120.86 117.70 3.16 0.50 N 45 11 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 121.16 117.70 3.46 0.50 N 46 11 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 120.77 117.70 3.07 0.50 N 47 11 "O4'" A U 11 ? ? "C1'" A U 11 ? ? N1 A U 11 ? ? 113.14 108.50 4.64 0.70 N 48 11 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 120.90 117.70 3.20 0.50 N 49 11 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 121.28 117.70 3.58 0.50 N 50 11 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.37 117.70 3.67 0.50 N 51 11 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 115.35 108.50 6.85 0.70 N 52 11 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 120.89 117.70 3.19 0.50 N 53 11 "O4'" A U 21 ? ? "C1'" A U 21 ? ? N1 A U 21 ? ? 112.71 108.50 4.21 0.70 N 54 11 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 121.39 117.70 3.69 0.50 N 55 11 N1 A G 24 ? ? C6 A G 24 ? ? O6 A G 24 ? ? 115.60 119.90 -4.30 0.60 N 56 11 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 121.27 117.70 3.57 0.50 N 57 11 "O4'" A U 29 ? ? "C1'" A U 29 ? ? N1 A U 29 ? ? 112.88 108.50 4.38 0.70 N 58 12 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.78 108.50 5.28 0.70 N 59 12 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 120.85 117.70 3.15 0.50 N 60 12 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 120.97 117.70 3.27 0.50 N 61 12 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 121.10 117.70 3.40 0.50 N 62 12 "O4'" A A 14 ? ? "C1'" A A 14 ? ? N9 A A 14 ? ? 112.94 108.50 4.44 0.70 N 63 12 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 121.24 117.70 3.54 0.50 N 64 12 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.37 117.70 3.67 0.50 N 65 12 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 114.20 108.50 5.70 0.70 N 66 12 "O4'" A U 21 ? ? "C1'" A U 21 ? ? N1 A U 21 ? ? 113.58 108.50 5.08 0.70 N 67 12 "O4'" A C 22 ? ? "C1'" A C 22 ? ? N1 A C 22 ? ? 112.85 108.50 4.35 0.70 N 68 12 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 120.84 117.70 3.14 0.50 N 69 12 N1 A G 24 ? ? C6 A G 24 ? ? O6 A G 24 ? ? 116.16 119.90 -3.74 0.60 N 70 12 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 120.99 117.70 3.29 0.50 N 71 12 "O4'" A U 29 ? ? "C1'" A U 29 ? ? N1 A U 29 ? ? 112.91 108.50 4.41 0.70 N 72 13 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.19 108.50 4.69 0.70 N 73 13 "O4'" A U 8 ? ? "C1'" A U 8 ? ? N1 A U 8 ? ? 112.79 108.50 4.29 0.70 N 74 13 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 120.87 117.70 3.17 0.50 N 75 13 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 112.91 108.50 4.41 0.70 N 76 13 C2 A G 19 ? ? N3 A G 19 ? ? C4 A G 19 ? ? 115.04 111.90 3.14 0.50 N 77 13 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 121.13 117.70 3.43 0.50 N 78 13 N1 A G 24 ? ? C6 A G 24 ? ? O6 A G 24 ? ? 116.20 119.90 -3.70 0.60 N 79 13 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 120.70 117.70 3.00 0.50 N 80 14 C5 A A 3 ? ? C6 A A 3 ? ? N1 A A 3 ? ? 121.51 117.70 3.81 0.50 N 81 14 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.49 108.50 4.99 0.70 N 82 14 C5 A A 5 ? ? C6 A A 5 ? ? N1 A A 5 ? ? 120.98 117.70 3.28 0.50 N 83 14 "O4'" A U 6 ? ? "C1'" A U 6 ? ? N1 A U 6 ? ? 113.07 108.50 4.57 0.70 N 84 14 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 121.37 117.70 3.67 0.50 N 85 14 "C5'" A A 10 ? ? "C4'" A A 10 ? ? "C3'" A A 10 ? ? 106.33 115.20 -8.87 1.40 N 86 14 C4 A A 12 ? ? C5 A A 12 ? ? C6 A A 12 ? ? 113.77 117.00 -3.23 0.50 N 87 14 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 121.77 117.70 4.07 0.50 N 88 14 "O4'" A C 13 ? ? "C4'" A C 13 ? ? "C3'" A C 13 ? ? 111.67 106.10 5.57 0.80 N 89 14 "C4'" A C 13 ? ? "C3'" A C 13 ? ? "C2'" A C 13 ? ? 95.06 102.60 -7.54 1.00 N 90 14 C4 A A 14 ? ? C5 A A 14 ? ? C6 A A 14 ? ? 113.52 117.00 -3.48 0.50 N 91 14 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 121.70 117.70 4.00 0.50 N 92 14 C4 A A 15 ? ? C5 A A 15 ? ? C6 A A 15 ? ? 113.08 117.00 -3.92 0.50 N 93 14 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 122.05 117.70 4.35 0.50 N 94 14 C5 A A 15 ? ? N7 A A 15 ? ? C8 A A 15 ? ? 100.37 103.90 -3.53 0.50 N 95 14 N7 A A 15 ? ? C8 A A 15 ? ? N9 A A 15 ? ? 117.10 113.80 3.30 0.50 N 96 14 N1 A A 15 ? ? C6 A A 15 ? ? N6 A A 15 ? ? 114.32 118.60 -4.28 0.60 N 97 14 N3 A U 16 ? ? C2 A U 16 ? ? O2 A U 16 ? ? 118.00 122.20 -4.20 0.70 N 98 14 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 113.64 108.50 5.14 0.70 N 99 14 C5 A G 19 ? ? C6 A G 19 ? ? N1 A G 19 ? ? 114.62 111.50 3.12 0.50 N 100 14 C4 A A 20 ? ? C5 A A 20 ? ? C6 A A 20 ? ? 113.73 117.00 -3.27 0.50 N 101 14 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 121.95 117.70 4.25 0.50 N 102 14 N3 A C 22 ? ? C2 A C 22 ? ? O2 A C 22 ? ? 116.72 121.90 -5.18 0.70 N 103 14 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 122.27 117.70 4.57 0.50 N 104 14 C5 A G 24 ? ? C6 A G 24 ? ? N1 A G 24 ? ? 114.57 111.50 3.07 0.50 N 105 14 N1 A G 24 ? ? C6 A G 24 ? ? O6 A G 24 ? ? 114.47 119.90 -5.43 0.60 N 106 14 C4 A A 26 ? ? C5 A A 26 ? ? C6 A A 26 ? ? 113.99 117.00 -3.01 0.50 N 107 14 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 121.97 117.70 4.27 0.50 N 108 14 C5 A A 28 ? ? C6 A A 28 ? ? N1 A A 28 ? ? 121.77 117.70 4.07 0.50 N 109 14 "O4'" A U 29 ? ? "C1'" A U 29 ? ? N1 A U 29 ? ? 113.09 108.50 4.59 0.70 N 110 14 N3 A C 30 ? ? C2 A C 30 ? ? O2 A C 30 ? ? 117.29 121.90 -4.61 0.70 N 111 15 "C5'" A U 8 ? ? "C4'" A U 8 ? ? "C3'" A U 8 ? ? 106.30 115.20 -8.90 1.40 N 112 15 "C5'" A G 9 ? ? "C4'" A G 9 ? ? "C3'" A G 9 ? ? 105.28 115.20 -9.92 1.40 N 113 15 "C5'" A A 10 ? ? "C4'" A A 10 ? ? "C3'" A A 10 ? ? 105.78 115.20 -9.42 1.40 N 114 16 "O4'" A G 2 ? ? "C1'" A G 2 ? ? N9 A G 2 ? ? 112.73 108.50 4.23 0.70 N 115 16 C5 A A 3 ? ? C6 A A 3 ? ? N1 A A 3 ? ? 120.89 117.70 3.19 0.50 N 116 16 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 112.73 108.50 4.23 0.70 N 117 16 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 120.83 117.70 3.13 0.50 N 118 16 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 120.71 117.70 3.01 0.50 N 119 16 "O4'" A C 13 ? ? "C4'" A C 13 ? ? "C3'" A C 13 ? ? 111.15 106.10 5.05 0.80 N 120 16 "C4'" A C 13 ? ? "C3'" A C 13 ? ? "C2'" A C 13 ? ? 95.37 102.60 -7.23 1.00 N 121 16 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 121.05 117.70 3.35 0.50 N 122 16 N1 A A 14 ? ? C6 A A 14 ? ? N6 A A 14 ? ? 114.99 118.60 -3.61 0.60 N 123 16 C4 A A 15 ? ? C5 A A 15 ? ? C6 A A 15 ? ? 113.56 117.00 -3.44 0.50 N 124 16 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.89 117.70 4.19 0.50 N 125 16 N1 A A 15 ? ? C6 A A 15 ? ? N6 A A 15 ? ? 114.39 118.60 -4.21 0.60 N 126 16 N3 A U 16 ? ? C2 A U 16 ? ? O2 A U 16 ? ? 117.93 122.20 -4.27 0.70 N 127 16 N1 A G 19 ? ? C6 A G 19 ? ? O6 A G 19 ? ? 115.50 119.90 -4.40 0.60 N 128 16 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 120.81 117.70 3.11 0.50 N 129 16 N3 A C 22 ? ? C2 A C 22 ? ? O2 A C 22 ? ? 117.62 121.90 -4.28 0.70 N 130 16 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 121.53 117.70 3.83 0.50 N 131 16 N1 A G 24 ? ? C6 A G 24 ? ? O6 A G 24 ? ? 115.39 119.90 -4.51 0.60 N 132 16 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 121.37 117.70 3.67 0.50 N 133 16 "O4'" A U 27 ? ? "C1'" A U 27 ? ? N1 A U 27 ? ? 113.05 108.50 4.55 0.70 N 134 16 C5 A A 28 ? ? C6 A A 28 ? ? N1 A A 28 ? ? 120.71 117.70 3.01 0.50 N 135 16 N3 A C 30 ? ? C2 A C 30 ? ? O2 A C 30 ? ? 117.54 121.90 -4.36 0.70 N 136 17 "O4'" A U 16 ? ? "C1'" A U 16 ? ? N1 A U 16 ? ? 113.19 108.50 4.69 0.70 N 137 17 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 115.06 108.50 6.56 0.70 N 138 17 "O4'" A G 24 ? ? "C1'" A G 24 ? ? N9 A G 24 ? ? 113.16 108.50 4.66 0.70 N 139 18 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.19 108.50 4.69 0.70 N 140 18 "O4'" A U 8 ? ? "C1'" A U 8 ? ? N1 A U 8 ? ? 113.44 108.50 4.94 0.70 N 141 18 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 120.72 117.70 3.02 0.50 N 142 18 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 120.72 117.70 3.02 0.50 N 143 18 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.21 117.70 3.51 0.50 N 144 18 "O4'" A G 19 ? ? "C1'" A G 19 ? ? N9 A G 19 ? ? 112.77 108.50 4.27 0.70 N 145 18 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 121.23 117.70 3.53 0.50 N 146 18 C5 A A 28 ? ? C6 A A 28 ? ? N1 A A 28 ? ? 120.73 117.70 3.03 0.50 N 147 19 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 112.77 108.50 4.27 0.70 N 148 19 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 121.46 117.70 3.76 0.50 N 149 19 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 120.89 117.70 3.19 0.50 N 150 19 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 121.73 117.70 4.03 0.50 N 151 19 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.25 117.70 3.55 0.50 N 152 19 "O4'" A U 18 ? ? "C1'" A U 18 ? ? N1 A U 18 ? ? 113.26 108.50 4.76 0.70 N 153 19 N1 A G 19 ? ? C6 A G 19 ? ? O6 A G 19 ? ? 115.63 119.90 -4.27 0.60 N 154 19 C5 A A 20 ? ? C6 A A 20 ? ? N1 A A 20 ? ? 120.93 117.70 3.23 0.50 N 155 19 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 121.56 117.70 3.86 0.50 N 156 19 N1 A G 24 ? ? C6 A G 24 ? ? O6 A G 24 ? ? 115.70 119.90 -4.20 0.60 N 157 19 N1 A A 26 ? ? C6 A A 26 ? ? N6 A A 26 ? ? 113.53 118.60 -5.07 0.60 N 158 19 C5 A A 28 ? ? C6 A A 28 ? ? N1 A A 28 ? ? 120.81 117.70 3.11 0.50 N 159 20 C5 A A 3 ? ? C6 A A 3 ? ? N1 A A 3 ? ? 120.88 117.70 3.18 0.50 N 160 20 "O4'" A U 4 ? ? "C1'" A U 4 ? ? N1 A U 4 ? ? 113.06 108.50 4.56 0.70 N 161 20 C5 A A 5 ? ? C6 A A 5 ? ? N1 A A 5 ? ? 121.04 117.70 3.34 0.50 N 162 20 "O4'" A U 6 ? ? "C1'" A U 6 ? ? N1 A U 6 ? ? 112.94 108.50 4.44 0.70 N 163 20 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 120.84 117.70 3.14 0.50 N 164 20 "O4'" A U 8 ? ? "C1'" A U 8 ? ? N1 A U 8 ? ? 113.21 108.50 4.71 0.70 N 165 20 C5 A A 10 ? ? C6 A A 10 ? ? N1 A A 10 ? ? 120.99 117.70 3.29 0.50 N 166 20 C5 A A 12 ? ? C6 A A 12 ? ? N1 A A 12 ? ? 121.16 117.70 3.46 0.50 N 167 20 N3 A C 13 ? ? C4 A C 13 ? ? C5 A C 13 ? ? 124.35 121.90 2.45 0.40 N 168 20 C5 A A 14 ? ? C6 A A 14 ? ? N1 A A 14 ? ? 121.95 117.70 4.25 0.50 N 169 20 C4 A A 15 ? ? C5 A A 15 ? ? C6 A A 15 ? ? 113.94 117.00 -3.06 0.50 N 170 20 C5 A A 15 ? ? C6 A A 15 ? ? N1 A A 15 ? ? 121.92 117.70 4.22 0.50 N 171 20 N1 A A 15 ? ? C6 A A 15 ? ? N6 A A 15 ? ? 114.90 118.60 -3.70 0.60 N 172 20 C5 A G 19 ? ? C6 A G 19 ? ? N1 A G 19 ? ? 114.58 111.50 3.08 0.50 N 173 20 N1 A G 19 ? ? C6 A G 19 ? ? O6 A G 19 ? ? 115.75 119.90 -4.15 0.60 N 174 20 N1 A A 20 ? ? C6 A A 20 ? ? N6 A A 20 ? ? 114.62 118.60 -3.98 0.60 N 175 20 "O4'" A U 21 ? ? "C1'" A U 21 ? ? N1 A U 21 ? ? 112.87 108.50 4.37 0.70 N 176 20 N3 A C 22 ? ? C2 A C 22 ? ? O2 A C 22 ? ? 117.66 121.90 -4.24 0.70 N 177 20 C5 A A 23 ? ? C6 A A 23 ? ? N1 A A 23 ? ? 121.84 117.70 4.14 0.50 N 178 20 C5 A A 26 ? ? C6 A A 26 ? ? N1 A A 26 ? ? 121.07 117.70 3.37 0.50 N 179 20 C5 A A 28 ? ? C6 A A 28 ? ? N1 A A 28 ? ? 120.95 117.70 3.25 0.50 N 180 20 "O4'" A U 29 ? ? "C1'" A U 29 ? ? N1 A U 29 ? ? 112.72 108.50 4.22 0.70 N 181 20 "O4'" A C 30 ? ? "C1'" A C 30 ? ? N1 A C 30 ? ? 112.75 108.50 4.25 0.70 N 182 20 N3 A C 30 ? ? C2 A C 30 ? ? O2 A C 30 ? ? 117.66 121.90 -4.24 0.70 N 183 20 N3 A C 31 ? ? C2 A C 31 ? ? O2 A C 31 ? ? 117.69 121.90 -4.21 0.70 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 2 A A 15 ? ? 0.054 'SIDE CHAIN' 2 3 A A 15 ? ? 0.068 'SIDE CHAIN' 3 4 A A 15 ? ? 0.063 'SIDE CHAIN' 4 5 A A 15 ? ? 0.060 'SIDE CHAIN' 5 9 A A 15 ? ? 0.060 'SIDE CHAIN' 6 11 A A 15 ? ? 0.068 'SIDE CHAIN' 7 13 A A 5 ? ? 0.055 'SIDE CHAIN' 8 13 A A 15 ? ? 0.055 'SIDE CHAIN' 9 16 A A 5 ? ? 0.053 'SIDE CHAIN' 10 16 A A 15 ? ? 0.098 'SIDE CHAIN' 11 17 U A 16 ? ? 0.079 'SIDE CHAIN' 12 17 U A 17 ? ? 0.060 'SIDE CHAIN' 13 19 A A 12 ? ? 0.056 'SIDE CHAIN' 14 19 U A 25 ? ? 0.069 'SIDE CHAIN' 15 19 A A 26 ? ? 0.060 'SIDE CHAIN' 16 20 A A 15 ? ? 0.076 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1YNC 'double helix' 1YNC 'a-form double helix' 1YNC 'hairpin loop' 1YNC 'bulge loop' 1YNC 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 31 1_555 -0.297 -0.088 -0.267 -9.494 3.188 3.371 1 A_G1:C31_A A 1 ? A 31 ? 19 1 1 A G 2 1_555 A C 30 1_555 -0.331 -0.127 0.072 -6.222 -7.281 -0.320 2 A_G2:C30_A A 2 ? A 30 ? 19 1 1 A A 3 1_555 A U 29 1_555 0.420 -0.110 0.149 -8.363 -17.694 -4.193 3 A_A3:U29_A A 3 ? A 29 ? 20 1 1 A U 4 1_555 A A 28 1_555 0.189 -0.197 0.440 -7.928 -15.119 -6.244 4 A_U4:A28_A A 4 ? A 28 ? 20 1 1 A A 5 1_555 A U 27 1_555 0.070 -0.149 0.536 -2.672 -14.783 -6.890 5 A_A5:U27_A A 5 ? A 27 ? 20 1 1 A U 6 1_555 A A 26 1_555 -0.008 -0.063 0.552 -3.623 -14.073 -5.375 6 A_U6:A26_A A 6 ? A 26 ? 20 1 1 A A 7 1_555 A G 24 1_555 -0.182 1.519 0.810 31.544 -6.902 -24.134 7 A_A7:G24_A A 7 ? A 24 ? 8 ? 1 A U 8 1_555 A A 23 1_555 -0.336 0.008 0.012 21.337 -15.207 -10.682 8 A_U8:A23_A A 8 ? A 23 ? 20 1 1 A G 9 1_555 A C 22 1_555 -0.372 -0.193 0.390 6.184 -17.484 -0.253 9 A_G9:C22_A A 9 ? A 22 ? 19 1 1 A A 10 1_555 A U 21 1_555 -0.233 0.044 0.793 4.873 -14.494 2.899 10 A_A10:U21_A A 10 ? A 21 ? 20 1 1 A U 11 1_555 A A 20 1_555 -0.133 -0.216 1.165 4.316 -16.899 7.308 11 A_U11:A20_A A 11 ? A 20 ? 20 1 1 A A 12 1_555 A G 19 1_555 -1.290 6.116 0.786 -30.422 -26.699 -63.846 12 A_A12:G19_A A 12 ? A 19 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 31 1_555 A G 2 1_555 A C 30 1_555 -0.016 -1.429 3.255 -0.232 7.002 29.459 -4.077 -0.013 2.847 13.529 0.448 30.262 1 AA_G1G2:C30C31_AA A 1 ? A 31 ? A 2 ? A 30 ? 1 A G 2 1_555 A C 30 1_555 A A 3 1_555 A U 29 1_555 -0.140 -1.470 3.254 1.623 3.517 37.299 -2.735 0.425 3.099 5.480 -2.530 37.492 2 AA_G2A3:U29C30_AA A 2 ? A 30 ? A 3 ? A 29 ? 1 A A 3 1_555 A U 29 1_555 A U 4 1_555 A A 28 1_555 -0.019 -1.590 3.121 -0.076 -3.532 33.171 -2.195 0.020 3.268 -6.165 0.132 33.353 3 AA_A3U4:A28U29_AA A 3 ? A 29 ? A 4 ? A 28 ? 1 A U 4 1_555 A A 28 1_555 A A 5 1_555 A U 27 1_555 0.084 -1.580 2.728 0.473 5.520 35.467 -3.195 -0.082 2.463 8.993 -0.770 35.883 4 AA_U4A5:U27A28_AA A 4 ? A 28 ? A 5 ? A 27 ? 1 A A 5 1_555 A U 27 1_555 A U 6 1_555 A A 26 1_555 0.019 -1.755 3.251 -0.138 -5.357 31.521 -2.181 -0.060 3.494 -9.773 0.253 31.962 5 AA_A5U6:A26U27_AA A 5 ? A 27 ? A 6 ? A 26 ? 1 A U 6 1_555 A A 26 1_555 A A 7 1_555 A G 24 1_555 1.634 -2.816 2.826 -15.968 -15.265 48.813 -2.246 -2.756 2.901 -17.473 18.278 53.299 6 AA_U6A7:G24A26_AA A 6 ? A 26 ? A 7 ? A 24 ? 1 A A 7 1_555 A G 24 1_555 A U 8 1_555 A A 23 1_555 0.655 -1.950 3.462 -1.688 -10.346 32.212 -1.436 -1.439 3.849 -18.059 2.946 33.832 7 AA_A7U8:A23G24_AA A 7 ? A 24 ? A 8 ? A 23 ? 1 A U 8 1_555 A A 23 1_555 A G 9 1_555 A C 22 1_555 0.356 -1.006 3.894 -2.549 0.024 39.385 -1.493 -0.884 3.863 0.036 3.778 39.464 8 AA_U8G9:C22A23_AA A 8 ? A 23 ? A 9 ? A 22 ? 1 A G 9 1_555 A C 22 1_555 A A 10 1_555 A U 21 1_555 -0.033 -1.770 2.958 -3.766 3.335 37.264 -3.129 -0.382 2.785 5.190 5.861 37.590 9 AA_G9A10:U21C22_AA A 9 ? A 22 ? A 10 ? A 21 ? 1 A A 10 1_555 A U 21 1_555 A U 11 1_555 A A 20 1_555 0.211 -1.642 3.195 -2.298 -0.464 30.560 -3.018 -0.843 3.195 -0.878 4.352 30.648 10 AA_A10U11:A20U21_AA A 10 ? A 21 ? A 11 ? A 20 ? 1 A U 11 1_555 A A 20 1_555 A A 12 1_555 A G 19 1_555 0.469 -3.455 1.509 15.592 21.524 68.814 -3.135 -0.221 0.628 18.371 -13.307 73.174 11 AA_U11A12:G19A20_AA A 11 ? A 20 ? A 12 ? A 19 ? #