data_1A51 # _entry.id 1A51 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1A51 pdb_00001a51 10.2210/pdb1a51/pdb WWPDB D_1000170400 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1998-05-27 2 'Structure model' 1 1 2008-03-24 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-16 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' Other 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1A51 _pdbx_database_status.recvd_initial_deposition_date 1998-02-19 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1A4D _pdbx_database_related.details 'MINIMIZED AVERAGE STRUCTURE' _pdbx_database_related.content_type 'representative structure' # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Dallas, A.' 1 'Moore, P.B.' 2 # _citation.id primary _citation.title ;The loop E-loop D region of Escherichia coli 5S rRNA: the solution structure reveals an unusual loop that may be important for binding ribosomal proteins. ; _citation.journal_abbrev Structure _citation.journal_volume 5 _citation.page_first 1639 _citation.page_last 1653 _citation.year 1997 _citation.journal_id_ASTM STRUE6 _citation.country UK _citation.journal_id_ISSN 0969-2126 _citation.journal_id_CSD 2005 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9438864 _citation.pdbx_database_id_DOI '10.1016/S0969-2126(97)00311-0' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Dallas, A.' 1 ? primary 'Moore, P.B.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method man _entity.pdbx_description '5S RRNA LOOP D/LOOP E' _entity.formula_weight 13299.919 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment 'LOOP D/LOOP E ARM' _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGCC _entity_poly.pdbx_seq_one_letter_code_can GGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 C n 1 5 G n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 U n 1 11 A n 1 12 G n 1 13 U n 1 14 G n 1 15 U n 1 16 G n 1 17 G n 1 18 G n 1 19 G n 1 20 U n 1 21 C n 1 22 U n 1 23 C n 1 24 C n 1 25 C n 1 26 C n 1 27 A n 1 28 U n 1 29 G n 1 30 C n 1 31 G n 1 32 A n 1 33 G n 1 34 A n 1 35 G n 1 36 U n 1 37 A n 1 38 G n 1 39 G n 1 40 C n 1 41 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type ? _entity_src_gen.pdbx_beg_seq_num ? _entity_src_gen.pdbx_end_seq_num ? _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus Escherichia _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 562 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location CYTOPLASM _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus Escherichia _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain JM101 _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name PAD3 _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 68 68 G G A . n A 1 2 G 2 69 69 G G A . n A 1 3 C 3 70 70 C C A . n A 1 4 C 4 71 71 C C A . n A 1 5 G 5 72 72 G G A . n A 1 6 A 6 73 73 A A A . n A 1 7 U 7 74 74 U U A . n A 1 8 G 8 75 75 G G A . n A 1 9 G 9 76 76 G G A . n A 1 10 U 10 77 77 U U A . n A 1 11 A 11 78 78 A A A . n A 1 12 G 12 79 79 G G A . n A 1 13 U 13 80 80 U U A . n A 1 14 G 14 81 81 G G A . n A 1 15 U 15 82 82 U U A . n A 1 16 G 16 83 83 G G A . n A 1 17 G 17 84 84 G G A . n A 1 18 G 18 85 85 G G A . n A 1 19 G 19 86 86 G G A . n A 1 20 U 20 87 87 U U A . n A 1 21 C 21 88 88 C C A . n A 1 22 U 22 89 89 U U A . n A 1 23 C 23 90 90 C C A . n A 1 24 C 24 91 91 C C A . n A 1 25 C 25 92 92 C C A . n A 1 26 C 26 93 93 C C A . n A 1 27 A 27 94 94 A A A . n A 1 28 U 28 95 95 U U A . n A 1 29 G 29 96 96 G G A . n A 1 30 C 30 97 97 C C A . n A 1 31 G 31 98 98 G G A . n A 1 32 A 32 99 99 A A A . n A 1 33 G 33 100 100 G G A . n A 1 34 A 34 101 101 A A A . n A 1 35 G 35 102 102 G G A . n A 1 36 U 36 103 103 U U A . n A 1 37 A 37 104 104 A A A . n A 1 38 G 38 105 105 G G A . n A 1 39 G 39 106 106 G G A . n A 1 40 C 40 107 107 C C A . n A 1 41 C 41 108 108 C C A . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' . ? 1 X-PLOR refinement . ? 2 X-PLOR phasing . ? 3 # _cell.entry_id 1A51 _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1A51 _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 1A51 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 1A51 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1A51 _struct.title 'LOOP D/LOOP E ARM OF E. COLI 5S RRNA, NMR, 9 STRUCTURES' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1A51 _struct_keywords.pdbx_keywords RNA _struct_keywords.text '5S RRNA, INTERNAL LOOP, CROSS-STRAND STACK, TRANSLATION, RIBOSOME, RIBONUCLEIC ACID, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1A51 _struct_ref.pdbx_db_accession 1A51 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1A51 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 41 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1A51 _struct_ref_seq.db_align_beg 68 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 108 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 68 _struct_ref_seq.pdbx_auth_seq_align_end 108 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 68 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 68 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 68 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 69 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 69 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 69 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 39 N1 ? ? A C 70 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 39 O6 ? ? A C 70 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 39 N2 ? ? A C 70 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 71 A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 71 A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 71 A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A A 37 N7 ? ? A G 72 A A 104 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog14 hydrog ? ? A G 5 N3 ? ? ? 1_555 A A 37 N6 ? ? A G 72 A A 104 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 36 O2 ? ? A A 73 A U 103 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A A 6 N7 ? ? ? 1_555 A U 36 N3 ? ? A A 73 A U 103 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A G 35 N1 ? ? A U 74 A G 102 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A G 8 O6 ? ? ? 1_555 A A 34 N6 ? ? A G 75 A A 101 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 A G 33 O6 ? ? A G 76 A G 100 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog20 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 32 N7 ? ? A U 77 A A 99 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog21 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 32 N6 ? ? A U 77 A A 99 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 A G 31 N3 ? ? A A 78 A G 98 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog23 hydrog ? ? A A 11 N7 ? ? ? 1_555 A G 31 N2 ? ? A A 78 A G 98 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog24 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 79 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 79 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 79 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 13 N3 ? ? ? 1_555 A G 29 O6 ? ? A U 80 A G 96 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A U 13 O2 ? ? ? 1_555 A G 29 N1 ? ? A U 80 A G 96 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A G 14 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 81 A U 95 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog30 hydrog ? ? A G 14 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 81 A U 95 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog31 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 82 A A 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 82 A A 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 83 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 83 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 83 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 84 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 84 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 84 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 18 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 85 A C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 18 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 85 A C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 18 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 85 A C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 86 A C 90 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O4 A U 74 ? ? H1 A G 102 ? ? 1.39 2 2 O4 A U 74 ? ? H1 A G 102 ? ? 1.50 3 3 O4 A U 74 ? ? H1 A G 102 ? ? 1.40 4 4 O4 A U 74 ? ? H1 A G 102 ? ? 1.47 5 5 O4 A U 74 ? ? H1 A G 102 ? ? 1.51 6 6 O4 A U 74 ? ? H1 A G 102 ? ? 1.43 7 7 O4 A U 74 ? ? H1 A G 102 ? ? 1.43 8 8 "HO2'" A C 88 ? ? O2 A C 90 ? ? 1.57 9 9 O4 A U 74 ? ? H1 A G 102 ? ? 1.41 # _pdbx_nmr_ensemble.entry_id 1A51 _pdbx_nmr_ensemble.conformers_calculated_total_number 60 _pdbx_nmr_ensemble.conformers_submitted_total_number 9 _pdbx_nmr_ensemble.conformer_selection_criteria 'NO NOE, DIHEDRAL VIOLATIONS, LOW OVERALL ENERGY STRUCTURES, GOOD LOCAL GEOMETRY' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 ? 7.2 ? . K 2 283 ? 5.5 ? . K # _pdbx_nmr_refine.entry_id 1A51 _pdbx_nmr_refine.method 'TORSION ANGLE MOLECULAR DYNAMICS' _pdbx_nmr_refine.details 'FOR REFINEMENT DETAILS, SEE STRUCTURE,5,P.1639' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR ? BRUNGER 1 'structure solution' X-PLOR ? ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1A51 'double helix' 1A51 'a-form double helix' 1A51 'hairpin loop' 1A51 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 41 1_555 -0.394 -0.250 0.043 -0.600 -3.479 0.410 1 A_G68:C108_A A 68 ? A 108 ? 19 1 1 A G 2 1_555 A C 40 1_555 -0.892 -0.447 -0.115 -2.016 0.245 0.791 2 A_G69:C107_A A 69 ? A 107 ? 19 1 1 A C 3 1_555 A G 39 1_555 0.743 -0.371 -0.219 3.116 -0.027 -0.448 3 A_C70:G106_A A 70 ? A 106 ? 19 1 1 A C 4 1_555 A G 38 1_555 0.236 -0.248 -0.279 -5.038 -5.757 2.351 4 A_C71:G105_A A 71 ? A 105 ? 19 1 1 A G 5 1_555 A A 37 1_555 6.909 -3.933 0.188 4.080 -1.333 -4.157 5 A_G72:A104_A A 72 ? A 104 ? 11 10 1 A A 6 1_555 A U 36 1_555 -3.550 -1.000 -0.023 2.884 -10.184 -108.003 6 A_A73:U103_A A 73 ? A 103 ? 24 4 1 A U 7 1_555 A G 35 1_555 -4.202 0.992 -0.425 -4.942 -7.955 -93.930 7 A_U74:G102_A A 74 ? A 102 ? ? 2 1 A G 8 1_555 A A 34 1_555 -2.011 2.182 -0.092 -1.291 -2.036 -70.262 8 A_G75:A101_A A 75 ? A 101 ? ? ? 1 A G 9 1_555 A G 33 1_555 4.433 0.927 -0.314 2.725 0.241 -95.071 9 A_G76:G100_A A 76 ? A 100 ? ? ? 1 A U 10 1_555 A A 32 1_555 3.991 -1.669 -0.477 2.904 -6.535 -94.504 10 A_U77:A99_A A 77 ? A 99 ? 24 4 1 A A 11 1_555 A G 31 1_555 -6.757 -4.333 -0.148 3.284 -0.220 0.735 11 A_A78:G98_A A 78 ? A 98 ? 11 9 1 A G 12 1_555 A C 30 1_555 -0.822 -0.440 -0.254 -2.535 -6.681 1.697 12 A_G79:C97_A A 79 ? A 97 ? 19 1 1 A U 13 1_555 A G 29 1_555 1.531 -0.379 0.450 3.385 -7.621 -4.524 13 A_U80:G96_A A 80 ? A 96 ? 28 1 1 A G 14 1_555 A U 28 1_555 -1.089 -0.736 -1.078 -10.725 -8.760 -5.646 14 A_G81:U95_A A 81 ? A 95 ? 28 1 1 A U 15 1_555 A A 27 1_555 0.062 -0.244 0.077 1.559 -6.516 0.642 15 A_U82:A94_A A 82 ? A 94 ? 20 1 1 A G 16 1_555 A C 26 1_555 -0.397 -0.751 0.888 5.084 -16.718 -8.434 16 A_G83:C93_A A 83 ? A 93 ? 19 1 1 A G 17 1_555 A C 25 1_555 -0.344 -0.263 -0.066 -0.551 -9.955 -0.041 17 A_G84:C92_A A 84 ? A 92 ? 19 1 1 A G 18 1_555 A C 24 1_555 -0.979 -0.450 -0.046 -6.994 -5.108 1.449 18 A_G85:C91_A A 85 ? A 91 ? 19 1 1 A G 19 1_555 A C 23 1_555 0.842 2.197 -1.197 -10.347 6.482 53.777 19 A_G86:C90_A A 86 ? A 90 ? ? 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 41 1_555 A G 2 1_555 A C 40 1_555 0.173 -1.654 3.083 -1.258 14.795 37.831 -3.798 -0.369 2.298 21.820 1.855 40.541 1 AA_G68G69:C107C108_AA A 68 ? A 108 ? A 69 ? A 107 ? 1 A G 2 1_555 A C 40 1_555 A C 3 1_555 A G 39 1_555 -0.072 -0.480 3.111 0.935 19.141 34.150 -2.848 0.211 2.505 29.860 -1.459 39.020 2 AA_G69C70:G106C107_AA A 69 ? A 107 ? A 70 ? A 106 ? 1 A C 3 1_555 A G 39 1_555 A C 4 1_555 A G 38 1_555 0.205 -1.903 3.311 1.590 12.953 35.260 -4.510 -0.128 2.490 20.535 -2.520 37.526 3 AA_C70C71:G105G106_AA A 70 ? A 106 ? A 71 ? A 105 ? 1 A C 4 1_555 A G 38 1_555 A G 5 1_555 A A 37 1_555 -0.457 0.039 3.078 0.343 8.760 59.505 -0.369 0.473 3.053 8.774 -0.343 60.089 4 AA_C71G72:A104G105_AA A 71 ? A 105 ? A 72 ? A 104 ? 1 A G 5 1_555 A A 37 1_555 A A 6 1_555 A U 36 1_555 -6.189 -0.634 2.889 -8.309 -2.698 -11.795 3.121 -26.207 -1.284 11.314 -34.835 -14.669 5 AA_G72A73:U103A104_AA A 72 ? A 104 ? A 73 ? A 103 ? 1 A A 6 1_555 A U 36 1_555 A U 7 1_555 A G 35 1_555 0.836 -3.323 3.276 1.201 9.344 56.733 -3.928 -0.809 2.759 9.758 -1.254 57.445 6 AA_A73U74:G102U103_AA A 73 ? A 103 ? A 74 ? A 102 ? 1 A U 7 1_555 A G 35 1_555 A G 8 1_555 A A 34 1_555 1.251 -2.254 3.014 0.415 -0.983 39.548 -3.222 -1.804 3.080 -1.453 -0.614 39.561 7 AA_U74G75:A101G102_AA A 74 ? A 102 ? A 75 ? A 101 ? 1 A G 8 1_555 A A 34 1_555 A G 9 1_555 A G 33 1_555 -0.551 -2.712 3.277 0.688 0.575 59.714 -2.752 0.588 3.247 0.578 -0.691 59.720 8 AA_G75G76:G100A101_AA A 75 ? A 101 ? A 76 ? A 100 ? 1 A G 9 1_555 A G 33 1_555 A U 10 1_555 A A 32 1_555 -0.774 -2.322 3.128 -5.294 -4.102 45.583 -2.616 0.535 3.378 -5.261 6.790 46.046 9 AA_G76U77:A99G100_AA A 76 ? A 100 ? A 77 ? A 99 ? 1 A U 10 1_555 A A 32 1_555 A A 11 1_555 A G 31 1_555 5.492 -0.932 3.134 -0.845 2.193 -18.521 1.685 16.471 3.465 -6.779 -2.613 -18.668 10 AA_U77A78:G98A99_AA A 77 ? A 99 ? A 78 ? A 98 ? 1 A A 11 1_555 A G 31 1_555 A G 12 1_555 A C 30 1_555 -0.202 -0.777 3.251 -4.869 7.187 65.500 -0.999 -0.009 3.166 6.612 4.479 66.009 11 AA_A78G79:C97G98_AA A 78 ? A 98 ? A 79 ? A 97 ? 1 A G 12 1_555 A C 30 1_555 A U 13 1_555 A G 29 1_555 -0.366 -0.659 3.116 -0.390 2.145 43.504 -1.084 0.458 3.085 2.892 0.526 43.556 12 AA_G79U80:G96C97_AA A 79 ? A 97 ? A 80 ? A 96 ? 1 A U 13 1_555 A G 29 1_555 A G 14 1_555 A U 28 1_555 -0.418 -2.192 4.025 6.797 -5.380 18.142 -3.043 5.293 4.080 -15.935 -20.132 20.091 13 AA_U80G81:U95G96_AA A 80 ? A 96 ? A 81 ? A 95 ? 1 A G 14 1_555 A U 28 1_555 A U 15 1_555 A A 27 1_555 0.374 -0.821 2.976 -7.470 -6.276 39.831 -0.543 -1.285 2.953 -9.048 10.770 40.961 14 AA_G81U82:A94U95_AA A 81 ? A 95 ? A 82 ? A 94 ? 1 A U 15 1_555 A A 27 1_555 A G 16 1_555 A C 26 1_555 -0.620 -1.524 2.933 -3.711 -0.574 29.762 -2.837 0.500 3.015 -1.113 7.189 29.992 15 AA_U82G83:C93A94_AA A 82 ? A 94 ? A 83 ? A 93 ? 1 A G 16 1_555 A C 26 1_555 A G 17 1_555 A C 25 1_555 0.416 -1.500 3.638 3.641 -8.113 32.748 -1.041 -0.025 3.910 -14.068 -6.314 33.901 16 AA_G83G84:C92C93_AA A 83 ? A 93 ? A 84 ? A 92 ? 1 A G 17 1_555 A C 25 1_555 A G 18 1_555 A C 24 1_555 0.275 -1.871 3.695 -3.083 -8.882 27.627 -1.363 -1.364 4.036 -17.953 6.232 29.153 17 AA_G84G85:C91C92_AA A 84 ? A 92 ? A 85 ? A 91 ? 1 A G 18 1_555 A C 24 1_555 A G 19 1_555 A C 23 1_555 2.655 -1.076 3.463 4.463 6.497 34.017 -2.859 -3.697 3.514 10.923 -7.504 34.892 18 AA_G85G86:C90C91_AA A 85 ? A 91 ? A 86 ? A 90 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 UNITY Varian 500 2 UNITYPLUS GE 600 3 OMEGA GE 600 # _atom_sites.entry_id 1A51 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_