data_1L3D
# 
_entry.id   1L3D 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.376 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
_database_2.pdbx_database_accession 
_database_2.pdbx_DOI 
PDB   1L3D         pdb_00001l3d 10.2210/pdb1l3d/pdb 
NDB   UR0021       ?            ?                   
RCSB  RCSB015603   ?            ?                   
WWPDB D_1000015603 ?            ?                   
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.db_id 
_pdbx_database_related.details 
_pdbx_database_related.content_type 
PDB 437D '437D is the same RNA pseudoknot structure at 1.6 Angstrom resolution' unspecified 
PDB 1L2X 'Atomic Resolution Crystal Structure of a Viral RNA Pseudoknot'        unspecified 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1L3D 
_pdbx_database_status.recvd_initial_deposition_date   2002-02-26 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Egli, M.'    1 
'Minasov, G.' 2 
'Su, L.'      3 
'Rich, A.'    4 
# 
_citation.id                        primary 
_citation.title                     'Metal ions and flexibility in a viral RNA pseudoknot at atomic resolution.' 
_citation.journal_abbrev            Proc.Natl.Acad.Sci.USA 
_citation.journal_volume            99 
_citation.page_first                4302 
_citation.page_last                 4307 
_citation.year                      2002 
_citation.journal_id_ASTM           PNASA6 
_citation.country                   US 
_citation.journal_id_ISSN           0027-8424 
_citation.journal_id_CSD            0040 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   11904368 
_citation.pdbx_database_id_DOI      10.1073/pnas.062055599 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Egli, M.'    1 ? 
primary 'Minasov, G.' 2 ? 
primary 'Su, L.'      3 ? 
primary 'Rich, A.'    4 ? 
# 
_cell.entry_id           1L3D 
_cell.length_a           107.810 
_cell.length_b           107.810 
_cell.length_c           107.810 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              24 
_cell.pdbx_unique_axis   ? 
# 
_symmetry.entry_id                         1L3D 
_symmetry.space_group_name_H-M             'I 21 3' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                199 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer syn 'RNA pseudoknot' 9245.484 1  ? ? ? 'Cubic crystal form' 
2 water   nat water            18.015   14 ? ? ? ?                    
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   yes 
_entity_poly.pdbx_seq_one_letter_code       '(GTP)GCGCGGCACCGUCCGCGGAACAAACGG' 
_entity_poly.pdbx_seq_one_letter_code_can   GGCGCGGCACCGUCCGCGGAACAAACGG 
_entity_poly.pdbx_strand_id                 A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  GTP n 
1 2  G   n 
1 3  C   n 
1 4  G   n 
1 5  C   n 
1 6  G   n 
1 7  G   n 
1 8  C   n 
1 9  A   n 
1 10 C   n 
1 11 C   n 
1 12 G   n 
1 13 U   n 
1 14 C   n 
1 15 C   n 
1 16 G   n 
1 17 C   n 
1 18 G   n 
1 19 G   n 
1 20 A   n 
1 21 A   n 
1 22 C   n 
1 23 A   n 
1 24 A   n 
1 25 A   n 
1 26 C   n 
1 27 G   n 
1 28 G   n 
# 
_pdbx_entity_src_syn.entity_id              1 
_pdbx_entity_src_syn.pdbx_src_id            1 
_pdbx_entity_src_syn.pdbx_alt_source_flag   sample 
_pdbx_entity_src_syn.pdbx_beg_seq_num       ? 
_pdbx_entity_src_syn.pdbx_end_seq_num       ? 
_pdbx_entity_src_syn.organism_scientific    ? 
_pdbx_entity_src_syn.organism_common_name   ? 
_pdbx_entity_src_syn.ncbi_taxonomy_id       ? 
_pdbx_entity_src_syn.details                'RNA SEQUENCE TAKEN FROM BEET WESTERN YELLOW VIRUS' 
# 
_struct_ref.id                         1 
_struct_ref.entity_id                  1 
_struct_ref.db_name                    PDB 
_struct_ref.db_code                    1L3D 
_struct_ref.pdbx_db_accession          1L3D 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.pdbx_seq_one_letter_code   ? 
_struct_ref.pdbx_align_begin           ? 
# 
_struct_ref_seq.align_id                      1 
_struct_ref_seq.ref_id                        1 
_struct_ref_seq.pdbx_PDB_id_code              1L3D 
_struct_ref_seq.pdbx_strand_id                A 
_struct_ref_seq.seq_align_beg                 1 
_struct_ref_seq.pdbx_seq_align_beg_ins_code   ? 
_struct_ref_seq.seq_align_end                 28 
_struct_ref_seq.pdbx_seq_align_end_ins_code   ? 
_struct_ref_seq.pdbx_db_accession             1L3D 
_struct_ref_seq.db_align_beg                  1 
_struct_ref_seq.pdbx_db_align_beg_ins_code    ? 
_struct_ref_seq.db_align_end                  28 
_struct_ref_seq.pdbx_db_align_end_ins_code    ? 
_struct_ref_seq.pdbx_auth_seq_align_beg       1 
_struct_ref_seq.pdbx_auth_seq_align_end       28 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A   'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P'   347.221 
C   'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'    323.197 
G   'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P'   363.221 
GTP non-polymer   n "GUANOSINE-5'-TRIPHOSPHATE"  ? 'C10 H16 N5 O14 P3' 523.180 
HOH non-polymer   . WATER                        ? 'H2 O'              18.015  
U   'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'    324.181 
# 
_exptl.entry_id          1L3D 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_percent_sol   78.22 
_exptl_crystal.density_Matthews      5.65 
_exptl_crystal.description           ? 
# 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, SITTING DROP' 
_exptl_crystal_grow.temp            277.0 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              5.0 
_exptl_crystal_grow.pdbx_details    'ammonium sulfate, sodium citrate, pH 5.0, VAPOR DIFFUSION, SITTING DROP, temperature 277.0K' 
_exptl_crystal_grow.pdbx_pH_range   . 
# 
loop_
_exptl_crystal_grow_comp.crystal_id 
_exptl_crystal_grow_comp.id 
_exptl_crystal_grow_comp.sol_id 
_exptl_crystal_grow_comp.name 
_exptl_crystal_grow_comp.conc 
_exptl_crystal_grow_comp.volume 
_exptl_crystal_grow_comp.details 
1 1 1 '(NH4)2SO4'      ? ? ? 
1 2 1 'sodium citrate' ? ? ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           100.0 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               'IMAGE PLATE' 
_diffrn_detector.type                   MARRESEARCH 
_diffrn_detector.pdbx_collection_date   1997-06-17 
_diffrn_detector.details                mirrors 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    graphite 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   1.0800 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'SSRL BEAMLINE BL1-5' 
_diffrn_source.pdbx_synchrotron_site       SSRL 
_diffrn_source.pdbx_synchrotron_beamline   BL1-5 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        1.0800 
# 
_reflns.entry_id                     1L3D 
_reflns.observed_criterion_sigma_I   -3.0 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             30.0 
_reflns.d_resolution_high            2.85 
_reflns.number_obs                   5034 
_reflns.number_all                   5034 
_reflns.percent_possible_obs         100.0 
_reflns.pdbx_Rmerge_I_obs            0.0540000 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        39.5 
_reflns.B_iso_Wilson_estimate        63.1 
_reflns.pdbx_redundancy              9.2 
_reflns.R_free_details               ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
# 
_reflns_shell.d_res_high             2.85 
_reflns_shell.d_res_low              2.95 
_reflns_shell.percent_possible_all   100.0 
_reflns_shell.Rmerge_I_obs           0.2860000 
_reflns_shell.pdbx_Rsym_value        ? 
_reflns_shell.meanI_over_sigI_obs    9.3 
_reflns_shell.pdbx_redundancy        8.9 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      486 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
# 
_refine.entry_id                                 1L3D 
_refine.ls_number_reflns_obs                     4989 
_refine.ls_number_reflns_all                     4989 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          0.0 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_d_res_low                             20.0 
_refine.ls_d_res_high                            2.85 
_refine.ls_percent_reflns_obs                    99.7 
_refine.ls_R_factor_obs                          ? 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.2710000 
_refine.ls_R_factor_R_free                       0.2750000 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  514 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               43.3 
_refine.aniso_B[1][1]                            1.768 
_refine.aniso_B[2][2]                            1.768 
_refine.aniso_B[3][3]                            1.768 
_refine.aniso_B[1][2]                            0.0 
_refine.aniso_B[1][3]                            0.0 
_refine.aniso_B[2][3]                            0.0 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  
;Crystallographic conjugate gradient minimization refinement 
using maximum likelihood target for amplitudes
;
_refine.pdbx_starting_model                      'PDB entry 437D' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             Isotropic 
_refine.pdbx_stereochemistry_target_values       'G. Parkinson et al., Acta Cryst. (1996) D52, 57-64' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.overall_SU_ML                            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   677 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             14 
_refine_hist.number_atoms_total               691 
_refine_hist.d_res_high                       2.85 
_refine_hist.d_res_low                        20.0 
# 
loop_
_refine_ls_restr.type 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.weight 
_refine_ls_restr.number 
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.pdbx_restraint_function 
c_bond_d    0.009 ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg 1.0   ? ? ? 'X-RAY DIFFRACTION' ? 
# 
_refine_ls_shell.pdbx_total_number_of_bins_used   ? 
_refine_ls_shell.d_res_high                       2.85 
_refine_ls_shell.d_res_low                        2.98 
_refine_ls_shell.number_reflns_R_work             ? 
_refine_ls_shell.R_factor_R_work                  0.4270000 
_refine_ls_shell.percent_reflns_obs               99.7 
_refine_ls_shell.R_factor_R_free                  0.4430000 
_refine_ls_shell.R_factor_R_free_error            ? 
_refine_ls_shell.percent_reflns_R_free            ? 
_refine_ls_shell.number_reflns_R_free             65 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
# 
_struct.entry_id                  1L3D 
_struct.title                     'Low Resolution Crystal Structure of a Viral RNA Pseudoknot' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        1L3D 
_struct_keywords.pdbx_keywords   RNA 
_struct_keywords.text            'Pseudoknot, frameshifting, viral RNA, flexibility, RNA' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 2 ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
_struct_conn.pdbx_role 
covale1  covale both ? A GTP 1  "O3'" ? ? ? 1_555 A G 2  P  ? ? A GTP 1  A G 2  1_555 ? ? ? ? ? ? ?             1.621 ? ? 
hydrog1  hydrog ?    ? A C   3  N3    ? ? ? 1_555 A G 18 N1 ? ? A C   3  A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog2  hydrog ?    ? A C   3  N4    ? ? ? 1_555 A G 18 O6 ? ? A C   3  A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog3  hydrog ?    ? A C   3  O2    ? ? ? 1_555 A G 18 N2 ? ? A C   3  A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog4  hydrog ?    ? A G   4  N1    ? ? ? 1_555 A C 17 O2 ? ? A G   4  A C 17 1_555 ? ? ? ? ? ? 'G-C PAIR'    ?     ? ? 
hydrog5  hydrog ?    ? A G   4  N2    ? ? ? 1_555 A A 20 N3 ? ? A G   4  A A 20 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ?     ? ? 
hydrog6  hydrog ?    ? A C   5  N3    ? ? ? 1_555 A G 16 N1 ? ? A C   5  A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog7  hydrog ?    ? A C   5  N4    ? ? ? 1_555 A G 16 O6 ? ? A C   5  A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog8  hydrog ?    ? A C   5  O2    ? ? ? 1_555 A G 16 N2 ? ? A C   5  A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog9  hydrog ?    ? A G   6  N1    ? ? ? 1_555 A C 15 N3 ? ? A G   6  A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog10 hydrog ?    ? A G   6  N2    ? ? ? 1_555 A C 15 O2 ? ? A G   6  A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog11 hydrog ?    ? A G   6  O6    ? ? ? 1_555 A C 15 N4 ? ? A G   6  A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog12 hydrog ?    ? A G   7  N1    ? ? ? 1_555 A C 14 N3 A ? A G   7  A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog13 hydrog ?    ? A G   7  N2    ? ? ? 1_555 A C 14 O2 A ? A G   7  A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog14 hydrog ?    ? A G   7  O6    ? ? ? 1_555 A C 14 N4 A ? A G   7  A C 14 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog15 hydrog ?    ? A G   7  N2    ? ? ? 1_555 A A 24 N1 ? ? A G   7  A A 24 1_555 ? ? ? ? ? ? TYPE_10_PAIR  ?     ? ? 
hydrog16 hydrog ?    ? A G   7  N3    ? ? ? 1_555 A A 24 N6 ? ? A G   7  A A 24 1_555 ? ? ? ? ? ? TYPE_10_PAIR  ?     ? ? 
hydrog17 hydrog ?    ? A C   8  N4    ? ? ? 1_555 A G 12 N7 A ? A C   8  A G 12 1_555 ? ? ? ? ? ? 'C-G PAIR'    ?     ? ? 
hydrog18 hydrog ?    ? A C   8  O2    ? ? ? 1_555 A C 26 N4 ? ? A C   8  A C 26 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ?     ? ? 
hydrog19 hydrog ?    ? A C   10 N3    ? ? ? 1_555 A G 28 N1 ? ? A C   10 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog20 hydrog ?    ? A C   10 N4    ? ? ? 1_555 A G 28 O6 ? ? A C   10 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog21 hydrog ?    ? A C   10 O2    ? ? ? 1_555 A G 28 N2 ? ? A C   10 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog22 hydrog ?    ? A C   11 N3    ? ? ? 1_555 A G 27 N1 ? ? A C   11 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog23 hydrog ?    ? A C   11 N4    ? ? ? 1_555 A G 27 O6 ? ? A C   11 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog24 hydrog ?    ? A C   11 O2    ? ? ? 1_555 A G 27 N2 ? ? A C   11 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog25 hydrog ?    ? A G   12 N1    A ? ? 1_555 A C 26 N3 ? ? A G   12 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog26 hydrog ?    ? A G   12 N2    A ? ? 1_555 A C 26 O2 ? ? A G   12 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog27 hydrog ?    ? A G   12 O6    A ? ? 1_555 A C 26 N4 ? ? A G   12 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? ? 
hydrog28 hydrog ?    ? A C   14 O2    A ? ? 1_555 A A 25 N6 ? ? A C   14 A A 25 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ?     ? ? 
hydrog29 hydrog ?    ? A C   15 O2    ? ? ? 1_555 A A 23 N6 ? ? A C   15 A A 23 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ?     ? ? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
covale ? ? 
hydrog ? ? 
# 
_database_PDB_matrix.entry_id          1L3D 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
# 
_atom_sites.entry_id                    1L3D 
_atom_sites.fract_transf_matrix[1][1]   0.009276 
_atom_sites.fract_transf_matrix[1][2]   -0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.009276 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.009276 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
C 
N 
O 
P 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  GTP 1  1  1  GTP GTP A . n 
A 1 2  G   2  2  2  G   G   A . n 
A 1 3  C   3  3  3  C   C   A . n 
A 1 4  G   4  4  4  G   G   A . n 
A 1 5  C   5  5  5  C   C   A . n 
A 1 6  G   6  6  6  G   G   A . n 
A 1 7  G   7  7  7  G   G   A . n 
A 1 8  C   8  8  8  C   C   A . n 
A 1 9  A   9  9  9  A   A   A . n 
A 1 10 C   10 10 10 C   C   A . n 
A 1 11 C   11 11 11 C   C   A . n 
A 1 12 G   12 12 12 G   G   A . n 
A 1 13 U   13 13 13 U   U   A . n 
A 1 14 C   14 14 14 C   C   A . n 
A 1 15 C   15 15 15 C   C   A . n 
A 1 16 G   16 16 16 G   G   A . n 
A 1 17 C   17 17 17 C   C   A . n 
A 1 18 G   18 18 18 G   G   A . n 
A 1 19 G   19 19 19 G   G   A . n 
A 1 20 A   20 20 20 A   A   A . n 
A 1 21 A   21 21 21 A   A   A . n 
A 1 22 C   22 22 22 C   C   A . n 
A 1 23 A   23 23 23 A   A   A . n 
A 1 24 A   24 24 24 A   A   A . n 
A 1 25 A   25 25 25 A   A   A . n 
A 1 26 C   26 26 26 C   C   A . n 
A 1 27 G   27 27 27 G   G   A . n 
A 1 28 G   28 28 28 G   G   A . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
B 2 HOH 1  29 29 HOH TIP A . 
B 2 HOH 2  30 30 HOH TIP A . 
B 2 HOH 3  31 31 HOH TIP A . 
B 2 HOH 4  32 32 HOH TIP A . 
B 2 HOH 5  33 33 HOH TIP A . 
B 2 HOH 6  34 34 HOH TIP A . 
B 2 HOH 7  35 35 HOH TIP A . 
B 2 HOH 8  36 36 HOH TIP A . 
B 2 HOH 9  37 37 HOH TIP A . 
B 2 HOH 10 38 38 HOH TIP A . 
B 2 HOH 11 39 39 HOH TIP A . 
B 2 HOH 12 40 40 HOH TIP A . 
B 2 HOH 13 41 41 HOH TIP A . 
B 2 HOH 14 42 42 HOH TIP A . 
# 
_pdbx_struct_mod_residue.id               1 
_pdbx_struct_mod_residue.label_asym_id    A 
_pdbx_struct_mod_residue.label_comp_id    GTP 
_pdbx_struct_mod_residue.label_seq_id     1 
_pdbx_struct_mod_residue.auth_asym_id     A 
_pdbx_struct_mod_residue.auth_comp_id     GTP 
_pdbx_struct_mod_residue.auth_seq_id      1 
_pdbx_struct_mod_residue.PDB_ins_code     ? 
_pdbx_struct_mod_residue.parent_comp_id   G 
_pdbx_struct_mod_residue.details          "GUANOSINE-5'-TRIPHOSPHATE" 
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   monomeric 
_pdbx_struct_assembly.oligomeric_count     1 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2002-03-22 
2 'Structure model' 1 1 2008-04-28 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2023-08-16 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' 'Data collection'           
4 4 'Structure model' 'Database references'       
5 4 'Structure model' 'Derived calculations'      
6 4 'Structure model' 'Refinement description'    
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 4 'Structure model' chem_comp_atom                
2 4 'Structure model' chem_comp_bond                
3 4 'Structure model' database_2                    
4 4 'Structure model' pdbx_initial_refinement_model 
5 4 'Structure model' struct_conn                   
# 
loop_
_pdbx_audit_revision_item.ordinal 
_pdbx_audit_revision_item.revision_ordinal 
_pdbx_audit_revision_item.data_content_type 
_pdbx_audit_revision_item.item 
1 4 'Structure model' '_database_2.pdbx_DOI'                
2 4 'Structure model' '_database_2.pdbx_database_accession' 
3 4 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' 
# 
loop_
_software.name 
_software.classification 
_software.version 
_software.citation_id 
_software.pdbx_ordinal 
AMoRE     phasing          . ? 1 
CNS       refinement       . ? 2 
DENZO     'data reduction' . ? 3 
SCALEPACK 'data scaling'   . ? 4 
# 
loop_
_chem_comp_atom.comp_id 
_chem_comp_atom.atom_id 
_chem_comp_atom.type_symbol 
_chem_comp_atom.pdbx_aromatic_flag 
_chem_comp_atom.pdbx_stereo_config 
_chem_comp_atom.pdbx_ordinal 
A   OP3    O N N 1   
A   P      P N N 2   
A   OP1    O N N 3   
A   OP2    O N N 4   
A   "O5'"  O N N 5   
A   "C5'"  C N N 6   
A   "C4'"  C N R 7   
A   "O4'"  O N N 8   
A   "C3'"  C N S 9   
A   "O3'"  O N N 10  
A   "C2'"  C N R 11  
A   "O2'"  O N N 12  
A   "C1'"  C N R 13  
A   N9     N Y N 14  
A   C8     C Y N 15  
A   N7     N Y N 16  
A   C5     C Y N 17  
A   C6     C Y N 18  
A   N6     N N N 19  
A   N1     N Y N 20  
A   C2     C Y N 21  
A   N3     N Y N 22  
A   C4     C Y N 23  
A   HOP3   H N N 24  
A   HOP2   H N N 25  
A   "H5'"  H N N 26  
A   "H5''" H N N 27  
A   "H4'"  H N N 28  
A   "H3'"  H N N 29  
A   "HO3'" H N N 30  
A   "H2'"  H N N 31  
A   "HO2'" H N N 32  
A   "H1'"  H N N 33  
A   H8     H N N 34  
A   H61    H N N 35  
A   H62    H N N 36  
A   H2     H N N 37  
C   OP3    O N N 38  
C   P      P N N 39  
C   OP1    O N N 40  
C   OP2    O N N 41  
C   "O5'"  O N N 42  
C   "C5'"  C N N 43  
C   "C4'"  C N R 44  
C   "O4'"  O N N 45  
C   "C3'"  C N S 46  
C   "O3'"  O N N 47  
C   "C2'"  C N R 48  
C   "O2'"  O N N 49  
C   "C1'"  C N R 50  
C   N1     N N N 51  
C   C2     C N N 52  
C   O2     O N N 53  
C   N3     N N N 54  
C   C4     C N N 55  
C   N4     N N N 56  
C   C5     C N N 57  
C   C6     C N N 58  
C   HOP3   H N N 59  
C   HOP2   H N N 60  
C   "H5'"  H N N 61  
C   "H5''" H N N 62  
C   "H4'"  H N N 63  
C   "H3'"  H N N 64  
C   "HO3'" H N N 65  
C   "H2'"  H N N 66  
C   "HO2'" H N N 67  
C   "H1'"  H N N 68  
C   H41    H N N 69  
C   H42    H N N 70  
C   H5     H N N 71  
C   H6     H N N 72  
G   OP3    O N N 73  
G   P      P N N 74  
G   OP1    O N N 75  
G   OP2    O N N 76  
G   "O5'"  O N N 77  
G   "C5'"  C N N 78  
G   "C4'"  C N R 79  
G   "O4'"  O N N 80  
G   "C3'"  C N S 81  
G   "O3'"  O N N 82  
G   "C2'"  C N R 83  
G   "O2'"  O N N 84  
G   "C1'"  C N R 85  
G   N9     N Y N 86  
G   C8     C Y N 87  
G   N7     N Y N 88  
G   C5     C Y N 89  
G   C6     C N N 90  
G   O6     O N N 91  
G   N1     N N N 92  
G   C2     C N N 93  
G   N2     N N N 94  
G   N3     N N N 95  
G   C4     C Y N 96  
G   HOP3   H N N 97  
G   HOP2   H N N 98  
G   "H5'"  H N N 99  
G   "H5''" H N N 100 
G   "H4'"  H N N 101 
G   "H3'"  H N N 102 
G   "HO3'" H N N 103 
G   "H2'"  H N N 104 
G   "HO2'" H N N 105 
G   "H1'"  H N N 106 
G   H8     H N N 107 
G   H1     H N N 108 
G   H21    H N N 109 
G   H22    H N N 110 
GTP PG     P N N 111 
GTP O1G    O N N 112 
GTP O2G    O N N 113 
GTP O3G    O N N 114 
GTP O3B    O N N 115 
GTP PB     P N N 116 
GTP O1B    O N N 117 
GTP O2B    O N N 118 
GTP O3A    O N N 119 
GTP PA     P N N 120 
GTP O1A    O N N 121 
GTP O2A    O N N 122 
GTP "O5'"  O N N 123 
GTP "C5'"  C N N 124 
GTP "C4'"  C N R 125 
GTP "O4'"  O N N 126 
GTP "C3'"  C N S 127 
GTP "O3'"  O N N 128 
GTP "C2'"  C N R 129 
GTP "O2'"  O N N 130 
GTP "C1'"  C N R 131 
GTP N9     N Y N 132 
GTP C8     C Y N 133 
GTP N7     N Y N 134 
GTP C5     C Y N 135 
GTP C6     C N N 136 
GTP O6     O N N 137 
GTP N1     N N N 138 
GTP C2     C N N 139 
GTP N2     N N N 140 
GTP N3     N N N 141 
GTP C4     C Y N 142 
GTP HOG2   H N N 143 
GTP HOG3   H N N 144 
GTP HOB2   H N N 145 
GTP HOA2   H N N 146 
GTP "H5'"  H N N 147 
GTP "H5''" H N N 148 
GTP "H4'"  H N N 149 
GTP "H3'"  H N N 150 
GTP "HO3'" H N N 151 
GTP "H2'"  H N N 152 
GTP "HO2'" H N N 153 
GTP "H1'"  H N N 154 
GTP H8     H N N 155 
GTP HN1    H N N 156 
GTP HN21   H N N 157 
GTP HN22   H N N 158 
HOH O      O N N 159 
HOH H1     H N N 160 
HOH H2     H N N 161 
U   OP3    O N N 162 
U   P      P N N 163 
U   OP1    O N N 164 
U   OP2    O N N 165 
U   "O5'"  O N N 166 
U   "C5'"  C N N 167 
U   "C4'"  C N R 168 
U   "O4'"  O N N 169 
U   "C3'"  C N S 170 
U   "O3'"  O N N 171 
U   "C2'"  C N R 172 
U   "O2'"  O N N 173 
U   "C1'"  C N R 174 
U   N1     N N N 175 
U   C2     C N N 176 
U   O2     O N N 177 
U   N3     N N N 178 
U   C4     C N N 179 
U   O4     O N N 180 
U   C5     C N N 181 
U   C6     C N N 182 
U   HOP3   H N N 183 
U   HOP2   H N N 184 
U   "H5'"  H N N 185 
U   "H5''" H N N 186 
U   "H4'"  H N N 187 
U   "H3'"  H N N 188 
U   "HO3'" H N N 189 
U   "H2'"  H N N 190 
U   "HO2'" H N N 191 
U   "H1'"  H N N 192 
U   H3     H N N 193 
U   H5     H N N 194 
U   H6     H N N 195 
# 
loop_
_chem_comp_bond.comp_id 
_chem_comp_bond.atom_id_1 
_chem_comp_bond.atom_id_2 
_chem_comp_bond.value_order 
_chem_comp_bond.pdbx_aromatic_flag 
_chem_comp_bond.pdbx_stereo_config 
_chem_comp_bond.pdbx_ordinal 
A   OP3   P      sing N N 1   
A   OP3   HOP3   sing N N 2   
A   P     OP1    doub N N 3   
A   P     OP2    sing N N 4   
A   P     "O5'"  sing N N 5   
A   OP2   HOP2   sing N N 6   
A   "O5'" "C5'"  sing N N 7   
A   "C5'" "C4'"  sing N N 8   
A   "C5'" "H5'"  sing N N 9   
A   "C5'" "H5''" sing N N 10  
A   "C4'" "O4'"  sing N N 11  
A   "C4'" "C3'"  sing N N 12  
A   "C4'" "H4'"  sing N N 13  
A   "O4'" "C1'"  sing N N 14  
A   "C3'" "O3'"  sing N N 15  
A   "C3'" "C2'"  sing N N 16  
A   "C3'" "H3'"  sing N N 17  
A   "O3'" "HO3'" sing N N 18  
A   "C2'" "O2'"  sing N N 19  
A   "C2'" "C1'"  sing N N 20  
A   "C2'" "H2'"  sing N N 21  
A   "O2'" "HO2'" sing N N 22  
A   "C1'" N9     sing N N 23  
A   "C1'" "H1'"  sing N N 24  
A   N9    C8     sing Y N 25  
A   N9    C4     sing Y N 26  
A   C8    N7     doub Y N 27  
A   C8    H8     sing N N 28  
A   N7    C5     sing Y N 29  
A   C5    C6     sing Y N 30  
A   C5    C4     doub Y N 31  
A   C6    N6     sing N N 32  
A   C6    N1     doub Y N 33  
A   N6    H61    sing N N 34  
A   N6    H62    sing N N 35  
A   N1    C2     sing Y N 36  
A   C2    N3     doub Y N 37  
A   C2    H2     sing N N 38  
A   N3    C4     sing Y N 39  
C   OP3   P      sing N N 40  
C   OP3   HOP3   sing N N 41  
C   P     OP1    doub N N 42  
C   P     OP2    sing N N 43  
C   P     "O5'"  sing N N 44  
C   OP2   HOP2   sing N N 45  
C   "O5'" "C5'"  sing N N 46  
C   "C5'" "C4'"  sing N N 47  
C   "C5'" "H5'"  sing N N 48  
C   "C5'" "H5''" sing N N 49  
C   "C4'" "O4'"  sing N N 50  
C   "C4'" "C3'"  sing N N 51  
C   "C4'" "H4'"  sing N N 52  
C   "O4'" "C1'"  sing N N 53  
C   "C3'" "O3'"  sing N N 54  
C   "C3'" "C2'"  sing N N 55  
C   "C3'" "H3'"  sing N N 56  
C   "O3'" "HO3'" sing N N 57  
C   "C2'" "O2'"  sing N N 58  
C   "C2'" "C1'"  sing N N 59  
C   "C2'" "H2'"  sing N N 60  
C   "O2'" "HO2'" sing N N 61  
C   "C1'" N1     sing N N 62  
C   "C1'" "H1'"  sing N N 63  
C   N1    C2     sing N N 64  
C   N1    C6     sing N N 65  
C   C2    O2     doub N N 66  
C   C2    N3     sing N N 67  
C   N3    C4     doub N N 68  
C   C4    N4     sing N N 69  
C   C4    C5     sing N N 70  
C   N4    H41    sing N N 71  
C   N4    H42    sing N N 72  
C   C5    C6     doub N N 73  
C   C5    H5     sing N N 74  
C   C6    H6     sing N N 75  
G   OP3   P      sing N N 76  
G   OP3   HOP3   sing N N 77  
G   P     OP1    doub N N 78  
G   P     OP2    sing N N 79  
G   P     "O5'"  sing N N 80  
G   OP2   HOP2   sing N N 81  
G   "O5'" "C5'"  sing N N 82  
G   "C5'" "C4'"  sing N N 83  
G   "C5'" "H5'"  sing N N 84  
G   "C5'" "H5''" sing N N 85  
G   "C4'" "O4'"  sing N N 86  
G   "C4'" "C3'"  sing N N 87  
G   "C4'" "H4'"  sing N N 88  
G   "O4'" "C1'"  sing N N 89  
G   "C3'" "O3'"  sing N N 90  
G   "C3'" "C2'"  sing N N 91  
G   "C3'" "H3'"  sing N N 92  
G   "O3'" "HO3'" sing N N 93  
G   "C2'" "O2'"  sing N N 94  
G   "C2'" "C1'"  sing N N 95  
G   "C2'" "H2'"  sing N N 96  
G   "O2'" "HO2'" sing N N 97  
G   "C1'" N9     sing N N 98  
G   "C1'" "H1'"  sing N N 99  
G   N9    C8     sing Y N 100 
G   N9    C4     sing Y N 101 
G   C8    N7     doub Y N 102 
G   C8    H8     sing N N 103 
G   N7    C5     sing Y N 104 
G   C5    C6     sing N N 105 
G   C5    C4     doub Y N 106 
G   C6    O6     doub N N 107 
G   C6    N1     sing N N 108 
G   N1    C2     sing N N 109 
G   N1    H1     sing N N 110 
G   C2    N2     sing N N 111 
G   C2    N3     doub N N 112 
G   N2    H21    sing N N 113 
G   N2    H22    sing N N 114 
G   N3    C4     sing N N 115 
GTP PG    O1G    doub N N 116 
GTP PG    O2G    sing N N 117 
GTP PG    O3G    sing N N 118 
GTP PG    O3B    sing N N 119 
GTP O2G   HOG2   sing N N 120 
GTP O3G   HOG3   sing N N 121 
GTP O3B   PB     sing N N 122 
GTP PB    O1B    doub N N 123 
GTP PB    O2B    sing N N 124 
GTP PB    O3A    sing N N 125 
GTP O2B   HOB2   sing N N 126 
GTP O3A   PA     sing N N 127 
GTP PA    O1A    doub N N 128 
GTP PA    O2A    sing N N 129 
GTP PA    "O5'"  sing N N 130 
GTP O2A   HOA2   sing N N 131 
GTP "O5'" "C5'"  sing N N 132 
GTP "C5'" "C4'"  sing N N 133 
GTP "C5'" "H5'"  sing N N 134 
GTP "C5'" "H5''" sing N N 135 
GTP "C4'" "O4'"  sing N N 136 
GTP "C4'" "C3'"  sing N N 137 
GTP "C4'" "H4'"  sing N N 138 
GTP "O4'" "C1'"  sing N N 139 
GTP "C3'" "O3'"  sing N N 140 
GTP "C3'" "C2'"  sing N N 141 
GTP "C3'" "H3'"  sing N N 142 
GTP "O3'" "HO3'" sing N N 143 
GTP "C2'" "O2'"  sing N N 144 
GTP "C2'" "C1'"  sing N N 145 
GTP "C2'" "H2'"  sing N N 146 
GTP "O2'" "HO2'" sing N N 147 
GTP "C1'" N9     sing N N 148 
GTP "C1'" "H1'"  sing N N 149 
GTP N9    C8     sing Y N 150 
GTP N9    C4     sing Y N 151 
GTP C8    N7     doub Y N 152 
GTP C8    H8     sing N N 153 
GTP N7    C5     sing Y N 154 
GTP C5    C6     sing N N 155 
GTP C5    C4     doub Y N 156 
GTP C6    O6     doub N N 157 
GTP C6    N1     sing N N 158 
GTP N1    C2     sing N N 159 
GTP N1    HN1    sing N N 160 
GTP C2    N2     sing N N 161 
GTP C2    N3     doub N N 162 
GTP N2    HN21   sing N N 163 
GTP N2    HN22   sing N N 164 
GTP N3    C4     sing N N 165 
HOH O     H1     sing N N 166 
HOH O     H2     sing N N 167 
U   OP3   P      sing N N 168 
U   OP3   HOP3   sing N N 169 
U   P     OP1    doub N N 170 
U   P     OP2    sing N N 171 
U   P     "O5'"  sing N N 172 
U   OP2   HOP2   sing N N 173 
U   "O5'" "C5'"  sing N N 174 
U   "C5'" "C4'"  sing N N 175 
U   "C5'" "H5'"  sing N N 176 
U   "C5'" "H5''" sing N N 177 
U   "C4'" "O4'"  sing N N 178 
U   "C4'" "C3'"  sing N N 179 
U   "C4'" "H4'"  sing N N 180 
U   "O4'" "C1'"  sing N N 181 
U   "C3'" "O3'"  sing N N 182 
U   "C3'" "C2'"  sing N N 183 
U   "C3'" "H3'"  sing N N 184 
U   "O3'" "HO3'" sing N N 185 
U   "C2'" "O2'"  sing N N 186 
U   "C2'" "C1'"  sing N N 187 
U   "C2'" "H2'"  sing N N 188 
U   "O2'" "HO2'" sing N N 189 
U   "C1'" N1     sing N N 190 
U   "C1'" "H1'"  sing N N 191 
U   N1    C2     sing N N 192 
U   N1    C6     sing N N 193 
U   C2    O2     doub N N 194 
U   C2    N3     sing N N 195 
U   N3    C4     sing N N 196 
U   N3    H3     sing N N 197 
U   C4    O4     doub N N 198 
U   C4    C5     sing N N 199 
U   C5    C6     doub N N 200 
U   C5    H5     sing N N 201 
U   C6    H6     sing N N 202 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
1L3D 'double helix'        
1L3D 'a-form double helix' 
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A C 3  1_555 A G 18 1_555 0.439  -0.405 0.214  10.360 -7.471  -3.277 1 A_C3:G18_A  A 3  ? A 18 ? 19 1 
1 A G 4  1_555 A C 17 1_555 -0.895 -0.037 0.054  -1.103 -18.766 11.994 2 A_G4:C17_A  A 4  ? A 17 ? ?  1 
1 A C 5  1_555 A G 16 1_555 -0.443 -0.215 0.004  1.991  -14.788 -0.317 3 A_C5:G16_A  A 5  ? A 16 ? 19 1 
1 A G 6  1_555 A C 15 1_555 0.545  -0.470 -0.086 -9.713 -5.112  -3.246 4 A_G6:C15_A  A 6  ? A 15 ? 19 1 
1 A G 7  1_555 A C 14 1_555 -0.004 -0.271 -0.198 -5.501 -8.703  -9.991 5 A_G7:C14_A  A 7  ? A 14 ? 19 1 
1 A C 26 1_555 A G 12 1_555 0.586  -0.068 0.012  4.505  -16.674 6.537  6 A_C26:G12_A A 26 ? A 12 ? 19 1 
1 A G 27 1_555 A C 11 1_555 -0.696 -0.364 0.562  -8.471 -15.796 -3.862 7 A_G27:C11_A A 27 ? A 11 ? 19 1 
1 A G 28 1_555 A C 10 1_555 -0.116 -0.418 0.581  -1.161 -13.716 -3.368 8 A_G28:C10_A A 28 ? A 10 ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A C 3  1_555 A G 18 1_555 A G 4  1_555 A C 17 1_555 0.987  -1.663 3.387 0.745  10.813 29.177 -5.076 -1.705 2.641 20.589 -1.418 
31.084 1 AA_C3G4:C17G18_AA   A 3  ? A 18 ? A 4  ? A 17 ? 
1 A G 4  1_555 A C 17 1_555 A C 5  1_555 A G 16 1_555 -0.767 -1.532 3.139 -2.571 1.921  33.151 -2.979 0.929  3.097 3.358  4.494  
33.302 2 AA_G4C5:G16C17_AA   A 4  ? A 17 ? A 5  ? A 16 ? 
1 A C 5  1_555 A G 16 1_555 A G 6  1_555 A C 15 1_555 -0.163 -1.753 3.523 0.503  11.013 32.816 -4.642 0.351  2.804 18.842 -0.861 
34.570 3 AA_C5G6:C15G16_AA   A 5  ? A 16 ? A 6  ? A 15 ? 
1 A G 6  1_555 A C 15 1_555 A G 7  1_555 A C 14 1_555 -0.075 -1.913 3.091 2.335  3.074  31.393 -4.032 0.534  2.882 5.655  -4.294 
31.623 4 AA_G6G7:C14C15_AA   A 6  ? A 15 ? A 7  ? A 14 ? 
1 A G 7  1_555 A C 14 1_555 A C 26 1_555 A G 12 1_555 -5.745 -0.362 3.764 9.207  -5.337 93.776 -0.141 4.101  3.335 -3.646 -6.290 
94.238 5 AA_G7C26:G12C14_AA  A 7  ? A 14 ? A 26 ? A 12 ? 
1 A C 26 1_555 A G 12 1_555 A G 27 1_555 A C 11 1_555 -0.660 -2.011 3.355 -8.596 10.314 23.616 -6.736 -0.634 2.380 22.976 19.149 
27.119 6 AA_C26G27:C11G12_AA A 26 ? A 12 ? A 27 ? A 11 ? 
1 A G 27 1_555 A C 11 1_555 A G 28 1_555 A C 10 1_555 0.187  -1.909 2.996 4.080  -0.272 37.612 -2.913 0.194  3.012 -0.420 -6.306 
37.826 7 AA_G27G28:C10C11_AA A 27 ? A 11 ? A 28 ? A 10 ? 
# 
_pdbx_entity_nonpoly.entity_id   2 
_pdbx_entity_nonpoly.name        water 
_pdbx_entity_nonpoly.comp_id     HOH 
# 
_pdbx_initial_refinement_model.id               1 
_pdbx_initial_refinement_model.entity_id_list   ? 
_pdbx_initial_refinement_model.type             'experimental model' 
_pdbx_initial_refinement_model.source_name      PDB 
_pdbx_initial_refinement_model.accession_code   437D 
_pdbx_initial_refinement_model.details          'PDB entry 437D' 
#