data_1MFJ # _entry.id 1MFJ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.355 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1MFJ pdb_00001mfj 10.2210/pdb1mfj/pdb RCSB RCSB016873 ? ? WWPDB D_1000016873 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1MFJ _pdbx_database_status.recvd_initial_deposition_date 2002-08-11 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Comolli, L.R.' 1 'Ulyanov, N.B.' 2 'James, T.L.' 3 'Gmeiner, W.H.' 4 # _citation.id primary _citation.title ;NMR Structure of the 3' Stem-Loop from Human U4 snRNA ; _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 30 _citation.page_first 4371 _citation.page_last 4379 _citation.year 2002 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 12384583 _citation.pdbx_database_id_DOI 10.1093/nar/gkf560 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Comolli, L.R.' 1 ? primary 'Ulyanov, N.B.' 2 ? primary 'Soto, A.M.' 3 ? primary 'Marky, L.A.' 4 ? primary 'James, T.L.' 5 ? primary 'Gmeiner, W.H.' 6 ? # _cell.entry_id 1MFJ _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1MFJ _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-R(*GP*AP*CP*AP*GP*UP*CP*UP*CP*UP*AP*CP*GP*GP*AP*GP*AP*CP*UP*G)-3'" _entity.formula_weight 6422.879 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ;3'stem-loop of human U4 snRNA ; # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GACAGUCUCUACGGAGACUG _entity_poly.pdbx_seq_one_letter_code_can GACAGUCUCUACGGAGACUG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 C n 1 4 A n 1 5 G n 1 6 U n 1 7 C n 1 8 U n 1 9 C n 1 10 U n 1 11 A n 1 12 C n 1 13 G n 1 14 G n 1 15 A n 1 16 G n 1 17 A n 1 18 C n 1 19 U n 1 20 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'This sequence is part of human U4 snRNA.' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1MFJ _struct_ref.pdbx_db_accession 1MFJ _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 1MFJ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 20 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1MFJ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 20 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 20 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D NOESY' 1 2 2 '2D NOESY' 2 3 1 DQF-COSY 1 4 1 '2D TOCSY' 1 5 1 'natural abundance 13C-HMQC' 1 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 303 ambient 6.4 '10 mM sodium phosphate & 50 mM NaCl' ? K 2 293 ambient 6.4 '10 mM sodium phosphate & 50 mM NaCl' ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 ;1 mM RNA; 10 mM sodium phosphate buffer; 50 mM sodium chloride ; D2O 2 ;1 mM RNA; 10 mM sodium phosphate buffer; 50 mM sodium chloride ; '90% H2O/10% D2O' # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model INOVA _pdbx_nmr_spectrometer.manufacturer Varian _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.type ? # _pdbx_nmr_refine.entry_id 1MFJ _pdbx_nmr_refine.method ;complete relaxation matrix; random error analysis of NOE; torsion angle dynamics; simulated annealing using Metropolis Monte Carlo; restrained minimization ; _pdbx_nmr_refine.details ;Structures are based on 200 distance restraints, of which 140 are quantitative bounds for nonexchangeable protons calculated with MARDIGRAS, 56 are upper bounds for exchangeable protons, and 4 are hydrogen bond restraints. ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_details.entry_id 1MFJ _pdbx_nmr_details.text ;This structure was determined using standard 2D homonuclear techniques and complete relaxation matrix analysis of NOE intensities. ; # _pdbx_nmr_ensemble.entry_id 1MFJ _pdbx_nmr_ensemble.conformers_calculated_total_number 15 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'Lowest total energy (a weighted sum of conformational energy and restraint energy).' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 1MFJ _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest total energy' # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal collection VNMR 6.1 'Varian Associates, Inc.' 1 processing NMRPipe 2.1 Delaglio 2 'data analysis' Sparky 3.0 'Goddard & Kneller' 3 'iterative matrix relaxation' MARDIGRAS 3.2 'Borgias et al.' 4 refinement DYANA 1.5 Guentert 5 refinement miniCarlo . 'Ulyanov et al.' 6 # _exptl.entry_id 1MFJ _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 1MFJ _struct.title ;3' Stem-Loop from Human U4 SNRNA ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1MFJ _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RIBONUCLEIC ACID, RNA OLIGONUCLEOTIDE, STEM-AND-LOOP, U4 SMALL NUCLEAR RNA, UACG TETRALOOP, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N2 ? ? ? 1_555 A A 2 N7 ? ? A G 1 A A 2 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog2 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 3 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 3 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 3 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 19 N3 ? ? A A 4 A U 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 19 O4 ? ? A A 4 A U 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 5 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 5 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 5 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 17 N1 ? ? A U 6 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 6 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 10 O2 ? ? ? 1_555 A G 13 N1 ? ? A U 10 A G 13 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog21 hydrog ? ? A U 10 N3 ? ? ? 1_555 A G 14 O6 ? ? A U 10 A G 14 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog22 hydrog ? ? A U 10 O2 ? ? ? 1_555 A G 14 N1 ? ? A U 10 A G 14 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 1MFJ _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 1MFJ _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 A 2 2 2 A A A . n A 1 3 C 3 3 3 C C A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 U 10 10 10 U U A . n A 1 11 A 11 11 11 A A A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 U 19 19 19 U U A . n A 1 20 G 20 20 20 G G A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2002-11-06 2 'Structure model' 1 1 2008-04-28 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-02-23 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_struct_assembly 3 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 7 _pdbx_validate_rmsd_angle.auth_atom_id_1 "C3'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 A _pdbx_validate_rmsd_angle.auth_seq_id_1 15 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C2'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 A _pdbx_validate_rmsd_angle.auth_seq_id_2 15 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 A _pdbx_validate_rmsd_angle.auth_seq_id_3 15 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 107.11 _pdbx_validate_rmsd_angle.angle_target_value 101.50 _pdbx_validate_rmsd_angle.angle_deviation 5.61 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.80 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1MFJ 'double helix' 1MFJ 'a-form double helix' 1MFJ tetraloop 1MFJ 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 2 1_555 A G 1 1_555 -6.578 -2.936 -1.033 46.208 -31.163 -8.191 1 A_A2:G1_A A 2 ? A 1 ? ? ? 1 A C 3 1_555 A G 20 1_555 -0.060 -0.113 0.234 -17.006 -0.918 -1.520 2 A_C3:G20_A A 3 ? A 20 ? 19 1 1 A A 4 1_555 A U 19 1_555 -0.021 -0.124 0.090 -4.413 -13.184 -4.577 3 A_A4:U19_A A 4 ? A 19 ? 20 1 1 A G 5 1_555 A C 18 1_555 0.053 -0.162 0.040 -6.629 -19.337 -0.990 4 A_G5:C18_A A 5 ? A 18 ? 19 1 1 A U 6 1_555 A A 17 1_555 0.060 -0.134 0.065 3.197 -14.657 -4.386 5 A_U6:A17_A A 6 ? A 17 ? 20 1 1 A C 7 1_555 A G 16 1_555 -0.111 -0.118 -0.158 12.561 -13.527 -1.075 6 A_C7:G16_A A 7 ? A 16 ? 19 1 1 A U 8 1_555 A A 15 1_555 0.064 -0.131 -0.457 12.678 -13.419 -1.356 7 A_U8:A15_A A 8 ? A 15 ? 20 1 1 A C 9 1_555 A G 14 1_555 0.043 -0.276 -0.592 5.190 20.834 -4.391 8 A_C9:G14_A A 9 ? A 14 ? 19 1 1 A U 10 1_555 A G 13 1_555 0.898 -5.524 -0.748 7.233 -13.174 -99.591 9 A_U10:G13_A A 10 ? A 13 ? ? 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 2 1_555 A G 1 1_555 A C 3 1_555 A G 20 1_555 -3.683 -2.495 2.952 35.121 -8.703 23.183 -3.050 6.552 -0.856 -14.048 -56.692 42.763 1 AA_A2C3:G20G1_AA A 2 ? A 1 ? A 3 ? A 20 ? 1 A C 3 1_555 A G 20 1_555 A A 4 1_555 A U 19 1_555 -0.416 -1.387 3.025 0.189 7.094 28.764 -4.026 0.849 2.613 14.012 -0.374 29.609 2 AA_C3A4:U19G20_AA A 3 ? A 20 ? A 4 ? A 19 ? 1 A A 4 1_555 A U 19 1_555 A G 5 1_555 A C 18 1_555 0.076 -1.407 3.387 0.306 11.047 31.807 -4.179 -0.083 2.759 19.438 -0.539 33.626 3 AA_A4G5:C18U19_AA A 4 ? A 19 ? A 5 ? A 18 ? 1 A G 5 1_555 A C 18 1_555 A U 6 1_555 A A 17 1_555 -0.213 -1.254 3.040 -1.250 4.548 31.091 -3.084 0.181 2.839 8.424 2.315 31.438 4 AA_G5U6:A17C18_AA A 5 ? A 18 ? A 6 ? A 17 ? 1 A U 6 1_555 A A 17 1_555 A C 7 1_555 A G 16 1_555 0.323 -1.394 3.039 1.044 3.794 30.139 -3.349 -0.426 2.856 7.258 -1.996 30.389 5 AA_U6C7:G16A17_AA A 6 ? A 17 ? A 7 ? A 16 ? 1 A C 7 1_555 A G 16 1_555 A U 8 1_555 A A 15 1_555 0.097 -1.455 3.329 1.543 7.562 31.845 -3.844 0.086 2.917 13.535 -2.761 32.743 6 AA_C7U8:A15G16_AA A 7 ? A 16 ? A 8 ? A 15 ? 1 A U 8 1_555 A A 15 1_555 A C 9 1_555 A G 14 1_555 -0.449 -1.848 3.725 -2.502 17.080 30.030 -5.769 0.367 2.390 30.045 4.401 34.539 7 AA_U8C9:G14A15_AA A 8 ? A 15 ? A 9 ? A 14 ? 1 A C 9 1_555 A G 14 1_555 A U 10 1_555 A G 13 1_555 -0.671 0.047 2.822 24.934 10.353 86.836 -0.145 0.904 2.595 7.383 -17.781 90.132 8 AA_C9U10:G13G14_AA A 9 ? A 14 ? A 10 ? A 13 ? #