data_1MWL # _entry.id 1MWL # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.386 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1MWL pdb_00001mwl 10.2210/pdb1mwl/pdb NDB DR0008 ? ? RCSB RCSB017251 ? ? WWPDB D_1000017251 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2003-02-18 2 'Structure model' 1 1 2008-04-28 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2012-02-08 5 'Structure model' 1 4 2024-02-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Derived calculations' 4 5 'Structure model' 'Data collection' 5 5 'Structure model' 'Database references' 6 5 'Structure model' 'Derived calculations' 7 5 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 5 'Structure model' chem_comp_atom 2 5 'Structure model' chem_comp_bond 3 5 'Structure model' database_2 4 5 'Structure model' pdbx_initial_refinement_model 5 5 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 5 'Structure model' '_database_2.pdbx_DOI' 2 5 'Structure model' '_database_2.pdbx_database_accession' 3 5 'Structure model' '_struct_site.pdbx_auth_asym_id' 4 5 'Structure model' '_struct_site.pdbx_auth_comp_id' 5 5 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1MWL _pdbx_database_status.recvd_initial_deposition_date 2002-09-30 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.SG_entry . _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1J7T 'Complex with paromomycin' unspecified PDB 1LC4 'Complex with tobramycin' unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Vicens, Q.' 1 'Westhof, E.' 2 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'Crystal structure of geneticin bound to a bacterial 16S ribosomal RNA A site oligonucleotide' J.Mol.Biol. 326 1175 1188 2003 JMOBAK UK 0022-2836 0070 ? 12589761 '10.1016/S0022-2836(02)01435-3' 1 ;Crystal structure of a complex between the aminoglycoside tobramycin and an oligonucleotide containing the ribosomal decoding A site ; Chem.Biol. 9 747 755 2002 CBOLE2 UK 1074-5521 2050 ? ? '10.1016/S1074-5521(02)00153-9' 2 'Crystal structure of paromomycin docked into the eubacterial ribosomal decoding A site' Structure 9 647 658 2001 STRUE6 UK 0969-2126 2005 ? ? '10.1016/S0969-2126(01)00629-3' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Vicens, Q.' 1 ? primary 'Westhof, E.' 2 ? 1 'Vicens, Q.' 3 ? 1 'Westhof, E.' 4 ? 2 'Vicens, Q.' 5 ? 2 'Westhof, E.' 6 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn "5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 7048.259 2 ? ? ? ;eubacterial 16S rRNA A site. The oligonucleotide contains two A sites. ; 2 non-polymer syn GENETICIN 496.552 2 ? ? ? ? 3 water nat water 18.015 40 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code CGCGUCACACCGGUGAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can CGCGUCACACCGGUGAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 GENETICIN GET 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 C n 1 7 A n 1 8 C n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 G n 1 14 U n 1 15 G n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 C n 1 21 G n 1 22 C n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GET non-polymer . GENETICIN G418 'C20 H40 N4 O10' 496.552 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 1 ? ? ? A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 A 7 7 7 A A A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 U 14 14 14 U U A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 G 18 18 18 G G A . n A 1 19 U 19 19 19 U U A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n B 1 1 C 1 23 ? ? ? B . n B 1 2 G 2 24 24 G G B . n B 1 3 C 3 25 25 C C B . n B 1 4 G 4 26 26 G G B . n B 1 5 U 5 27 27 U U B . n B 1 6 C 6 28 28 C C B . n B 1 7 A 7 29 29 A A B . n B 1 8 C 8 30 30 C C B . n B 1 9 A 9 31 31 A A B . n B 1 10 C 10 32 32 C C B . n B 1 11 C 11 33 33 C C B . n B 1 12 G 12 34 34 G G B . n B 1 13 G 13 35 35 G G B . n B 1 14 U 14 36 36 U U B . n B 1 15 G 15 37 37 G G B . n B 1 16 A 16 38 38 A A B . n B 1 17 A 17 39 39 A A B . n B 1 18 G 18 40 40 G G B . n B 1 19 U 19 41 41 U U B . n B 1 20 C 20 42 42 C C B . n B 1 21 G 21 43 43 G G B . n B 1 22 C 22 44 44 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GET 1 45 45 GET GET A . D 2 GET 1 46 46 GET GET A . E 3 HOH 1 102 102 HOH HOH A . E 3 HOH 2 104 104 HOH HOH A . E 3 HOH 3 106 106 HOH HOH A . E 3 HOH 4 108 108 HOH HOH A . E 3 HOH 5 111 111 HOH HOH A . E 3 HOH 6 114 114 HOH HOH A . E 3 HOH 7 115 115 HOH HOH A . E 3 HOH 8 116 116 HOH HOH A . E 3 HOH 9 118 118 HOH HOH A . E 3 HOH 10 119 119 HOH HOH A . E 3 HOH 11 121 121 HOH HOH A . E 3 HOH 12 122 122 HOH HOH A . E 3 HOH 13 126 126 HOH HOH A . E 3 HOH 14 127 127 HOH HOH A . E 3 HOH 15 129 129 HOH HOH A . E 3 HOH 16 130 130 HOH HOH A . E 3 HOH 17 132 132 HOH HOH A . E 3 HOH 18 134 134 HOH HOH A . E 3 HOH 19 135 135 HOH HOH A . E 3 HOH 20 136 136 HOH HOH A . E 3 HOH 21 137 137 HOH HOH A . E 3 HOH 22 139 139 HOH HOH A . E 3 HOH 23 140 140 HOH HOH A . F 3 HOH 1 101 101 HOH HOH B . F 3 HOH 2 103 103 HOH HOH B . F 3 HOH 3 105 105 HOH HOH B . F 3 HOH 4 107 107 HOH HOH B . F 3 HOH 5 109 109 HOH HOH B . F 3 HOH 6 110 110 HOH HOH B . F 3 HOH 7 112 112 HOH HOH B . F 3 HOH 8 113 113 HOH HOH B . F 3 HOH 9 117 117 HOH HOH B . F 3 HOH 10 120 120 HOH HOH B . F 3 HOH 11 123 123 HOH HOH B . F 3 HOH 12 124 124 HOH HOH B . F 3 HOH 13 125 125 HOH HOH B . F 3 HOH 14 128 128 HOH HOH B . F 3 HOH 15 131 131 HOH HOH B . F 3 HOH 16 133 133 HOH HOH B . F 3 HOH 17 138 138 HOH HOH B . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal DENZO 'data reduction' . ? 1 SCALEPACK 'data scaling' . ? 2 AMoRE phasing . ? 3 CNS refinement 1.1 ? 4 # _cell.entry_id 1MWL _cell.length_a 46.200 _cell.length_b 33.180 _cell.length_c 51.740 _cell.angle_alpha 90.00 _cell.angle_beta 104.13 _cell.angle_gamma 90.00 _cell.Z_PDB 4 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1MWL _symmetry.space_group_name_H-M 'P 1 21 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 4 # _exptl.entry_id 1MWL _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 2 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_percent_sol 54.91 _exptl_crystal.density_Matthews 2.73 _exptl_crystal.description ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 310 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 6.4 _exptl_crystal_grow.pdbx_details ;MPD, MAGNESIUM SULPHATE, POTASSIUM CHLORIDE, SODIUM CHLORIDE, SODIUM CACODYLATE, pH 6.4, VAPOR DIFFUSION, HANGING DROP, temperature 310K ; _exptl_crystal_grow.pdbx_pH_range . # loop_ _diffrn.id _diffrn.ambient_temp _diffrn.ambient_temp_details _diffrn.crystal_id 1 100 ? 1 2 100 ? 1 # loop_ _diffrn_detector.diffrn_id _diffrn_detector.detector _diffrn_detector.type _diffrn_detector.pdbx_collection_date _diffrn_detector.details 1 CCD 'ADSC QUANTUM 4' 2001-11-07 ? 2 CCD 'ADSC QUANTUM 4' 2002-03-11 ? # loop_ _diffrn_radiation.diffrn_id _diffrn_radiation.wavelength_id _diffrn_radiation.pdbx_monochromatic_or_laue_m_l _diffrn_radiation.monochromator _diffrn_radiation.pdbx_diffrn_protocol _diffrn_radiation.pdbx_scattering_type 1 1 M DIAMOND 'SINGLE WAVELENGTH' x-ray 2 1 M 'GERMANIUM, DIAMOND' 'SINGLE WAVELENGTH' x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.934 _diffrn_radiation_wavelength.wt 1.0 # loop_ _diffrn_source.diffrn_id _diffrn_source.source _diffrn_source.type _diffrn_source.pdbx_synchrotron_site _diffrn_source.pdbx_synchrotron_beamline _diffrn_source.pdbx_wavelength _diffrn_source.pdbx_wavelength_list 1 SYNCHROTRON 'ESRF BEAMLINE ID14-4' ESRF ID14-4 ? 0.934 2 SYNCHROTRON 'ESRF BEAMLINE ID14-1' ESRF ID14-1 ? 0.934 # _reflns.entry_id 1MWL _reflns.observed_criterion_sigma_I ? _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 25.0 _reflns.d_resolution_high 2.40 _reflns.number_obs 5466 _reflns.number_all ? _reflns.percent_possible_obs 88.8 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value 0.062 _reflns.pdbx_netI_over_sigmaI 39.3 _reflns.B_iso_Wilson_estimate 65.5 _reflns.pdbx_redundancy 4.8 _reflns.R_free_details ? _reflns.pdbx_ordinal 1 _reflns.pdbx_diffrn_id 1,2 # _reflns_shell.d_res_high 2.4 _reflns_shell.d_res_low 2.49 _reflns_shell.percent_possible_all 92.8 _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value 0.211 _reflns_shell.meanI_over_sigI_obs 6.7 _reflns_shell.pdbx_redundancy ? _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all 566 _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1,2 # _refine.entry_id 1MWL _refine.ls_number_reflns_obs 5334 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.5 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.ls_d_res_low 22.61 _refine.ls_d_res_high 2.40 _refine.ls_percent_reflns_obs 86.8 _refine.ls_R_factor_obs 0.224 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.224 _refine.ls_R_factor_R_free 0.249 _refine.ls_R_factor_R_free_error 0.014 _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 5.5 _refine.ls_number_reflns_R_free 296 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean 57.4 _refine.aniso_B[1][1] 0.00 _refine.aniso_B[2][2] 0.00 _refine.aniso_B[3][3] 0.00 _refine.aniso_B[1][2] 0.00 _refine.aniso_B[1][3] 0.00 _refine.aniso_B[2][3] 0.00 _refine.solvent_model_details 'FLAT MODEL' _refine.solvent_model_param_ksol 0.314673 _refine.solvent_model_param_bsol 36.9452 _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.details ? _refine.pdbx_starting_model 'PDB ENTRY 1LC4 (RNA ONLY)' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model RESTRAINED _refine.pdbx_stereochemistry_target_values ;G. Parkinson, J. Vojtechovsky, L. Clowney, A.T. Brunger, H.M. Berman, New parameters for the refinement of nucleic acid containing structures, Acta Cryst, D, 52, 57-64 (1996) ; _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_SU_ML ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1,2 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_analyze.entry_id 1MWL _refine_analyze.Luzzati_coordinate_error_obs ? _refine_analyze.Luzzati_sigma_a_obs ? _refine_analyze.Luzzati_d_res_low_obs ? _refine_analyze.Luzzati_coordinate_error_free 0.39 _refine_analyze.Luzzati_sigma_a_free 0.45 _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 898 _refine_hist.pdbx_number_atoms_ligand 68 _refine_hist.number_atoms_solvent 40 _refine_hist.number_atoms_total 1006 _refine_hist.d_res_high 2.40 _refine_hist.d_res_low 22.61 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.007 ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg 1.2 ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d 10.6 ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d 0.74 ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_scbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_scangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_total_number_of_bins_used 10 _refine_ls_shell.d_res_high 2.4 _refine_ls_shell.d_res_low 2.49 _refine_ls_shell.number_reflns_R_work 479 _refine_ls_shell.R_factor_R_work 0.386 _refine_ls_shell.percent_reflns_obs 82.4 _refine_ls_shell.R_factor_R_free 0.556 _refine_ls_shell.R_factor_R_free_error 0.119 _refine_ls_shell.percent_reflns_R_free 4.4 _refine_ls_shell.number_reflns_R_free 22 _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # loop_ _pdbx_xplor_file.serial_no _pdbx_xplor_file.param_file _pdbx_xplor_file.topol_file _pdbx_xplor_file.pdbx_refine_id 1 DNA-RNA_REP-MODIF.PARAM DNA-RNA.TOP 'X-RAY DIFFRACTION' 2 WATER_REP.PARAM WATER.TOP 'X-RAY DIFFRACTION' 3 GENETICIN.PARAM GENETICIN.TOP 'X-RAY DIFFRACTION' # _database_PDB_matrix.entry_id 1MWL _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1MWL _struct.title 'Crystal structure of geneticin bound to the eubacterial 16S rRNA A site' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1MWL _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'AMINOGLYCOSIDE ANTIBIOTIC, GENETICIN-A-SITE COMPLEX, 16S RIBOSOMAL RNA, Bulged adenines, UoU pairs, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1MWL _struct_ref.pdbx_db_accession 1MWL _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 1MWL A 1 ? 22 ? 1MWL 1 ? 22 ? 1 22 2 1 1MWL B 1 ? 22 ? 1MWL 23 ? 44 ? 23 44 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.pdbx_parent_biol_id ? _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 2 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 2 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 2 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 3 B G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 3 B G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 3 B G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 4 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 4 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 4 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 O4 ? ? ? 1_555 B U 19 N3 ? ? A U 5 B U 41 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 B G 18 N1 ? ? A C 6 B G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 B G 18 O6 ? ? A C 6 B G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 B G 18 N2 ? ? A C 6 B G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 8 N3 ? ? ? 1_555 B G 15 N1 ? ? A C 8 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 8 N4 ? ? ? 1_555 B G 15 O6 ? ? A C 8 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 8 O2 ? ? ? 1_555 B G 15 N2 ? ? A C 8 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 9 N1 ? ? ? 1_555 B U 14 N3 ? ? A A 9 B U 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 9 N6 ? ? ? 1_555 B U 14 O4 ? ? A A 9 B U 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 10 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 10 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 10 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 11 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 11 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 11 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 12 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 12 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 12 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 13 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 13 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 13 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 N3 ? ? ? 1_555 B A 9 N1 ? ? A U 14 B A 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 14 O4 ? ? ? 1_555 B A 9 N6 ? ? A U 14 B A 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 15 N1 ? ? ? 1_555 B C 8 N3 ? ? A G 15 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 15 N2 ? ? ? 1_555 B C 8 O2 ? ? A G 15 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 15 O6 ? ? ? 1_555 B C 8 N4 ? ? A G 15 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 18 N1 A ? ? 1_555 B C 6 N3 ? ? A G 18 B C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 18 N2 A ? ? 1_555 B C 6 O2 ? ? A G 18 B C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 18 O6 A ? ? 1_555 B C 6 N4 ? ? A G 18 B C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 19 N3 ? ? ? 1_555 B U 5 O4 ? ? A U 19 B U 27 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog40 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 20 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 20 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 20 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 21 B C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 21 B C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 21 B C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 22 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 22 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 22 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A GET 45 ? 13 'BINDING SITE FOR RESIDUE GET A 45' AC2 Software A GET 46 ? 12 'BINDING SITE FOR RESIDUE GET A 46' 1 ? ? ? ? ? ? ? # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 13 G A 15 ? G A 15 . ? 1_555 ? 2 AC1 13 A A 16 ? A A 16 . ? 1_555 ? 3 AC1 13 A A 17 ? A A 17 . ? 1_555 ? 4 AC1 13 G A 18 ? G A 18 . ? 1_555 ? 5 AC1 13 U A 19 ? U A 19 . ? 1_555 ? 6 AC1 13 HOH E . ? HOH A 119 . ? 1_555 ? 7 AC1 13 HOH E . ? HOH A 134 . ? 1_555 ? 8 AC1 13 C B 3 ? C B 25 . ? 1_555 ? 9 AC1 13 G B 4 ? G B 26 . ? 1_555 ? 10 AC1 13 U B 5 ? U B 27 . ? 1_555 ? 11 AC1 13 C B 6 ? C B 28 . ? 1_555 ? 12 AC1 13 A B 7 ? A B 29 . ? 1_555 ? 13 AC1 13 C B 8 ? C B 30 . ? 1_555 ? 14 AC2 12 G A 4 ? G A 4 . ? 1_555 ? 15 AC2 12 U A 5 ? U A 5 . ? 1_555 ? 16 AC2 12 C A 6 ? C A 6 . ? 1_555 ? 17 AC2 12 A A 7 ? A A 7 . ? 1_555 ? 18 AC2 12 C A 8 ? C A 8 . ? 1_555 ? 19 AC2 12 HOH E . ? HOH A 111 . ? 1_555 ? 20 AC2 12 HOH E . ? HOH A 118 . ? 1_555 ? 21 AC2 12 G B 15 ? G B 37 . ? 1_555 ? 22 AC2 12 A B 16 ? A B 38 . ? 1_555 ? 23 AC2 12 A B 17 ? A B 39 . ? 1_555 ? 24 AC2 12 G B 18 ? G B 40 . ? 1_555 ? 25 AC2 12 U B 19 ? U B 41 . ? 1_555 ? # _struct_site_keywords.site_id 1 _struct_site_keywords.text INTERCALATION # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A C 1 ? A C 1 2 1 Y 1 B C 23 ? B C 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GET C11 C N S 111 GET O11 O N N 112 GET C21 C N R 113 GET N21 N N N 114 GET C31 C N R 115 GET O31 O N N 116 GET C41 C N S 117 GET O41 O N N 118 GET C51 C N R 119 GET O51 O N N 120 GET C61 C N R 121 GET O61 O N N 122 GET C71 C N N 123 GET C12 C N R 124 GET N12 N N N 125 GET C22 C N N 126 GET C32 C N S 127 GET N32 N N N 128 GET C42 C N R 129 GET C52 C N S 130 GET O52 O N N 131 GET C62 C N S 132 GET O62 O N N 133 GET C13 C N R 134 GET C23 C N R 135 GET O23 O N N 136 GET C33 C N R 137 GET N33 N N N 138 GET C93 C N N 139 GET C43 C N R 140 GET O43 O N N 141 GET C83 C N N 142 GET C53 C N N 143 GET O53 O N N 144 GET H111 H N N 145 GET H21 H N N 146 GET H211 H N N 147 GET H212 H N N 148 GET H311 H N N 149 GET H31 H N N 150 GET H411 H N N 151 GET H41 H N N 152 GET H511 H N N 153 GET H611 H N N 154 GET H61 H N N 155 GET H711 H N N 156 GET H712 H N N 157 GET H713 H N N 158 GET H12 H N N 159 GET H121 H N N 160 GET H122 H N N 161 GET H221 H N N 162 GET H222 H N N 163 GET H32 H N N 164 GET H321 H N N 165 GET H322 H N N 166 GET H421 H N N 167 GET H521 H N N 168 GET H52 H N N 169 GET H621 H N N 170 GET H131 H N N 171 GET H231 H N N 172 GET H23 H N N 173 GET H331 H N N 174 GET H33 H N N 175 GET H931 H N N 176 GET H932 H N N 177 GET H933 H N N 178 GET H43 H N N 179 GET H831 H N N 180 GET H832 H N N 181 GET H833 H N N 182 GET H531 H N N 183 GET H532 H N N 184 HOH O O N N 185 HOH H1 H N N 186 HOH H2 H N N 187 U OP3 O N N 188 U P P N N 189 U OP1 O N N 190 U OP2 O N N 191 U "O5'" O N N 192 U "C5'" C N N 193 U "C4'" C N R 194 U "O4'" O N N 195 U "C3'" C N S 196 U "O3'" O N N 197 U "C2'" C N R 198 U "O2'" O N N 199 U "C1'" C N R 200 U N1 N N N 201 U C2 C N N 202 U O2 O N N 203 U N3 N N N 204 U C4 C N N 205 U O4 O N N 206 U C5 C N N 207 U C6 C N N 208 U HOP3 H N N 209 U HOP2 H N N 210 U "H5'" H N N 211 U "H5''" H N N 212 U "H4'" H N N 213 U "H3'" H N N 214 U "HO3'" H N N 215 U "H2'" H N N 216 U "HO2'" H N N 217 U "H1'" H N N 218 U H3 H N N 219 U H5 H N N 220 U H6 H N N 221 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GET C11 O11 sing N N 116 GET C11 C21 sing N N 117 GET C11 O51 sing N N 118 GET C11 H111 sing N N 119 GET O11 C42 sing N N 120 GET C21 N21 sing N N 121 GET C21 C31 sing N N 122 GET C21 H21 sing N N 123 GET N21 H211 sing N N 124 GET N21 H212 sing N N 125 GET C31 O31 sing N N 126 GET C31 C41 sing N N 127 GET C31 H311 sing N N 128 GET O31 H31 sing N N 129 GET C41 O41 sing N N 130 GET C41 C51 sing N N 131 GET C41 H411 sing N N 132 GET O41 H41 sing N N 133 GET C51 O51 sing N N 134 GET C51 C61 sing N N 135 GET C51 H511 sing N N 136 GET C61 O61 sing N N 137 GET C61 C71 sing N N 138 GET C61 H611 sing N N 139 GET O61 H61 sing N N 140 GET C71 H711 sing N N 141 GET C71 H712 sing N N 142 GET C71 H713 sing N N 143 GET C12 N12 sing N N 144 GET C12 C22 sing N N 145 GET C12 C62 sing N N 146 GET C12 H12 sing N N 147 GET N12 H121 sing N N 148 GET N12 H122 sing N N 149 GET C22 C32 sing N N 150 GET C22 H221 sing N N 151 GET C22 H222 sing N N 152 GET C32 N32 sing N N 153 GET C32 C42 sing N N 154 GET C32 H32 sing N N 155 GET N32 H321 sing N N 156 GET N32 H322 sing N N 157 GET C42 C52 sing N N 158 GET C42 H421 sing N N 159 GET C52 O52 sing N N 160 GET C52 C62 sing N N 161 GET C52 H521 sing N N 162 GET O52 H52 sing N N 163 GET C62 O62 sing N N 164 GET C62 H621 sing N N 165 GET O62 C13 sing N N 166 GET C13 C23 sing N N 167 GET C13 O53 sing N N 168 GET C13 H131 sing N N 169 GET C23 O23 sing N N 170 GET C23 C33 sing N N 171 GET C23 H231 sing N N 172 GET O23 H23 sing N N 173 GET C33 N33 sing N N 174 GET C33 C43 sing N N 175 GET C33 H331 sing N N 176 GET N33 C93 sing N N 177 GET N33 H33 sing N N 178 GET C93 H931 sing N N 179 GET C93 H932 sing N N 180 GET C93 H933 sing N N 181 GET C43 O43 sing N N 182 GET C43 C83 sing N N 183 GET C43 C53 sing N N 184 GET O43 H43 sing N N 185 GET C83 H831 sing N N 186 GET C83 H832 sing N N 187 GET C83 H833 sing N N 188 GET C53 O53 sing N N 189 GET C53 H531 sing N N 190 GET C53 H532 sing N N 191 HOH O H1 sing N N 192 HOH O H2 sing N N 193 U OP3 P sing N N 194 U OP3 HOP3 sing N N 195 U P OP1 doub N N 196 U P OP2 sing N N 197 U P "O5'" sing N N 198 U OP2 HOP2 sing N N 199 U "O5'" "C5'" sing N N 200 U "C5'" "C4'" sing N N 201 U "C5'" "H5'" sing N N 202 U "C5'" "H5''" sing N N 203 U "C4'" "O4'" sing N N 204 U "C4'" "C3'" sing N N 205 U "C4'" "H4'" sing N N 206 U "O4'" "C1'" sing N N 207 U "C3'" "O3'" sing N N 208 U "C3'" "C2'" sing N N 209 U "C3'" "H3'" sing N N 210 U "O3'" "HO3'" sing N N 211 U "C2'" "O2'" sing N N 212 U "C2'" "C1'" sing N N 213 U "C2'" "H2'" sing N N 214 U "O2'" "HO2'" sing N N 215 U "C1'" N1 sing N N 216 U "C1'" "H1'" sing N N 217 U N1 C2 sing N N 218 U N1 C6 sing N N 219 U C2 O2 doub N N 220 U C2 N3 sing N N 221 U N3 C4 sing N N 222 U N3 H3 sing N N 223 U C4 O4 doub N N 224 U C4 C5 sing N N 225 U C5 C6 doub N N 226 U C5 H5 sing N N 227 U C6 H6 sing N N 228 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1MWL 'a-form double helix' 1MWL 'mismatched base pair' 1MWL 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 B C 22 1_555 -0.751 -0.490 -0.085 -6.243 -5.306 -8.348 1 A_G2:C44_B A 2 ? B 44 ? 19 1 1 A C 3 1_555 B G 21 1_555 0.124 -0.068 0.074 -2.747 0.773 -0.881 2 A_C3:G43_B A 3 ? B 43 ? 19 1 1 A G 4 1_555 B C 20 1_555 -0.148 -0.281 -0.052 -0.922 -3.259 2.994 3 A_G4:C42_B A 4 ? B 42 ? 19 1 1 A U 5 1_555 B U 19 1_555 -2.319 -1.497 -0.533 3.097 -11.765 -7.448 4 A_U5:U41_B A 5 ? B 41 ? ? ? 1 A C 6 1_555 B G 18 1_555 0.385 -0.301 -0.338 -3.332 2.950 -0.978 5 A_C6:G40_B A 6 ? B 40 ? 19 1 1 A C 8 1_555 B G 15 1_555 0.081 -0.165 -0.008 3.783 -15.295 1.685 6 A_C8:G37_B A 8 ? B 37 ? 19 1 1 A A 9 1_555 B U 14 1_555 0.288 -0.189 0.021 3.565 -16.562 2.617 7 A_A9:U36_B A 9 ? B 36 ? 20 1 1 A C 10 1_555 B G 13 1_555 0.247 0.004 0.058 5.345 -19.414 5.128 8 A_C10:G35_B A 10 ? B 35 ? 19 1 1 A C 11 1_555 B G 12 1_555 -0.163 -0.236 -0.175 7.074 -9.501 0.804 9 A_C11:G34_B A 11 ? B 34 ? 19 1 1 A G 12 1_555 B C 11 1_555 -0.228 -0.039 -0.303 -5.922 -13.556 -0.838 10 A_G12:C33_B A 12 ? B 33 ? 19 1 1 A G 13 1_555 B C 10 1_555 -0.087 -0.156 0.162 -3.024 -12.494 1.084 11 A_G13:C32_B A 13 ? B 32 ? 19 1 1 A U 14 1_555 B A 9 1_555 0.171 -0.103 0.222 -10.168 -16.577 -0.145 12 A_U14:A31_B A 14 ? B 31 ? 20 1 1 A G 15 1_555 B C 8 1_555 0.102 -0.087 0.101 -3.558 -8.233 1.528 13 A_G15:C30_B A 15 ? B 30 ? 19 1 1 A G 18 1_555 B C 6 1_555 -0.005 -0.075 -0.288 4.374 -3.011 3.452 14 A_G18:C28_B A 18 ? B 28 ? 19 1 1 A U 19 1_555 B U 5 1_555 2.283 -1.738 -0.262 -1.109 -9.677 -10.420 15 A_U19:U27_B A 19 ? B 27 ? ? ? 1 A C 20 1_555 B G 4 1_555 -0.032 -0.353 -0.016 -1.020 -2.545 -1.323 16 A_C20:G26_B A 20 ? B 26 ? 19 1 1 A G 21 1_555 B C 3 1_555 -0.146 -0.356 0.076 -0.480 -0.853 -4.989 17 A_G21:C25_B A 21 ? B 25 ? 19 1 1 A C 22 1_555 B G 2 1_555 0.337 -0.261 -0.306 4.554 -4.818 -4.449 18 A_C22:G24_B A 22 ? B 24 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 B C 22 1_555 A C 3 1_555 B G 21 1_555 0.060 -1.589 3.216 -2.264 1.219 34.268 -2.876 -0.446 3.149 2.065 3.836 34.362 1 AA_G2C3:G43C44_BB A 2 ? B 44 ? A 3 ? B 43 ? 1 A C 3 1_555 B G 21 1_555 A G 4 1_555 B C 20 1_555 0.140 -2.022 3.229 -0.524 4.719 26.813 -5.400 -0.420 2.835 10.075 1.120 27.222 2 AA_C3G4:C42G43_BB A 3 ? B 43 ? A 4 ? B 42 ? 1 A G 4 1_555 B C 20 1_555 A U 5 1_555 B U 19 1_555 -0.550 -1.886 3.203 -0.044 1.640 23.786 -5.081 1.316 3.068 3.974 0.107 23.841 3 AA_G4U5:U41C42_BB A 4 ? B 42 ? A 5 ? B 41 ? 1 A U 5 1_555 B U 19 1_555 A C 6 1_555 B G 18 1_555 1.008 -2.411 3.633 -1.808 2.677 44.163 -3.469 -1.520 3.447 3.555 2.401 44.275 4 AA_U5C6:G40U41_BB A 5 ? B 41 ? A 6 ? B 40 ? 1 A C 8 1_555 B G 15 1_555 A A 9 1_555 B U 14 1_555 -0.191 -1.445 3.125 0.265 11.707 33.359 -3.915 0.349 2.491 19.655 -0.444 35.299 5 AA_C8A9:U36G37_BB A 8 ? B 37 ? A 9 ? B 36 ? 1 A A 9 1_555 B U 14 1_555 A C 10 1_555 B G 13 1_555 1.008 -1.914 3.231 1.503 2.189 27.786 -4.476 -1.742 3.123 4.546 -3.121 27.910 6 AA_A9C10:G35U36_BB A 9 ? B 36 ? A 10 ? B 35 ? 1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -0.991 -1.979 3.197 -1.323 5.294 29.570 -4.828 1.657 2.848 10.262 2.565 30.059 7 AA_C10C11:G34G35_BB A 10 ? B 35 ? A 11 ? B 34 ? 1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 -0.132 -1.638 3.638 0.480 10.885 31.249 -4.780 0.316 2.917 19.480 -0.859 33.049 8 AA_C11G12:C33G34_BB A 11 ? B 34 ? A 12 ? B 33 ? 1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 0.765 -1.726 3.008 -1.302 9.222 30.968 -4.477 -1.569 2.376 16.801 2.372 32.306 9 AA_G12G13:C32C33_BB A 12 ? B 33 ? A 13 ? B 32 ? 1 A G 13 1_555 B C 10 1_555 A U 14 1_555 B A 9 1_555 -0.272 -1.486 3.371 0.410 2.441 34.058 -2.923 0.529 3.257 4.160 -0.699 34.145 10 AA_G13U14:A31C32_BB A 13 ? B 32 ? A 14 ? B 31 ? 1 A U 14 1_555 B A 9 1_555 A G 15 1_555 B C 8 1_555 0.320 -1.681 2.894 3.304 9.138 31.948 -4.175 -0.107 2.357 16.141 -5.837 33.356 11 AA_U14G15:C30A31_BB A 14 ? B 31 ? A 15 ? B 30 ? 1 A G 18 1_555 B C 6 1_555 A U 19 1_555 B U 5 1_555 -1.180 -2.106 3.505 0.101 2.869 39.687 -3.443 1.746 3.348 4.219 -0.148 39.787 12 AA_G18U19:U27C28_BB A 18 ? B 28 ? A 19 ? B 27 ? 1 A U 19 1_555 B U 5 1_555 A C 20 1_555 B G 4 1_555 0.292 -2.410 3.250 1.079 2.988 22.176 -7.254 -0.371 2.915 7.716 -2.787 22.399 13 AA_U19C20:G26U27_BB A 19 ? B 27 ? A 20 ? B 26 ? 1 A C 20 1_555 B G 4 1_555 A G 21 1_555 B C 3 1_555 0.119 -1.780 3.093 -0.657 5.192 32.406 -3.956 -0.313 2.779 9.229 1.169 32.814 14 AA_C20G21:C25G26_BB A 20 ? B 26 ? A 21 ? B 25 ? 1 A G 21 1_555 B C 3 1_555 A C 22 1_555 B G 2 1_555 0.392 -2.225 3.215 4.375 1.489 29.108 -4.684 0.139 3.123 2.940 -8.636 29.464 15 AA_G21C22:G24C25_BB A 21 ? B 25 ? A 22 ? B 24 ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 1LC4 _pdbx_initial_refinement_model.details 'PDB ENTRY 1LC4 (RNA ONLY)' # _atom_sites.entry_id 1MWL _atom_sites.fract_transf_matrix[1][1] 0.021645 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.005449 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.030139 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019930 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_